A method for regulating the synthesis of ectoine in Escherichia coli
By introducing tisB poison protein gene fragment and constitutive promoter 2-22 in E. coli, an engineered strain spontaneously inhibits tetrahydropyrimidine synthesis was constructed, which solved the problem of active response of gene circuits under the condition of no inducer, reduced the risk of leaking of engineered bacteria and improved biosafety.
Patent Information
- Application Number
- CN202510354628.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2045-03-25
AI Technical Summary
The existing biological control gene circuits are difficult to respond actively under the conditions of no inducer, resulting in an increase in the risk of engineering bacteria leakage and affecting the safety of trade secrets.
By introducing gene fragments of tisB poison protein in E. coli, the tisB poison protein expression vector is constructed, and the expression of tisB poison protein is controlled by using the constitutive promoters 2-22 to achieve spontaneous inhibition of tetrahydropyrimidine synthesis and constructing an engineering strain that spontaneously inhibits tetrahydropyrimidine synthesis.
After multiple rounds of fermentation, tetrahydropyrimidine synthesis is spontaneously inhibited, ensuring normal early synthesis, reducing the long-term survival and transmission risks of engineered bacteria, and improving biosafety.
Smart Images

Figure CN119859649B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biological medicine technology, and more specifically, relates to a method for regulating the synthesis of ectoine in Escherichia coli. Background Art
[0002] With the wide application of ectoine in fields such as cosmetics and biological medicine, its market demand is continuously increasing. Constructing high-yield ectoine cell factories through means such as metabolic engineering has become an important current research direction. The highest yield of ectoine in engineered Escherichia coli has reached a relatively high level, providing strong support for industrial production.
[0003] tisB Toxic proteins play an important physiological role in bacteria and are a component of the toxin-antitoxin system. The toxin-antitoxin system widely exists in bacterial and fungal cells and consists of a pair of small genetic control elements encoded by a toxin gene and an antitoxin gene. Among them, the toxin gene encodes a stable protein molecule, such as tisB a toxic protein, while the antitoxin gene encodes a protein with poor stability or a regulatory RNA. tisB The specific functions and action mechanisms of toxic proteins are still under study. What is known is that the toxin-antitoxin system is involved in various physiological processes of bacteria, including cell growth, division, and persister formation. tisB Toxic proteins may exert toxic effects by affecting cell membrane permeability, interfering with intracellular metabolic processes, or interacting with other cellular components. In addition, tisB the study of toxic proteins is of great significance for understanding the pathogenic mechanisms of bacteria, developing new antibacterial drugs, and biotechnological applications. By deeply studying tisB the structure, function, and regulatory mechanisms of toxic proteins, new ideas and methods can be provided for the treatment and prevention of bacterial infections.
[0004] During the process of strain modification and metabolic optimization, using promoters with different strengths to finely regulate the expression of target genes is one of the common strategies, coordinating the synthesis and utilization of various intermediate metabolites to improve the synthesis efficiency of metabolic products. Many different-strength constitutive promoters in Escherichia coli have been characterized. However, the regulatory elements of existing biological control gene circuits usually require additional inducers as signals, which makes the existing control circuits lack the ability to actively respond under the condition of no inducer and are difficult to play an active role after the engineered bacteria leak. The leaked engineered bacteria may survive and spread for a long time, increasing the risk of commercial secret leakage. Summary of the Invention
[0005] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a method for regulating the synthesis of ectoine in Escherichia coli, which is used to regulate the synthesis of ectoine in Escherichia coli at different stages.
[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:
[0007] A method for regulating the synthesis of ectoine in Escherichia coli, comprising: tisB The gene fragment of the toxic protein is transferred into the ectoine synthesis strain to obtain an engineered bacterium that spontaneously inhibits the synthesis of ectoine; tisB The nucleotide sequence of the gene fragment of the toxin protein is shown in SEQ ID NO.1.
[0008] The method comprises:
[0009] 1) Build tisB Toxin protein expression vector;
[0010] 2) The constructed tisB Transformation of ectoine-synthesizing strains with toxin protein expression vector E . coli Ect, an engineered bacterium that spontaneously inhibits the synthesis of ectoine E . coli Ect pET28a(+)-p2-22- tisB .
[0011] Said tisB The toxic protein expression vector is pET28a(+)-p2-22- tisB .
[0012] Said tisB Toxin protein expression vector pET28a(+)-p2-22- tisB The construction method is: tisB The gene fragment of the toxic protein was constructed into the pET28a(+) vector to obtain the recombinant expression vector pET28a(+)- tisB ; The constitutive promoter 2-22 fragment was constructed into the recombinant expression vector pET28a(+)- tisB On, get tisB Toxin protein expression vector pET28a(+)-p2-22- tisB ;
[0013] Said tisB The nucleotide sequence of the gene fragment of the toxin protein is shown in SEQ ID NO.1;
[0014] The nucleotide sequence of the constitutive promoter 2-22 fragment is shown in SEQ ID NO.2.
[0015] The method described above specifically includes the following steps:
[0016] 1) Construct the gene fragment of the tisB toxin protein onto the pET28a(+) vector to obtain the recombinant expression vector pET28a(+)- tisB ; construct the constitutive promoter 2-22 fragment onto the recombinant expression vector pET28a(+)- tisB to obtain tisB the toxin protein expression vector pET28a(+)-p2-22- tisB ; the nucleotide sequence of the tisB gene fragment of the toxin protein is as shown in SEQ ID NO.1; the nucleotide sequence of the constitutive promoter 2-22 fragment is as shown in SEQ ID NO.2;
[0017] 2) Incubate 50 ng of the recombinant expression vector pET28a(+)-p2-22- tisB with the ectoine synthesis strain E . coli Ect competent cells on ice for 30 min, then perform heat shock at 42 °C for 90 s for transformation to obtain the engineered strain E . coli Ect pET28a(+)-p2-22- tisB .
[0018] tisB Application of the toxin protein expression vector pET28a(+)-p2-22- tisB in regulating ectoine synthesis in Escherichia coli.
[0019] The tisB construction method of the toxin protein expression vector pET28a(+)-p2-22- tisB is as follows: construct the gene fragment of the tisB toxin protein onto the pET28a(+) vector to obtain the recombinant expression vector pET28a(+)- tisB ; construct the constitutive promoter 2-22 fragment onto the recombinant expression vector pET28a(+)- tisB to obtain tisB the toxin protein expression vector pET28a(+)-p2-22- tisB ;
[0020] The tisB nucleotide sequence of the gene fragment of the toxin protein is as shown in SEQ ID NO.1;
[0021] the nucleotide sequence of the constitutive promoter 2-22 fragment is as shown in SEQ ID NO.2.
[0022] The described application specifically includes the following steps:
[0023] 1) Construct the gene fragment of the tisB toxin protein onto the pET28a(+) vector to obtain the recombinant expression vector pET28a(+)- tisB ; construct the constitutive promoter 2-22 fragment onto the recombinant expression vector pET28a(+)- tisB to obtain tisB the toxin protein expression vector pET28a(+)-p2-22- tisB ;
[0024] The tisB nucleotide sequence of the gene fragment of the toxin protein is as shown in SEQ ID NO.1;
[0025] The nucleotide sequence of the constitutive promoter 2-22 fragment is as shown in SEQ ID NO.2;
[0026] 2) Incubate 50 ng of the recombinant expression vector pET28a(+)-p2-22- tisB with the ectoine-synthesizing strain E . coli Ect competent cells on ice for 30 min, then heat shock at 42°C for 90 s to transform and obtain the engineered strain E . coli Ect pET28a(+)-p2-22- tisB that spontaneously inhibits ectoine synthesis.
[0027] The E . coli engineered strain tisB Ect pET28a(+)-p2-22-
[0028] stops synthesizing ectoine after multiple rounds of cyclic fermentation culture.
[0029] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0030] 1) Starting from the Escherichia coli engineered strain for synthesizing ectoine, using pET28a(+) as the expression vector, by constructing the expression cassette of the TisB toxin protein gene, which is controlled by the constitutive promoter 2-22 for expression, a recombinant engineered strain E . coli Ect pET28a(+)-p2-22- tisB that can spontaneously inhibit ectoine synthesis after multiple rounds of fermentation is obtained.
[0031] 2) The engineered Escherichia coli strain constructed in this application that spontaneously inhibits ectoine synthesis E . coli Ect pET28a(+)-p2-22- tisB After multiple rounds of cyclic fermentation culture, the results showed that the yield of ectoine was approximately 7.269 g / L in the first 3 rounds of fermentation, which was similar to that of the control engineered strain (7.191 g / L). After the 7th round, the yield of ectoine decreased sharply to 2.575 g / L, and at the 20th round of fermentation, the yield of ectoine was zero.
[0032] 3) This application tisB transforms the toxic protein into Escherichia coli to construct an engineered Escherichia coli strain that can spontaneously inhibit ectoine synthesis after multiple rounds of culture fermentation, while ensuring normal synthesis of ectoine in the early stage. This method can be applied to the protection of industrial strains and biosafety protection. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 is tisB a schematic diagram of the toxic protein expression vector pET28a(+)-p2-22- tisB ;
[0034] Figure 2 is the liquid phase diagram of ectoine;
[0035] Figure 3 is the graph of the ectoine yield of the recombinant engineered strain in multiple rounds of culture fermentation. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0036] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described below in conjunction with specific embodiments. In the following embodiments, unless otherwise specified in detail, the technical means used are all conventional means well known to those skilled in the art. Embodiment
[0037] 1. Construction tisB of the toxic protein expression vector
[0038] According to tisB the toxic protein gene sequence (NCBI Reference Sequence: NC_000913.3), the primer sequences are designed as follows:
[0039] tisB -F1:
[0040] 5‘-aactttaagaaggagatataccatggATGAACCTGGTGGATATCGC-3’ (SEQ ID NO.3),
[0041] tisB-R1:
[0042] 5'-caagcttgtcgacggagctcgaattcTTACTTCAGGTATTTCAGAACAGCAT-3' (SEQ ID NO.4);
[0043] tisB -F3:
[0044] 5'-atctcgatcccgcgaaatgaactggttaaggtgatggaca-3' (SEQ ID NO.5),
[0045] tisB -R3:
[0046] 5'-ccttcttaaagttaaacaaaattatttctagagggcctttagtatagcatattaccacc-3' (SEQ ID NO.6).
[0047] The toxic protein gene fragment (SEQ ID NO.1) was amplified using the high-fidelity PCR polymerase Prime Star with primers F1 / R1, tisB and was integrated into pET28a(+) by Gibson assembly and homologous recombination to construct the recombinant expression vector pET28a(+)- tisB . On this basis, using Escherichia coli MG1655 as a template, the constitutive promoter 2-22 fragment (SEQ ID NO.2) was amplified with primers F3 / R3, and was integrated into pET28a(+)- tisB by Gibson assembly and homologous recombination to construct the recombinant expression vector pET28a(+)-p2-22- tisB ( Figure 1 ).
[0048] 2. Construct the ectoine-producing strain ( E . coli Ect)
[0049] Using the genome of Halomonas elongata (CGMCC:1.6329) as a template, the ectABC gene fragment was amplified using primers ectABC-F / ectABC-R; using plasmid pSTOP1622 (MoBiTec) as a template, the xylose repressor protein and the xylose-inducible promoter xylR, PxylA were amplified using primers xylA-F / xylA-R; using the Escherichia coli genome W3110 (ATCC 27325) as a template, the upstream homologous arm was amplified using primers upstream yghX-F / upstream yghX-R, and the downstream homologous arm was amplified using primers downstream yghX-F / downstream yghX-R; using Gibson assembly, the upstream homologous arm, the downstream homologous arm, ectABC, xylR, and PxylA were assembled into "upstream homologous arm of the ectABC expression cassette - xylR - PxylA - ectABC - downstream homologous arm"; using pGRB as a template, the gRNA expression vector pGRB – yghX was constructed using primers pGRB-F / pGRB-R; the "upstream homologous arm of the ectABC expression cassette - xylR - PxylA - ectABC - downstream homologous arm" was combined with the gRNA expression vector pGRB – yghX and E. coli The competent cells of W3110 were incubated together on ice for 30 min, then electrotransformed at 1800 v and plated on an LB plate containing 50 mg / L Amp resistance and 50 mg / L spectinomycin. Single colonies were picked using xylA-F / ectABC-R as primers for PCR verification of positive clones; the positive clones were cultured overnight at 37 °C and 200 rpm to obtain the ectoine-producing strain by losing the plasmid pREDCas9 E . coli Ect.
[0050] Table 1 Primer sequences
[0051] Primer Sequence (5' to 3') ectABC-F ATGAACGCAACCACAGAGCC (SEQ ID NO.7) ectABC-R TTACAGCGGCTTCTGGTCGT (SEQ ID NO.8) xylA-F ctaacttataggggtaacacttaaaaaagaatcaat (SEQ ID NO.9) xylA-R GGCTCTGTGGTTGCGTTCATtatctcatcatatacaaaataaatgtttatttcaatgtttttttt (SEQ ID NO.10) Upstream yghX-F gctcaccggcaaccatgc (SEQ ID NO.11) Upstream yghX-R ATTGATTCTTTTTTAAGTGTTACCCCTATAAGTTAGtaggtttatctcttacgggattacgtcttaaac (SEQ ID NO.12) Downstream yghX-F ACGACCAGAAGCCGCTGTAAcagtttgttggatcaacctgctg (SEQ ID NO.13) Downstream yghX-R ggctttggtcgaggctgg (SEQ ID NO.14) pGRB-F1 GACAGCTAGCTCAGTCCTAGGTATAATACTAGTgcggcagatttgtcataacggggTTTTTCGGTGATGACGGTGAAAACC (SEQ ID NO.15) pGRB-R1 GGTTTTCACCGTCATCACCGAAAAAACTAGTATTATACCTAGGACTGAGCTAGCTGTC (SEQ ID NO.16) pGRB-F2 GACAGCTAGCTCAGTCCTAGGTATAATACTAGTaggccagccctcgttgattcgggTTTTTCGGTGATGACGGTGAAAACC (SEQ ID NO.17) pGRB-R2 GGTTTTCACCGTCATCACCGAAAAAACTAGTATTATACCTAGGACTGAGCTAGCTGTC (SEQ ID NO.18) pGRB-F3 GACAGCTAGCTCAGTCCTAGGTATAATACTAGTatcttcgccacatcggcagtgggTTTTTCGGTGATGACGGTGAAAACC (SEQ ID NO.19) pGRB-R3 GGTTTTCACCGTCATCACCGAAAAAACTAGTATTATACCTAGGACTGAGCTAGCTGTC (SEQ ID NO.20)
[0052] 3. Construction of recombinant engineering bacteria.
[0053] 50 ng of the recombinant expression vector pET28a(+)-p2-22- tisB was incubated together with the competent cells of the Escherichia coli engineering bacteria for synthesizing ectoine ( E . coli Ect) on ice for 30 min, and then heat-shocked at 42 °C for 90 s for transformation to obtain the recombinant engineering bacteria expressing strain E . coli Ect pET28a(+)-p2-22- tisB .
[0054] 4. Cultivation of recombinant engineering bacteria
[0055] Pick the recombinant Escherichia coli expression strain E . coli Ect pET28a(+)-p2-22- tisB Single colony was inoculated into 5 mL of LB medium (added with kanamycin at a final concentration of 50 mg / L), and cultured at 37 °C with 200 rpm cultured overnight to obtain the seed culture solution of the recombinant engineering bacteria.
[0056] 5. Multi-round culture of the recombinant engineering bacteria
[0057] Glycerol was added to the seed culture solution of the recombinant engineering bacteria as the first round. A small amount of bacterial solution was picked up with an inoculation loop and streaked on an LB plate containing kanamycin for the second round. After incubation at 37 °C for 12 hours, a little colony was picked up with an inoculation loop and transferred to a fresh kanamycin LB plate with kanamycin, and then incubated for another 12 hours to obtain the third round, and so on in a cycle.
[0058] Recombinant strains of different rounds were transferred at a ratio of 1% (v / v) to 50 mL of fermentation medium (2 g / L of yeast powder, 3 g / L of potassium dihydrogen phosphate, 25 g / L of disodium hydrogen phosphate dodecahydrate, 16.0 g / L of ammonium sulfate, 1 g / L of magnesium sulfate heptahydrate, 0.01 g / L of manganese sulfate heptahydrate, 20 g / L of glucose, kanamycin at a final concentration of 50 mg / L), cultured at 37 °C until the OD600nm reached 0.6 - 0.8, then xylose at a final concentration of 20 g / L was added, and after induction at 37 °C for 48 h, centrifuged at 8000 rpm for 5 min at 4 °C, the supernatant was collected, and the ectoine yield was measured.
[0059] The chromatographic conditions of the preparative liquid high-performance liquid chromatography used were as follows: chromatographic column: Shim-pack GIST C18; mobile phase: 2% acetonitrile / water (v / v); detection wavelength: 210 nm; flow rate: 1 mL / min; column temperature: 35 o °C. The elution time was 10 min, and the elution time of ectoine was 2.9 min ( Figure 2 ).
[0060] The results were as Figure 3 shown. In the first 3 rounds of fermentation, the yield of ectoine was about 7.269 g / L, which was similar to that of the control engineering bacteria (7.191 g / L); after the 7th round, the yield of ectoine decreased sharply to 2.575 g / L, and in the 20th round of fermentation, the yield of ectoine was zero.
[0061] In summary, tisBTransform Escherichia coli with a toxic protein to construct an engineered Escherichia coli strain that can spontaneously inhibit the synthesis of ectoine after multiple rounds of culture and fermentation, while ensuring normal synthesis of ectoine in the early stage. This method can be applied to the protection of industrial strains and biosafety protection.
[0062] The above description is illustrative rather than restrictive to the present invention. Those of ordinary skill in the art understand that many modifications, variations or equivalents can be made without departing from the spirit and scope defined by the appended claims, and all of them will fall within the protection scope of the present invention.
Claims
1. A method for regulating the synthesis of ectoine in Escherichia coli, characterized in that, Transfer the gene of tisB toxin protein into the strain capable of synthesizing ectoine to obtain an engineered strain with reduced ectoine production after multiple rounds of cyclic fermentation. The specific steps include: 1) Construct the gene of the toxic protein onto the pET28a(+) vector to obtain the recombinant expression vector pET28a(+)- tisB ; Construct the constitutive promoter 2-22 onto the recombinant expression vector pET28a(+)- tisB to obtain tisB the toxic protein expression vector pET28a(+)-p2-22- tisB ; tisB The said tisB The nucleotide sequence of the gene of the toxic protein is shown in SEQ ID NO.1; The nucleotide sequence of the constitutive promoter 2-22 is shown in SEQ ID NO.2; 2) Incubate 50 ng of the recombinant expression vector pET28a(+)-p2-22- tisB with Escherichia coli competent cells capable of synthesizing ectoine on ice for 30 min, then perform heat shock at 42 °C for 90 s to transform and obtain engineered bacteria with reduced ectoine production after multiple rounds of fermentation.
2. The tisB application of the toxic protein expression vector pET28a(+)-p2-22- tisB in regulating the synthesis of ectoine in Escherichia coli.
3. The application according to claim 2, characterized in that, After multiple rounds of cyclic fermentation culture, the synthesis of ectoine is stopped.
4. The application according to claim 3, characterized in that The multiple rounds of cyclic fermentation culture are ≥7 rounds of fermentation culture.
Citation Information
Patent Citations
Escherichia coli engineering strain for producing ectoine as well as construction method and application of escherichia coli engineering strain
CN116769813A
Non-resistant plasmid production system and application thereof
CN117187281A