A DNA molecular marker associated with haplotypes of cold-resistance genes in rice and its application

Abstract

This invention relates to the field of functional molecular marker technology, specifically to a DNA molecular marker related to haplotypes of rice cold-resistance genes and its application. The rice cold-resistance gene COLD1 haplotype is composed of SNP145938700 and SNP145938916. When the bases corresponding to these two SNPs are AG, it is a favorable haplotype (Hap2) of the COLD1 gene, indicating strong cold resistance during the budding stage. The molecular marker provided by this invention can be used for haplotype analysis of the COLD1 gene in different rice materials to determine their cold resistance during the budding stage. This allows for the screening of breeding materials with cold resistance during the budding stage through molecular markers, which is more time-saving, labor-saving, efficient, and cost-effective than traditional phenotypic screening. Furthermore, it can be applied to molecular breeding, improving breeding efficiency.

Description

Technical Field

[0001] This invention relates to the field of functional molecular marker technology, specifically to a DNA molecular marker related to a haplotype of a cold-resistant gene in rice and its application. Background Technology

[0002] Currently, low-temperature chilling injury has become a widespread agricultural meteorological disaster across the country, frequently occurring in early rice-growing areas of the middle and lower reaches of the Yangtze River, rice-growing areas in Northeast and Northwest China, double-cropping early rice areas in Sichuan, and single-cropping rice areas in the Yunnan-Guizhou Plateau. Particularly in the early rice production process in the south, frequent "late spring frosts" lead to a decline in rice seedling quality, causing seed rot, seedling rot, and seedling death. However, with global climate change, in recent years, the breeding time for early rice and double-cropping rice in the middle and lower reaches of the Yangtze River and South my country has generally been moved forward, with seedling raising in some areas even starting as early as early March, further increasing the possibility of low-temperature stress during rice sowing and seedling raising. Production practice shows that cultivating and planting early rice or ratooning rice varieties that are cold-resistant during the germination and seedling stages is the most economical and effective way to solve the above problems.

[0003] Cold tolerance during bud and seedling stages is a complex trait controlled by multiple genes, which is easily affected by environmental conditions and exhibits complex interactions. Currently, several related QTLs have been identified and multiple cold tolerance genes have been cloned, such as OsFAD2, OsSAP1, OsRZFP1, CBF1, OsDREB1A, OsCBL1, OsP5CS1, OsABF1, OsCYP20-2, OsPIL1, OsHSP101, OsCPI1, OsTLP1, OsICE1, LTT7, LTG1, COLD1, bZIP73, and HAN1. The COLD1 gene, located on chromosome 4, is an important cold-resistance gene in rice. It acts as a receptor mediating cold stress perception in rice, controlling its resistance to cold stress (0-15℃). COLD1 interacts with the α subunit RGA1 of the plant's G protein heterotrimer, promoting G protein GTPase activity and activating calcium in response to low temperatures. 2+ The COLD1 gene enhances rice's survival ability under low-temperature conditions; this mechanism may play a role in different growth stages of rice, such as the budding and seedling stages. Studies have shown that overexpression of the COLD1 gene can significantly improve the cold resistance of rice, while rice lines lacking or expressing low levels of the COLD1 gene are more sensitive to low temperatures. There is a single nucleotide mutation in the fourth exon region of the COLD1 gene (position 1091 in the CDS region), which is T or C in indica rice and A in japonica rice. This causes the encoded amino acid to change from methionine / threonine to lysine, thus conferring stronger cold resistance in japonica rice seedlings than indica rice.

[0004] Although the function and mechanism of action of the COLD1 gene have been studied in recent years, there are few reports on the differences in cold resistance of different materials caused by the SNP differences in the COLD1 gene regulatory region, which lead to changes in the expression level of the COLD1 gene. Further exploration of favorable haplotypes of the COLD1 gene is lacking. Summary of the Invention

[0005] To address the aforementioned shortcomings in existing technologies, the present invention aims to provide a DNA molecular marker associated with a superior haplotype of the rice cold-resistant gene COLD1. This molecular marker can be used to create new cold-resistant rice germplasm and breed new varieties through MAS (marker-assisted breeding) technology, thereby solving the problem of cold stress during the budding stage in early rice and ratooning rice production.

[0006] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows:

[0007] Firstly, a DNA molecular marker associated with a rice cold tolerance gene haplotype is provided. The rice cold tolerance gene COLD1 haplotype is composed of SNP145938700 and SNP145938916 located in its upstream gene variant. The molecular marker for detecting SNP145938700 is Cold1-1-kasp, used to distinguish T or A bases at physical position 30316708 (SNP145938700); the molecular marker for detecting SNP145938916 is Cold1-2-kasp, used to distinguish G or T bases at physical position 30316924 (SNP145938916); or complementary bases at the above sites.

[0008] The detection primer sequences for the molecular markers Cold1-1-kasp and Cold1-2-kasp are as follows:

[0009] 1)Cold1-1-kasp

[0010] 708FAM:GAAGGTGACCAAGTTCATGCTGTGCTGCGTGCGTTCCT,

[0011] 708HEX:GAAGGTCGGAGTCAACGGATTGTGCTGCGTGCGTTCCA,

[0012] 708C:TCTCCTGTAGCTTCCTCTTC;

[0013] 2)Cold1-2-kasp

[0014] 924FAM:GAAGGTGACCAAGTTCATGCTGCGCGCGCGACGCTAAACTTGCTTG,

[0015] 924HEX:GAAGGTCGGAGTCAACGGATTGCGCGCGCGACGCTAAACTTGCTTT,

[0016] 924C:CGTGGTCTCGCATCTCCCG.

[0017] Secondly, a method for identifying haplotypes of rice cold-resistance genes based on the aforementioned DNA molecular markers is provided. This method employs the kasp molecular marker, and the kasp molecular marker primer combination includes two specific primers and one universal primer. One specific primer has a fluorescent tag FAM attached to its 5' end; after PCR amplification, the product carrying the FAM sequence appears red under fluorescence irradiation. The other specific primer has a fluorescent tag HEX attached to its 5' end; after PCR amplification, the product carrying the HEX sequence appears blue under fluorescence irradiation. If the products show superimposed colors under fluorescence irradiation, the genotype of the rice material being tested is heterozygous.

[0018] The Cold1-1-kasp marker was detected at position 30316708. The PCR product was scanned for fluorescence. If the product showed red fluorescence, the genotype of the Cold1-1-kasp marker in the rice was TT; if the product showed blue fluorescence, the genotype was AA; if the product showed superimposed colors, the genotype was AT heterozygous.

[0019] The Cold1-2-kasp marker was detected at position 30,316,924. The PCR product was scanned for fluorescence signal. If the product showed red fluorescence after irradiation, the genotype of the Cold1-2-kasp marker in the rice was GG; if the product showed blue fluorescence after irradiation, the genotype of the Cold1-2-kasp marker in the rice was TT; if the product showed superimposed colors after irradiation, the genotype of the Cold1-2-kasp marker in the rice was GT heterozygous.

[0020] Furthermore, when the bases detected in SNP145938700 and SNP145938916 are TT or their corresponding complementary bases AA, the haplotype is Hap1; when the bases detected in SNP145938700 and SNP145938916 are AG or their corresponding complementary bases TC, the haplotype is Hap2; when the bases detected in SNP145938700 and SNP145938916 are AT or their corresponding complementary bases TA, the haplotype is Hap3; among them, haplotype Hap2 has the strongest cold tolerance during the budding stage.

[0021] Thirdly, this paper provides the application of the aforementioned DNA molecular markers related to rice cold-resistant gene haplotypes in the detection of superior haplotypes of the COLD1 gene for cold-resistant seedling growth during rice germination, germplasm purification, or variety improvement.

[0022] Fourthly, the application of the aforementioned DNA molecular markers related to rice cold-resistant gene haplotypes in the preparation of tools for detecting superior haplotypes of the COLD1 gene for rice cold-resistant seedling growth during the germination stage, germplasm purification, or variety improvement.

[0023] The beneficial effects of this invention are as follows:

[0024] Using the kasp molecular markers corresponding to the two SNPs of the COLD1 gene developed in this invention, genotyping can be performed on a large number of germplasm resources and new breeding germplasm, and the cold-resistant materials carrying the superior haplotype COLD1 can be identified. This method is more time-saving, labor-saving, efficient, and cost-effective than traditional phenotypic screening. In addition, by using techniques such as hybridization and backcrossing, and by using MAS (molecular marker-assisted breeding) to track the genotypes of SNP145938700 and SNP145938916, targeted improvement of breeding materials can be achieved, thereby improving the cold-resistant ability of the backbone parent materials during the budding stage and thus breeding new cold-resistant varieties of early rice or ratooning rice. Attached Figure Description

[0025] Figure 1 The physical locations of the four SNPs in the COLD1 gene are shown in the example.

[0026] Figure 2 This study analyzed the significant differences in cold tolerance of 493 3K germplasm samples from Hap1 to Hap3 during the budding stage in the examples.

[0027] Figure 3 The percentage of different haplotypes in the 2840 3K germplasm accessions in the example;

[0028] Figure 4 This example shows the distribution of 2840 3K germplasm accessions (Hap1-Hap3) among different subspecies.

[0029] Figure 5Genotyping of SNP145938700 was performed using the molecular marker Cold1-1-kasp.

[0030] Figure 6 Genotyping of SNP145938916 was performed using the molecular marker Cold1-2-kasp.

[0031] Figure 7 This serves to verify the detection results of the molecular markers Cold1-1-kasp and Cold1-2-kasp in the examples;

[0032] Figure 8 The results of the significance analysis of the differences in cold tolerance seedlings at the budding stage of 35 rice parents (conventional rice) Hap1 to Hap3 in the examples;

[0033] Figure 9 The results are from the Sanger first-generation sequencing verification of the molecular markers Cold1-1-kasp and Cold1-2-kasp in the examples. Detailed Implementation

[0034] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0035] Example

[0036] (1) Identification of cold tolerance phenotype of test materials. 529 materials evaluating the 3K rice population and 35 rice parents (conventional rice) were placed in a constant temperature oven and treated at 45℃ for 2 days to reduce moisture content and break dormancy. 500 seeds from each material were selected, treated with 1.5% (v / v) sodium hypochlorite solution for 20 minutes, washed with ultrapure water, soaked for 2 days, and then germinated at 32℃ in a constant temperature oven for about 1 day. When the sprouts were about 5 mm long, 200 seeds from each material with consistent germination were selected, placed in seed bags, and transferred to a low-temperature incubator for 7 days at 4℃. After treatment, the seeds from each material were spread evenly in 9cm diameter petri dishes lined with filter paper, 30 seeds per dish, with each material replicated 3 times. Water was added to submerge half the seed volume in the petri dishes, and the dishes were placed at 28℃ under normal light to allow the rice sprouts to recover normal growth for 10 days. The number of surviving seedlings was counted, and the seedling rate was calculated.

[0037] (2) Extraction of COLD1 gene SNP information. Log in to the National Rice Data Center gene bank (RiceData) to find COLD1 gene information. The Gene ID is LOC_Os04g51180. Use the Gene ID to find the COLD1 gene sequence information (Rice Genome Annotation) for Nipponbare (genome version number IRGSP-1.0). The positive strand sequence of the COLD1 gene CDS region was 30316303~30311519. Genomic SNP information of 3024 rice 3K accessions was downloaded (snp-seek.irri.org / _download.zul). Plink software was used to extract the COLD1 gene CDS region and the upstream 2kb and downstream 1kb SNP information (30310518~30318303) from the 529 3K accessions used in the experiment. The data was then filtered. The filtering conditions were: deletion of SNPs with a deletion rate >0.2, deletion of individuals with a deletion rate >0.2, and removal of SNPs with low MAF frequency (<0.05). After filtering, 4 SNPs remained from the 3K accessions used in the experiment. 93 copies; four SNP sites were obtained in the CDS region and the upstream and downstream 1kb regions of the COLD1 gene, with physical locations of Chr4-30313615 (SNP145935607, G / A), Chr4-30314997 (SNP145936989, A / G), Chr4-30316708 (SNP145938700, T / A), and Chr4-30316924 (SNP145938916, T / G). Among them, positions 30313615 and 30314997 are mutation sites in the intron region of the COLD1 gene CDS, and positions 30316708 and 30316924 are two SNP physical locations upstream of the COLD1 gene (upstream gene variant). Figure 1 Using the same conditions, 3024 3K germplasm materials and SNPs were filtered, leaving 2840 3K germplasm materials.

[0038] (3) Haplotype analysis of the COLD1 gene. The geneHapR package in R was used to analyze the haplotypes of two SNPs (SNP145938700 and SNP145938916) in the upstream regulatory region of the COLD1 gene in 493 filtered 3K germplasms. The results showed that the 493 germplasms were divided into three haplotypes: Hap1 accounted for 62.27%, with indica rice accounting for 73.29% and japonica rice accounting for 22.48%, making it the main haplotype of the COLD1 gene; Hap2 accounted for 27.99%, with indica rice accounting for 47.10% and japonica rice accounting for 52.17%; and Hap3 accounted for 9.74%, mainly Aus rice (79.17%), followed by indica rice (14.58%) (Table 1). Under cold stress during the budding stage, the seedling survival rate was Hap2 (62.76%) > Hap1 (55.88%) > Hap3 (48.25%). Significant difference analysis among the three haplotypes showed no significant difference in budding cold tolerance between haplotypes Hap1 and Hap3, while Hap2 showed significantly higher budding cold tolerance than both Hap1 and Hap3. This indicates that Hap2 is a favorable haplotype of the COLD1 gene and can be used for molecular breeding applications such as creating new cold-tolerant rice germplasm or selecting new varieties. Figure 2 ).

[0039] Table 1. Three haplotypes of the COLD1 gene

[0040]

[0041]

[0042] (4) Haplotype distribution of the COLD1 gene. Haplotype analysis of two SNPs (SNP145938700 and SNP145938916) of the COLD1 gene was performed using the geneHapR package in R language on 2840 filtered 3K germplasm accessions. The results showed that the haplotype percentages were: Hap1 (61.76%) > Hap2 (30.21%) > Hap3 (8.03%). Figure 3 Hap1 is the major haplotype of the COLD1 gene, primarily found in indica and slightly indica rice (Indica III, Indadx, Indica II, Indica I), followed by japonica and slightly japonica rice (TRJ, TEJ, Japadx), and is distributed across all rice types; Hap2 is primarily found in indica and japonica rice; Hap3 is primarily found in Aus and slightly indica rice, with less japonica rice. Figure 4 ).

[0043] (5) Development of kasp molecular markers. Kasp detection markers for two SNPs of the COLD1 gene were developed using Primer5 software (Table 2). The two kasp molecular marker primer combinations each included two specific primers and one universal primer; one specific primer had a fluorescent tag FAM attached to its 5′ end, and the product carrying the FAM sequence showed a red fluorescence after PCR amplification; the other specific primer had a fluorescent tag HEX attached to its 5′ end, and the product carrying the HEX sequence showed a blue fluorescence after PCR amplification. The detection molecular marker for SNP145938700 was Cold1-1-kasp, used to distinguish between T and A bases at position 30316708. After PCR amplification, a red fluorescence (FAM) indicated AA type, a blue fluorescence (HEX) indicated TT type, and a green fluorescence indicated TA type (heterozygous). Figure 5 SNP145938916 is used as the molecular marker Cold1-2-kasp to distinguish between G and T bases at position 30316924. After PCR amplification, fluorescence illumination shows red (FAM) for GG type, blue (HEX) for TT type, and green for GT type (heterozygous). Figure 6 Genotyping was performed on the distribution of two SNP sites in the tested materials using the two kasp molecular markers mentioned above. The results for sites 30316708 (SNP145938700) and 30316924 (SNP145938916) were TT when the result was haplotype Hap1, AG when the result was AG when the result was AG when the result was AT when the result was AT when the result was AT when the result was AT. Among them, Hap2 is a cold-resistant rice material in the bud stage.

[0044] Table 2. Two SNP molecular markers for the COLD1 gene.

[0045]

[0046] (6) Haplotype kasp molecular marker verification of the COLD1 gene. DNA was extracted from the test materials using the CTAB method, and molecular marker verification was performed using 15 accessions each of Hap1 to Hap3 (3K materials) from the COLD1 gene haplotype analysis. PARMS 2X Master Mix was provided by Wuhan Jingtai Biotechnology Co., Ltd. PARMS2X Master Mix contains two universal fluorescent primers, FAM and HEX. The FAM fluorescent sequence is GAAGGTGACCAAGTTCATGCT, and the HEX fluorescent sequence is GAAGGTCGGAGTCAACGGATT. The molecular markers Cold1-1-kasp and Cold1-2-kasp primers were synthesized by Beijing Qingke Xinyue Biotechnology Co., Ltd. The PCR amplification system was 10 μL, consisting of 5 μL PARMS2X Master Mix and 10 μmol·L⁻¹.-1 0.15 μL each of 924FAM and 924HEX (or 708FAM and 708HEX) primers, 0.4 μL of 924C (or 708C) primer, 1 μL of DNA (concentration 10–100 ng), and 3.3 μL of ddH2O; using Archimed... TM Version 2.0 real-time quantitative PCR was used for amplification and fluorescence capture; the reaction program was: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 65℃ (-0.8℃ per cycle) for 1 min, 10 cycles; 94℃ denaturation for 20 s, 57℃ annealing for 1 min, 30 cycles; 37℃ fluorescence capture for 1 min. Kasp analysis results showed that the genotyping results of the molecular markers Cold1-1-kasp and Cold1-2-kasp were completely consistent with the SNP information of the tested materials (snp-seek.irri.org / _download.zul) (Table 3). Figure 7 The results indicate that the molecular markers Cold1-1-kasp and Cold1-2-kasp can be used for the molecular detection of two SNPs (SNP145938700 and SNP145938916) in the upstream regulatory region of the COLD1 gene.

[0047] Table 3. KASP typing results of 45 3K germplasm resources

[0048]

[0049]

[0050] (7) Haplotype analysis of the COLD1 gene in 35 rice parents (conventional rice). Kasp typing was performed on two SNP loci in the 35 tested rice parents (conventional rice) using the molecular markers Cold1-1-kasp and Cold1-2-kasp. Among them, 21 materials, including Guanghui 398, Meishanzhan 2, and Nanjing 5718, were classified as Hap2, with cold-resistant seedling survival rates ranging from 42.2% to 100.0% during the budding stage; 14 materials, including Minghui 63, R9311, and Jingguizhan, were classified as Hap3, with cold-resistant seedling survival rates ranging from 0.00% to 32.2% during the budding stage; while Hap1 was not detected (Table 5). Haplotype Hap2 showed significantly higher cold resistance during the budding stage than haplotype Hap3, with an average seedling survival rate of 78.2% (…). Figure 8To further verify the accuracy of molecular markers Cold1-1-kasp and Cold1-2-kasp in genotyping SNP145938700 and SNP145938916, sequencing primers 567f / 567r were developed (Table 4). Twenty-one samples identified as Hap2 were mixed in equal amounts (7 DNA samples each), and 14 samples identified as Hap3 were mixed in equal amounts (7 DNA samples each). PCR amplification was performed on the mixed samples using primers 567f / 567r (PCR amplification band size was 567 bp). The PCR stock solution was then sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing. Sequencing results showed that SNP145938700, detected by the molecular marker Cold1-1-kasp, was a FAM tag (corresponding to TT genotype), with a sequencing result of base T; SNP145938700, detected by the molecular marker Cold1-1-kasp, was a HEX tag (corresponding to AA genotype), with a sequencing result of base A. Figure 9 Molecular marker Cold1-2-kasp detection identified SNP145938916 as a FAM tag (corresponding genotype GG), with sequencing result showing base C (complementary base); molecular marker Cold1-1-kasp detection identified SNP145938916 as a HEX tag (corresponding genotype TT), with sequencing result showing base A (complementary base). Figure 9 The above research results indicate that Hap2 is a favorable haplotype of the COLD1 gene, which can be used for molecular screening of cold-resistant rice seedlings during the germination stage, creation of new germplasm, or breeding of new varieties.

[0051] Table 4. Primers for COLD1 gene SNP sequencing

[0052]

[0053] Table 5. Haplotypes of the COLD1 gene in 35 rice parents (conventional rice).

[0054]

[0055] In summary, this invention, through research on the haplotypes of the rice cold-resistance gene COLD1, discovered that mutations in two SNPs (SNP145938700 and SNP145938916) at positions 30316708 and 30316924 in the upstream regulatory region of the COLD1 gene on rice Chr4 constitute three haplotypes. Among them, Hap2(AG) is the superior haplotype of the COLD1 gene, which can significantly improve the cold-resistance seedling ability of rice during the budding stage. This invention developed two kasp molecular markers for genotyping and haplotype analysis of the two SNPs of the COLD1 gene, which can effectively detect and distinguish between superior and non-superior haplotypes of the COLD1 gene in terms of cold-resistance seedling ability during the budding stage. Furthermore, by testing existing rice varieties, it was demonstrated that the superior haplotype materials screened by this molecular marker have significantly higher cold-resistance seedling ability during the budding stage than the non-superior haplotypes. Therefore, the molecular markers provided by this invention can be used for the detection of superior haplotypes of the COLD1 gene, which enhances cold tolerance and seedling growth in rice bud stage, and for molecular breeding, thereby improving breeding efficiency.

[0056] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the invention. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, it is intended that all variations falling within the meaning and scope of equivalents of the claims be included within the present invention.

Claims

1. A method for identifying the COLD1 haplotype of the rice cold-resistance gene, characterized in that, The kasp molecular markers Cold1-1-kasp and Cold1-2-kasp were used for detection. The kasp molecular marker primer combination included two specific primers and one universal primer. One specific primer was connected to a fluorescent tag FAM at its 5′ end. After PCR amplification, the product carrying the FAM sequence showed red fluorescence. The other specific primer was connected to a fluorescent tag HEX at its 5′ end. After PCR amplification, the product carrying the HEX sequence showed blue fluorescence. The detection primer sequences for Cold1-1-kasp and Cold1-2-kasp are as follows: 1)Cold1-1-kasp 708FAM:GAAGGTGACCAAGTTCATGCTGTGCTGCGTGCGTTCCT, 708HEX:GAAGGTCGGAGTCAACGGATTGTGCTGCGTGCGTTCCA, 708C:TCTCCTGTAGCTTCCTCTTC; 2)Cold1-2-kasp 924FAM:GAAGGTGACCAAGTTCATGCTGCGCGCGCGACGCTAAACTTGCTTG, 924HEX:GAAGGTCGGAGTCAACGGATTGCGCGCGCGACGCTAAACTTGCTTT, 924C:CGTGGTCTCGCATCTCCCG; The Cold1-1-kasp marker was detected at SNP 145938700, with a physical location of Chr4-30316708. The PCR product was scanned for fluorescence. If the product showed red fluorescence, the genotype of the Cold1-1-kasp marker in the rice was TT; if the product showed blue fluorescence, the genotype was AA; and if the product showed superimposed colors, the genotype was AT heterozygous. The Cold1-2-kasp marker was detected at SNP 145938916, located at Chr4-30316924. The PCR product was scanned for fluorescence. If the product showed red fluorescence, the genotype of the Cold1-2-kasp marker in the tested rice was GG; if the product showed blue fluorescence, the genotype was TT; and if the product showed a superimposed color, the genotype was GT heterozygous. When SNP145938700 is AA and SNP145938916 is GG, it corresponds to the COLD1 gene haplotype with excellent cold resistance and seedling growth ability during the rice budding stage.

Images