SNP (Single Nucleotide Polymorphism) molecular marker related to horse body height character and application of SNP molecular marker

Abstract

The invention relates to the technical field of animal breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to a horse body height character and application of the SNP molecular marker. The SNP molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, the 151st site of the nucleotide sequence is a polymorphic site, and the polymorphism is A / G. The SNP molecular marker related to the horse body height character is obtained through screening, can be used for molecular marker-assisted breeding of large horse varieties, is not limited by the age, gender and the like of horses, and can be used for breeding the large horse varieties, accelerating establishment of horse populations with excellent body shape characters and improving the breeding speed of excellent varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, and in particular to a SNP molecular marker related to horse body height traits and an application thereof. Background Art

[0002] Horses are one of the important livestock resources, and their body shape characteristics directly affect their athletic performance, reproductive ability and economic value. Horse breed resources are rich. After a long period of natural selection and artificial breeding, a variety of breeds that adapt to different environments and uses have been formed. Body shape, including body height, body length, chest circumference, tube circumference, etc., is a complex trait controlled by multiple genes and is one of the most important traits in the process of horse domestication and breeding. Body height, as a key indicator of body shape, has a significant impact on the horse's athletic ability, load capacity and economic value. Horses with taller bodies are usually more robust and have better athletic performance, especially in horse racing, riding and agricultural labor. They can better meet market demand and improve economic benefits. Through scientific selection and genetic improvement, breeding horse breeds with excellent body shape can not only improve the comprehensive performance of horses, but also provide important support for the development of animal husbandry.

[0003] With the increasing demand for high-performance horses, especially in the fields of horse racing, riding and agricultural labor, the market demand for horses with large bodies and strong athletic ability continues to grow. Breeding large-sized, high-performance horse breeds can better meet these market demands and promote the sustainable development of the horse industry. The size and athletic performance of horses are the result of the combined effects of multiple factors such as genetics, nutrition, training and environment. With the rapid development of molecular genetic technologies such as molecular marker-assisted selection, studying the main effect genes of the main performance of horses has become a hot area. Using the polymorphic sites of candidate genes as molecular auxiliary markers of the genetic effects of horse traits, and then accurately breeding horses, provides a new idea for improving their athletic performance, reproductive ability and disease resistance. Therefore, it is of great practical significance to develop horse-specific molecular markers and apply them to the breeding of large-sized, high-performance horses. The application of these molecular markers will significantly improve the efficiency and accuracy of breeding, accelerate the process of genetic improvement, optimize gene combinations, thereby improving the comprehensive performance and economic benefits of horses, and provide strong scientific and technological support for the modernization and high-quality development of the horse industry.

[0004] Insulin-like growth factor binding protein 1 (IGFBP1) is a secretory protein that binds to IGF in the extracellular environment. As a basic mediator of cell growth, development and survival, it is expressed in most tissues. Studies have shown that height is moderately positively correlated with IGFI and IGFBP3, but significantly negatively correlated with IGFBP1. Knockout of IGFBP1 can significantly alleviate hypoxia-induced growth retardation and developmental delay, while overexpression of IGFBP1 leads to growth and developmental retardation under normal hypoxic conditions. It is worth noting that IGFBP1 itself does not have mitotic activity, but it can inhibit the ability of IGF1 and IGF2 to stimulate cell proliferation by binding to them. When excessive amounts of IGF1 or IGF2 are added, this inhibitory effect disappears, indicating that IGFBP1 mainly regulates embryonic growth and development by binding to and inhibiting the activity of IGF. In addition, studies have found that height and body mass index are closely related to IGFBP1 and IGFBP2. IGFBP1 mainly regulates the action of growth hormone (GH) by inhibiting the activity of IGF1, thereby affecting bone growth and development. Clinical cases also provide support for the function of IGFBP1. A patient who suffered from severe growth and development disorders since birth had significantly elevated circulating levels of IGFBP1 and low levels of IGF2. The patient showed a good response to growth hormone (GH) drug treatment, further demonstrating the key role of IGFBP1 in growth regulation. It can be seen that IGFBP1 plays a key role in height growth and bone development by regulating the biological activity of IGF1. In-depth research on the mechanism of action of IGFBP1 in individual growth and its effect on body height is of great significance to basic biological research and will help breed large horse breeds. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a SNP molecular marker related to horse height traits and application thereof.

[0006] The present invention screened and obtained a SNP molecular marker related to the height trait of the horse body. The SNP molecular marker is based on the EquCab3.0 version number, is located at the 16223041bp position of the horse chromosome 4, and has a polymorphism of A / G.

[0007] In a first aspect, the present invention provides a SNP molecular marker, wherein the SNP molecular marker comprises a nucleotide sequence as shown in SEQ ID NO.1, wherein the 151st position of the nucleotide sequence is a polymorphic site, and the polymorphism is A / G.

[0008] For the convenience of detection, the present invention has developed primers for amplifying the SNP molecular marker based on the polymorphic site at the 16223041bp position of chromosome 4 of the horse based on the EquCab3.0 version genome and its upstream and downstream sequences. In combination with the upstream and downstream sequences of the polymorphic site, the present invention obtains the sequence shown in SEQ ID NO.1. It can be understood by those skilled in the art that based on the above-mentioned polymorphic site and its upstream and downstream sequences, sequence fragments of different lengths can be developed as SNP molecular markers for amplification and detection of the site. Therefore, the sequence shown in SEQ ID NO:1 does not constitute a limitation to the SNP molecular marker of the present invention, as long as the sequence fragments containing the polymorphic site at the 16223041bp position of chromosome 4 of the EquCab3.0 version horse reference genome are within the protection scope of the SNP molecular marker of the present invention.

[0009] The nucleotide sequence shown in SEQ ID NO.1: CTGTCTCGCGCTTGGACTCGGAGGAGAAGTTCTGGGTGTCTGTGCTCTGAGACTCGTAGTCGACCTTGTAGCGCTGGCTGTCCTTGGCATGGCCTTTCTTGATGACGTCCATCTTGGTGTGGATCGTGTGGAATTTGGGGTCCGGCATGCR GTGTGTGCTGGGCACGGCCTGGTTGTCCACACTCCCTGCGCTGTGGTCCTCCTCCGACTCACTGCTGTTTCCTTGAAAAGCACAAGGGACACAAAGACTGTTATGGATATTTAATGACATTCTTCTTAAAATCTTACTACTGCGACCAAG.

[0010] Furthermore, the genotype AA or AG of the SNP molecular marker corresponds to the high body height trait, and the genotype GG of the SNP molecular marker corresponds to the low body height trait.

[0011] In a second aspect, the present invention provides a primer pair, wherein the primer pair is used to amplify the aforementioned SNP molecular marker.

[0012] According to the location of the polymorphic site of the SNP molecular marker provided above and its upstream and downstream sequences, those skilled in the art can develop various types of primers for amplifying the SNP molecular marker. Therefore, the above primers can be any primers that can be used to detect the genotype of the SNP molecular marker.

[0013] Furthermore, the primer pair includes the nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.2.

[0014] In a third aspect, the present invention provides a kit comprising the aforementioned molecular marker or the aforementioned primer pair.

[0015] The above-mentioned kit may also contain other reagents for PCR amplification, including: PCR reaction buffer, DNA polymerase, probe, dNTP, Mg 2+ and one or more of water.

[0016] In a fourth aspect, the present invention provides the use of SNP sites as targets in any of the following: (1) IGFBP1 genotyping, (2) predicting or detecting the height trait of a horse, or preparing a reagent for predicting or detecting the height trait of a horse, (3) Screening or identifying horse breeds with high body and tall traits, or preparing reagents for screening or identifying horse breeds with high body and tall traits, (4) Molecular marker-assisted breeding of horse body traits, (5) Improvement of horse breeds related to height traits, (6) Selective breeding for height in horses, (7) Improvement of horse germplasm resources, The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

[0017] The target of the present invention means that any detection reagent that can detect the polymorphism of the target can be designed for the target, such as a primer pair or a probe.

[0018] In a fifth aspect, the present invention provides an application of the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned kit in any of the following: (1) IGFBP1 genotyping, (2) predicting or detecting the height trait of a horse, or preparing a reagent for predicting or detecting the height trait of a horse, (3) Screening or identifying horse breeds with high body and tall traits, or preparing reagents for screening or identifying horse breeds with high body and tall traits, (4) Molecular marker-assisted breeding of horse body traits, (5) Improvement of horse breeds related to height traits, (6) Selective breeding for height in horses, (7) Improvement of horse germplasm resources.

[0019] Furthermore, the aforementioned IGFBP1 gene may be an IGFBP1 gene from any source, such as the gene numbered ENSG00000146678.

[0020] Furthermore, predicting the horse's body height trait is an early prediction of the horse's body height trait.

[0021] In a sixth aspect, the present invention provides a method for detecting the height trait of a horse, comprising: Detecting the polymorphism of the SNP site of the test horse, and determining the height trait of the test horse according to the detection result; The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

[0022] Furthermore, judging the height trait of the horse to be tested according to the test result includes: Horses whose genotype test results of the SNP site are AA or AG have a higher body height trait than horses whose test results are GG.

[0023] In a seventh aspect, the present invention provides a method for breeding a horse breed with high body and high traits, comprising: When breeding, the SNP locus genotypes of the horse population are collected, and horses with genotypes of AA or AG are used for breeding; Collecting the SNP site genotypes of the born horses, and retaining the individuals with genotype AA or AG; The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

[0024] In an eighth aspect, the present invention provides a method for breeding horses with high body traits, comprising: By testing the genotypes of the aforementioned SNP sites for reserve stallions, selecting individuals with genotypes of AA or AG as reserve stallions, and eliminating stallion individuals with GG genotypes, horses with tall body traits can be bred as reserve stallions, thereby achieving the selection of stallions with tall body traits.

[0025] In a ninth aspect, the present invention provides a method for genetic improvement of horses, comprising: detecting the genotype of the aforementioned SNP loci in reserve stallions, selecting individuals with genotypes of AA or AG, and eliminating individuals with genotypes of GG; Individuals with genotype AA or AG are used as stallions for breeding, and stallion individuals with genotype AA or AG continue to be selected in the offspring, while individuals with genotype GG are eliminated, so as to increase the frequency of allele A in the offspring horse population generation by generation, thereby reducing the proportion of low body height in the offspring stallions.

[0026] The horse described in the present invention can be either an adult horse or a foal.

[0027] The present invention has the following beneficial effects: (1) The present invention screened and identified a molecular marker related to the horse height trait. The molecular marker showed extremely significant differences in the height of horses with different genotypes; the average height of genotypes AA or AG was 161.27 cm, and the average height of genotypes GG was 122.67 cm. The A allele significantly increased the height. The AA or AG genotype was the dominant genotype, corresponding to the high height trait. Therefore, by applying the molecular marker, the height of horses can be greatly improved, thereby increasing the slaughter rate and meat production of horses, affecting their production performance, and accelerating the genetic improvement and breeding process of stallions.

[0028] (2) By detecting the genotype of the molecular markers related to the horse height trait provided by the present invention to assist in stallion breeding, the horse height can be effectively improved by selecting stallions with AA or AG genotypes, thereby facilitating the comprehensive breeding of subsequent stallions.

[0029] (3) By applying the molecular markers related to the horse height trait provided by the present invention to the selection of high body height traits, the selected horses can greatly improve their body height, thereby increasing the slaughter rate and meat yield, and improving the production performance of stallions.

[0030] (4) By applying the molecular markers related to the horse height trait provided by the present invention to the breeding of horse breeds with high body height traits, a horse breed with high body height can be obtained, thereby improving the slaughter rate, meat production, etc. of the horses of this breed, improving the production performance of the horses of this breed, and accelerating the genetic improvement progress and breeding process of stallions.

[0031] (5) By applying the molecular markers related to the high horse body traits provided by the present invention to the genetic improvement of horses, the genetic breeding period can be greatly shortened, the horse slaughter rate can be improved, and the genetic improvement progress and breeding process of stallions can be accelerated.

[0032] (6) By applying the molecular markers related to the horse height trait provided by the present invention to the screening of foals with the genetic trait of high body height, stallions with high body height can be screened out at the foal stage and selected, thereby realizing the selection and breeding of stallions with the high body height trait at the foal stage, which can greatly improve the breeding efficiency and save the feeding cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0034] Figure 1 The height phenotype statistical diagram of the high-body tall group of horses and the low-body tall group of horses provided in Example 1 of the present invention; wherein, Indicates P<0.0001.

[0035] Figure 2 This is a Manhattan plot of the genome-wide SNP effect distribution of horse height traits provided in Example 2 of the present invention; wherein, the upper figure is a Manhattan plot of the three selection signals FST, XPCLR and XPEHH, wherein the selected position in the box represents the genomic position of the IGFBP1 gene rs395786667 molecular marker.

[0036] Figure 3 This is a Venn diagram of genes screened out from the three selection signal methods between the high body high group and the low body high group provided in Example 2 of the present invention.

[0037] Figure 4 This is a gene locus frequency diagram between the high body high group and the low body high group provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0038] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] The experimental methods involved in the following examples, unless otherwise mentioned, are all routine methods in the art. For example, reference can be made to experimental manuals in the art, such as Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, or the conditions recommended in the manufacturer's instructions.

[0040] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0041] Example 1 Acquisition of SNP Molecular Markers 1. Based on the National Domestic Animal Germplasm Resource Bank, ear tissue samples or blood samples of high-body height group and low-body height group horse breeds were collected, total DNA was extracted, DNA quality control was performed, and the DNA was sent to a sequencing company for high-depth whole genome resequencing, with an average sequencing depth of about 10×. Phenotypic data such as growth performance determination of corresponding horse breeds were collected, among which the average height of the high-body height group was 161.27cm, and the average height of the low-body height group was 122.67cm (e.g. Figure 1 as shown).

[0042] 2. Sort out the fastq files downloaded from the sequencing company. Eliminate reads that do not meet the standards and have poor quality. After quality control and filtering of the raw data, obtain high-quality sequencing data. Use the MEM algorithm of BWA (Version 0.7.15) software to align the Clean Data to the horse reference genome (EquCab3.0) to obtain the initial bam file, and use SAMtools (Version 1.9) software to sort the bam file and remove PCR duplicates.

[0043] 3. First, the HaplotypeCaller module of GATK (Version 4.1.4.0) software was used to detect variants in all individuals and generate gvcf files. The CombineGVCFs function of GATK software was used to merge the gvcf files of all individuals, and finally genotyping was performed using GenotypeGVCFs. Only autosomes were used for subsequent analysis, and the generated vcf files were initially filtered using the SelectVariants function. SNP filtering conditions: QD60.0, MQ3.0, ReadPosRankSum<-8.0, MQRankSum<-12.5. GATK4 was used to detect variants in 241 samples, and hard filtering was performed (QD<-2.0||ReadPosRankSum<-8.0||FS>60.0||MD<40.0||SOR>3.0||efMQRankSum<-12.5||QUAL<30).

[0044] After quality control, 241 domestic and foreign horse breed individuals and 10,714,899 SNPs were used for subsequent genome-wide selection signal analysis.

[0045] Example 2 Validation of molecular markers associated with horse height traits 1. The research population consisted of 241 domestic and foreign horse breeds, and the samples were from the National Livestock and Poultry Germplasm Resources Bank.

[0046] 2. Using VCFtools (Version 0.1.16) software, the FST of the high body high group and the low body high group was calculated, with the parameters of window length 50kb and step length 10kb. Using XPCLR (Version 1.1.2) software, the XPCLR of the high body high group and the low body high group was calculated, with the parameters of window length 50kb and step length 10kb. Using Selscan (Version 2.0.0) software, the XPEHH of the high body high group and the low body high group was calculated. The top 5% windows with the strongest signal values ​​were selected as significant areas. The analysis results were visualized using ggplot2 (Version 3.4.4) software in R (Version4.3.2) ( Figure 2 ). The three methods annotated 1319, 825 and 433 salient regions respectively ( Figure 3 , among which the three methods jointly identified 85 significantly associated genes, including the IGFBP1 gene). The intersection of the three screening methods annotated a total of 85 genes (including the IGFBP1 gene). The visualization results showed that in chromosome 4, within the 16.18MB-16.23MB region, this gene region was selected in the high-body high group and the low-body high group. By using VCFtools software to calculate the FST value of a single point in the high-body high group and the low-body high group, the FST value of the SNP molecular marker (rs395786667) was 0.887464 (indicating a significant allele frequency difference between the two groups).

[0047] 3. Plink (Version 1.90) software was used to calculate the genotype significance of the rs395786667 molecular marker site (located in the second exon of the IGFBP1 gene) between the high-body-high group and the low-body-high group. The results of the Fisher test and the chi-square test showed that the difference in this site between the high-body-high group and the low-body-high group was extremely significant (P<0.01) (e.g. Figure 4 as shown).

[0048] The above results indicate that the present invention verified the function of the rs395786667 molecular marker (a SNP molecular marker located at the 16223041bp position of horse chromosome 4, with a polymorphism of A / G) through a group of 241 domestic and foreign horse breeds. The A allele at this site significantly increases body height, and the AA or AG genotype is the dominant genotype, corresponding to the high body height trait.

[0049] Example 3 Application of SNP molecular markers in horse breeding for high-quality traits The reserve stallions are tested for rs395786667 molecular markers; individuals with the AA or AG genotype obtained by the test are selected as the reserve stallions, and the GG genotype stallion individuals are eliminated. Horses with high body height traits can be selected as reserve stallions to achieve the selection of stallions for body height traits.

[0050] The specific method for amplifying the rs395786667 molecular marker is as follows: 1. Primer pairs include: Forward primer (SEQ ID NO: 2): 5′-AGGGAGTGTGGACAACCAGG-3′; Reverse primer (SEQ ID NO:3): 5′-TGTCTGTGCTCTGAGACTCG-3′.

[0051] 2. The PCR amplification method is as follows: (1) Extracting genomic DNA from the horse to be tested; (2) using genomic DNA as a template and performing PCR amplification using the primers shown in SEQ ID NO: 2-3; (3) Analyze the PCR amplification products.

[0052] 3. PCR reaction system The amplification system (50 μL) includes: 1 μL of 100 ng / μL template DNA, 1 μL of 10 pmol / μL forward primer and reverse primer, 1 μL of 10 mmol / L dNTP Mixture, 1 μL of 1.25 U / 25 μL TaKaRa Ex Taq DNA polymerase, 25 μL of 2× PCR reaction buffer, and the balance is double distilled water.

[0053] 4. PCR reaction procedure The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C or 60°C for 30 s, extension at 72°C for 1-2 min, for a total of 30-35 cycles; and insulation at 72°C for 2 min.

[0054] For the PCR amplification product obtained, gene sequencing (a highly commercialized method) can be used to directly detect the type of nucleotide at position 151, and the gene can be determined to be AA, AG, or GG based on the gene sequencing results.

[0055] Example 4 Application of SNP molecular markers in breeding tall and high-trait horse strains The reserve stallions are tested for rs395786667 molecular markers; individuals with AA or AG genotypes obtained by the test are selected as breeding horses, and the breeding males and females are bred; the horses born from the breeding are tested for rs395786667 molecular markers, the AA or AG genotype individuals are retained, and the GG genotype individuals are eliminated for breeding, so as to cultivate a high-performance horse breed with high body and high traits.

[0056] The method for detecting the rs395786667 molecular marker in this embodiment is the same as that in Example 3.

[0057] Example 5 A method for genetic improvement of horses Detect the rs395786667 molecular marker in reserve stallions; select stallion individuals with genotype AA or AG, and eliminate individuals with GG genotype; use the screened individuals as stallions for breeding, and continue to select stallion individuals with rs395786667 molecular marker genotype AA or AG in the offspring, and eliminate individuals with GG genotype; thereby increasing the frequency of allele A in the offspring horse population generation by generation, thereby increasing the height of the offspring stallions.

[0058] The method for detecting the rs395786667 molecular marker in this embodiment is the same as that in Example 3.

[0059] Example 6 Application of SNP molecular markers in screening tall body and high trait foals The rs395786667 molecular marker is detected in the foal to be screened; when the genotype of the detected molecular marker is AA or AG, the foal to be screened has a high genetic trait of tall body and is retained; when the genotype is GG, the foal to be screened has a low genetic trait of tall body and is eliminated.

[0060] The method for detecting the rs395786667 molecular marker in this embodiment is the same as that in Example 3.

[0061] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A SNP molecular marker, characterized in that: The SNP molecular marker includes a nucleotide sequence as shown in SEQ ID NO.1, and the 151st position of the nucleotide sequence is a polymorphic site, and the polymorphism is A / G.

2. The SNP molecular marker according to claim 1, characterized in that: The genotype AA or AG of the SNP molecular marker corresponds to the high body height trait, and the genotype GG of the SNP molecular marker corresponds to the low body height trait.

3. A primer pair, characterized in that: The primer pair is used to amplify the SNP molecular marker as described in claim 1 or 2.

4. The primer pair according to claim 3, characterized in that: The primer pair includes the nucleotide sequences shown as SEQ ID NO.1 and SEQ ID NO.

2.

5. A kit, characterized in that: It comprises the molecular marker according to claim 1 or 2, or the primer pair according to claim 3.

6. Application of SNP sites as targets in any of the following: (1) IGFBP1 genotyping, (2) predicting or detecting the height trait of a horse, or preparing a reagent for predicting or detecting the height trait of a horse, (3) Screening or identifying horse breeds with high body and tall traits, or preparing reagents for screening or identifying horse breeds with high body and tall traits, (4) Molecular marker-assisted breeding of horse body traits, (5) Improvement of horse breeds related to height traits, (6) Selective breeding for height in horses, (7) Improvement of horse germplasm resources, The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

7. Use of the molecular marker according to claim 1 or 2, or the primer pair according to claim 3 or 4, or the kit according to claim 5 in any of the following: (1) IGFBP1 genotyping, (2) predicting or detecting the height trait of a horse, or preparing a reagent for predicting or detecting the height trait of a horse, (3) Screening or identifying horse breeds with high body and tall traits, or preparing reagents for screening or identifying horse breeds with high body and tall traits, (4) Molecular marker-assisted breeding of horse body traits, (5) Improvement of horse breeds related to height traits, (6) Selective breeding for height in horses, (7) Improvement of horse germplasm resources.

8. A method for detecting the height trait of a horse, characterized in that: include: Detecting the polymorphism of the SNP site of the test horse, and determining the height trait of the test horse according to the detection result; The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

9. The method according to claim 8, characterized in that The step of determining the height trait of the horse to be tested according to the test result comprises: Horses whose genotype test results of the SNP site are AA or AG have a higher body height trait than horses whose test results are GG.

10. A method for breeding a horse breed with high body and high traits, characterized in that: include: When breeding, the SNP locus genotypes of the horse population are collected, and horses with genotypes of AA or AG are used for breeding; Collecting the SNP site genotypes of the born horses, and retaining the individuals with genotype AA or AG; The SNP site is based on EquCab 3.0 version, and is located at the SNP molecular marker at the 16223041bp position of horse chromosome 4, and the polymorphism is A / G.

Images