SNP (Single Nucleotide Polymorphism) marker influencing acidity of cerasus humilis, identification method and application

Abstract

The invention relates to the technical field of breeding, in particular to an SNP marker influencing the acidity of cerasus humilis, an identification method and application. The nucleotide sequence of the SNP marker is as shown in SEQ ID NO.1, and single nucleotide A to C mutation occurs at the 201bp site. The SNP marker disclosed by the invention can be used for breeding the acidity of the cerasus humilis crossbreeding, and the acidity of the cerasus humilis can be rapidly identified in a large scale by identifying the SNP marker through a KASP molecular marker technology, so that the process of breeding the acidity of the cerasus humilis crossbreeding is greatly simplified, and the time limit of breeding the acidity of the cerasus humilis crossbreeding is greatly prolonged.

Description

Technical Field

[0001] The invention relates to the technical field of breeding, and in particular to a SNP marker affecting the acidity of European plum, an identification method and an application thereof. Background Art

[0002] The germplasm resources of European plum are extremely rich. The fruit of European plum is not only rich in nutrition, containing flavonoids, multiple vitamins and minerals, but also has high medicinal value, such as anti-oxidation, anti-inflammatory, hypoglycemic, etc. However, the cultivated European plum fruit is mostly high in acidity and there are few fresh varieties, which limits its promotion and application in the fresh food market.

[0003] At present, the breeding of European plums mainly improves the flavor of European plum fruits through wild selection, seed selection and hybrid breeding. However, wild selection selects individuals with good fruit quality from wild European plums for domestication and cultivation. This method is simple and easy, but the selection range is limited and the selection efficiency is low. Hybrid breeding uses sexual hybridization to hybridize European plum varieties with different excellent traits to obtain new varieties with excellent comprehensive characteristics. This method can effectively improve the efficiency and effect of breeding, but there is also the problem of long breeding cycle. Seed selection: Through seed propagation, individuals with excellent fruit quality are selected from a large number of seedlings. This method can increase the diversity of selection, but there is also the problem of long breeding cycle.

[0004] Therefore, it is very necessary to explore the molecular markers that affect the acidity of European plum at the genomic level and apply them to the acidity selection of hybrid breeding. Summary of the invention

[0005] To solve the above problems, the present invention provides a SNP marker affecting the acidity of European plum, an identification method and application thereof, so as to shorten the acidity breeding cycle of hybrid breeding.

[0006] The present invention is achieved through the following technical solutions:

[0007] A SNP marker affecting the acidity of European plum, the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and a single nucleotide A to C mutation occurs at the 201 bp site.

[0008] SEQ ID NO.1:

[0009] AGTTACTTGCCAAGATAACATGCAGACTGTGCCACTATCCCTAGTCCA ATGCTACCAGGAACAAAACTTTACAAGAATGATGGTGAGTTGTTGGACAA TC[C / A]TTTTCTTTATAGAAGTATTGTCGGAGCTCTTCAATATATTACTTTCA GTAGACCAGACATAGCATATGCAGTTAATTATGCTTGTCAATTCTTGCAAC AA.

[0010] The SNP marker is used to identify the acidity of hybrid offspring of European plum.

[0011] The acidity when the base at the 201 bp position of the SNP marker is A is higher than the acidity when the base at the position is C.

[0012] A method for identifying the acidity of European plum, comprising the following steps:

[0013] (1) Select the test sample to extract DNA and dilute the DNA to 10 ng / μL to 20 ng / μL.

[0014] (2) Using specific primers to perform PCR amplification on the SNP markers, and reading the fluorescence data of the PCR products; the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] (3) When the fluorescence data is read as a HEX signal, the genotype is AA; when the fluorescence data is read as a heterozygous signal, the genotype is AC. The acidity of the European plum with the genotype of AA is higher than that with the genotype of AC.

[0016] Preferably, Prunus chinensis seedlings that are free of pests and diseases and have a plant height of more than 1 meter are selected as test samples.

[0017] Preferably, the PCR reaction procedure is as follows:

[0018] Step 1: pre-denaturation at 93℃~95℃ for 14min~16min; Step 2: denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, decrease the temperature by 0.5℃~0.7℃ in each cycle, for a total of 10 cycles; Step 3: denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, for a total of 26 cycles.

[0019] Preferably, the PCR reaction procedure is as follows:

[0020] Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, decreasing 0.6°C each cycle, for a total of 10 cycles; Step 3: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.

[0021] The application of the SNP marker in Prunus cerasifera genetic breeding.

[0022] The application of the SNP marker in the genetic breeding of European plums can improve the acidity of European plum offspring by selecting individuals with AA genotype as parents.

[0023] The application of the SNP marker in the genetic breeding of European plum can reduce the acidity of European plum offspring by selecting individuals with AC genotype as parents.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] The present invention provides a SNP marker that affects the acidity of European plum, the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and a single nucleotide A to C mutation occurs at the 201 bp position. The SNP marker of the present invention can be used for the acidity selection of European plum hybrid breeding, and the SNP marker of the present invention is identified by KASP molecular marker technology, so that the acidity of European plum can be identified quickly and in large quantities, eliminating the tediousness of managing and measuring each plant in the field, shortening the time from planting seedlings to fruiting and measuring the acidity of the plants, saving a lot of manpower and material resources, greatly simplifying the process and years of acidity selection of European plum hybrid breeding, and the accuracy rate of acidity identification of European plum is high, which can reach 85% when the method is appropriate. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 This is the KASP marker typing diagram of the acidity trait of the hybrid offspring of Prunus cerasifera of the present invention;

[0028] Figure 2 This is the KASP marker typing diagram of the F1 generation of the hybridization between DS-1 and Nongda No. 6 of the present invention;

[0029] Figure 3 This is the KASP marker typing diagram of the F1 generation of the hybridization between DS-1 and Nongda No. 7 of the present invention;

[0030] Figure 4 This is the KASP marker genotype diagram of the F1 generation of the hybridization between DS-1 and Green Europe No. 1 of the present invention;

[0031] Figure 5 This is the natural resource KASP marker typing diagram of the present invention. DETAILED DESCRIPTION

[0032] In order to facilitate the understanding of the present invention, the present invention will be described more comprehensively below, and preferred embodiments of the present invention are provided. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0034] The inventive concept of the present invention is as follows:

[0035] Prunus chinensis is a shrub fruit tree unique to my country. Most of its fruits have high acidity. The flavor of Prunus chinensis fruit is improved mainly through wild selection, seed selection, and hybrid breeding. The traditional breeding method of measuring the acidity of Prunus chinensis requires a lot of manpower and material resources, and takes a long time, which greatly limits the breeding speed of Prunus chinensis. Therefore, it is very necessary to explore molecular markers that affect the acidity of Prunus chinensis at the genomic level and apply them to acidity selection in hybrid breeding.

[0036] Based on this, the present invention provides a SNP marker that affects the acidity of European plum, the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and a single nucleotide A to C mutation occurs at the 201 bp position. The SNP marker of the present invention can be used for the acidity selection of European plum hybrid breeding. By identifying the SNP marker of the present invention, the acidity of European plum can be quickly and in large quantities, eliminating the tediousness of managing and measuring each plant in the field, shortening the time from planting seedlings to fruiting and measuring the acidity of the plants, saving a lot of manpower and material resources, greatly simplifying the process and years of acidity selection of European plum hybrid breeding, and the accuracy of the identification of European plum acidity is high, which can reach 85% when the method is appropriate.

[0037] Based on the same inventive concept, a method for identifying the acidity of European plum includes the following steps: (1) extracting DNA from a test sample and diluting the DNA to 10 ng / μL to 20 ng / μL; (2) performing PCR amplification on the SNP marker described in claim 1 using specific primers, and reading the fluorescence data of the PCR product; the nucleotide sequence of the specific primers is shown in SEQ ID NO.2 and SEQ ID NO.3; (3) when the fluorescence data is read as a HEX signal, the genotype is AA; when the fluorescence data is read as a heterozygous signal, the genotype is AC, and the acidity of European plum when the genotype is AA is higher than the acidity when the genotype is AC. The method uses the KASP technology to accurately and quickly detect the SNP marker of the present invention, realizes the rapid and large-scale identification of the acidity of European plum hybrid breeding, simplifies the European plum acidity screening process and procedures, has a high accuracy rate, and is short in time, and is used to shorten the breeding period and accelerate the breeding process.

[0038] The method for identifying the acidity of European plum of the present invention comprises the following steps:

[0039] 1. Construct hybrid offspring of European plum and plant them.

[0040] 2. Select the test sample to extract DNA and dilute the DNA to 10ng / μL~20ng / μL.

[0041] (1) DNA extraction: Healthy, pest-free, and disease-free Prunus chinensis seedlings with a plant height of more than 1 meter were selected as test samples, and DNA was extracted from their young leaves using the CTAB method.

[0042] a. Add 700 μL of 2% CTAB extraction buffer (5 mol / L NaCl, 1 mol / L Tris-HCl, 0.5 mol / L EDTA, 2% CTAB) and 20 μL of β-mercaptoethanol to a 2 ml centrifuge tube and preheat in a 65°C water bath.

[0043] b. Take 1g of leaves and put them in a mortar with liquid nitrogen to grind them. Add the ground sample into a 2ml centrifuge tube containing extraction buffer and place it in a 65℃ water bath for 45min.

[0044] c. Add equal volumes of chloroform and isoamyl alcohol in a volume ratio of 24:1, mix by inversion; centrifuge at 12,000 rpm for 10 min at 4°C.

[0045] d. Use a 200 μL pipette to transfer the supernatant into another new 2 mL centrifuge tube.

[0046] e. Add chloroform:isoamyl alcohol in a volume ratio of 24:1 again, mix gently, centrifuge at 4°C, 12,000 rpm for 10 min in a low-temperature refrigerated centrifuge, aspirate the supernatant, and repeat 2 to 3 times.

[0047] f. Add twice the volume of ice-cold anhydrous ethanol that has been pre-cooled in a -20°C refrigerator; place in a -20°C refrigerator and precipitate for 30 minutes to 1 hour; use a low-temperature refrigerated centrifuge at 4°C, 12,000 rpm for 6 minutes.

[0048] g. Discard the supernatant, wash the DNA with 70% ethanol, centrifuge for 5 minutes, and repeat twice.

[0049] h. Discard the supernatant, open the centrifuge tube cap, and place it in a fume hood to dry; add 50μL to 100μL of TE buffer sterilized by high-pressure steam, and use a 200μL pipette to gently pump to dissolve the DNA.

[0050] i. Take 2 μL of genomic DNA and run it on a 1% agarose gel at 220 V. The purity and integrity of the DNA were detected by UV. The OD value was measured using a NanoDrop 2000 micro-spectrophotometer to check the extraction quality. The DNA sample was stored at -20°C for later use.

[0051] (2) DNA dilution

[0052] Dilute the DNA of the samples to be tested to about 10ng / μL~20ng / μL.

[0053] 3. KASP typing test: Use specific primers to perform PCR amplification on the SNP marker and read the fluorescence data of the PCR product; the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and the primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0054] SEQ ID NO.1:

[0055] AGTTACTTGCCAAGATAACATGCAGACTGTGCCACTATCCCTAGTCCA ATGCTACCAGGAACAAAACTTTACAAGAATGATGGTGAGTTGTTGGACAA TC[C / A]TTTTCTTTATAGAAGTATTGTCGGAGCTCTTCAATATATTACTTTCA GTAGACCAGACATAGCATATGCAGTTAATTATGCTTGTCAATTCTTGCAAC AA.

[0056] (1) The primer sequences are shown in Table 1.

[0057] Table 1

[0058]

[0059] (2) The reaction procedure is shown in Table 2.

[0060] Table 2

[0061]

[0062] (3) Fluorescence data reading and analysis are shown in Table 3.

[0063] Table 3

[0064] Fluorescence Excitation(nm) Emission(nm) FAM 485 520 HEX 535 556 ROX 575 610

[0065] (4) Add loop.

[0066] If the fluorescence signal of the data is low and the clusters are scattered, you can add cycles before reading the fluorescence. The conditions for adding cycles are shown in Table 4 below:

[0067] Table 4

[0068]

[0069] 4. Read the results

[0070] The results are as follows Figure 1 As shown, in the scatter plot, the representative test samples close to the Y-axis are HEX signals, the genotype is AA, and the phenotype is high acid. The representative test samples between the diagonal lines are heterozygous signals, the genotype is AC, and the phenotype is low acid.

[0071] The technical solution of the present invention will be further described below in conjunction with specific embodiments.

[0072] In 2022, three F1 generations of DS-1 hybridized with Nongda No. 6, Nongda No. 7, and Lvyo No. 1 were constructed and planted at the Juxin European Plum Breeding Base of Shanxi Agricultural University. The three hybrid groups began to bear fruit in 2023, and the titratable acid content was determined.

[0073] Example 1

[0074] In the spring of 2024, the following experiments were conducted at a European plum breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0075] Primer preparation: Synthesize primers according to Table 1.

[0076] (1) From the F1 generation of DS-1 and Nongda No. 6, 43 healthy seedlings with no pests and diseases and a plant height of more than 1 meter were selected. DNA was extracted from their young leaves using the CTAB method and diluted to about 10 ng / μL.

[0077] (2) The primers were subjected to KASP typing test, and specific primers were used to perform PCR amplification of SNP markers. The reaction system was as follows: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 93°C for 20 s, annealing / extension at 55°C for 59 s, with a decrease of 0.5°C for each cycle, for a total of 10 cycles; Step 3: denaturation at 93°C for 19 s, annealing / extension at 55°C for 59 s, for a total of 26 cycles. After the reaction was completed, the PCR product was placed in a fluorescence quantitative PCR instrument for fluorescence data reading.

[0078] (3) Titratable acid content measurement

[0079] The titratable acid content, i.e., TA, is determined by NaOH titration. When the fruit is ripe, 10 fruits of uniform size are taken from each individual plant and cut into pieces. About 5g of the pulp is taken, ground into a homogenate, and then fixed to a 100mL volumetric flask. Shake well, let it stand in the refrigerator for 30 minutes, take 20mL of the supernatant and put it into a 100mL beaker, drop 2 drops of phenolphthalein, and titrate with calibrated 0.01mol / LNaOH until a light pink color appears. At the same time, the pH value is 8.2 with an acidity meter. The milliliters of NaOH used at this time are counted and calculated according to the following formula. The TA content is converted to malic acid with a conversion coefficient of 0.067, and repeated 3 times. TA>1.6 is high acid, and TA<1.0 is low acid.

[0080] The results are as follows Figure 2 As shown, the typing was successful, with a total of 43 samples, of which 13 samples were AC heterozygous and 30 samples were AA homozygous. After TA content determination, 21 of the 43 samples were low acid and 22 were high acid. According to the identification results of the present invention, 33 samples were accurately identified, with an accuracy rate of 76.74%.

[0081] Example 2

[0082] In the spring of 2024, the following experiments were conducted at a European plum breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0083] Primer preparation: Synthesize primers according to Table 1.

[0084] (1) From the F1 generation of the hybrid of DS-1 and Nongda No. 7, 44 seedlings with healthy growth, no pests or diseases, and plant height of more than 1 meter were selected. DNA was extracted from their young leaves using the CTAB method and diluted to about 15 ng / μL.

[0085] (2) The primers were subjected to KASP typing test, and specific primers were used to perform PCR amplification of SNP markers. The reaction system was as follows: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 94°C for 20 s, annealing / extension at 58°C for 60 s, with a decrease of 0.6°C for each cycle, for a total of 10 cycles; Step 3: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles. After the reaction was completed, the PCR product was placed in a fluorescence quantitative PCR instrument for fluorescence data reading.

[0086] (3) Titratable acid content measurement

[0087] The titratable acid content, i.e., TA, is determined by NaOH titration. When the fruit is ripe, 10 fruits of uniform size are taken from each individual plant and cut into pieces. About 5g of the pulp is taken, ground into a homogenate, and then fixed to a 100mL volumetric flask. Shake well, let it stand in the refrigerator for 30 minutes, take 20mL of the supernatant and put it into a 100mL beaker, drop 2 drops of phenolphthalein, and titrate with calibrated 0.01mol / LNaOH until a light pink color appears. At the same time, the pH value is determined to be 8.3 with an acidity meter. The milliliters of NaOH used at this time are counted and calculated according to the following formula. The TA content is converted to malic acid with a conversion coefficient of 0.067, and repeated 3 times. TA>1.6 is high acid, and TA<1.0 is low acid.

[0088] The results are as follows Figure 3 As shown, the typing was successful, with a total of 38 samples, of which 17 samples were AC heterozygous and 21 samples were AA homozygous. After TA content determination, 21 of the 38 samples were low acid and 17 were high acid. According to the identification results of the present invention, 35 samples were accurately identified, with an accuracy rate of 78.95%.

[0089] Example 3

[0090] In the spring of 2024, the following experiments were conducted at a European plum breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0091] Primer preparation: Synthesize primers according to Table 1.

[0092] (1) From the F1 generation of the hybrid of DS-1 and Green Europe No. 1, 38 seedlings with healthy growth, no pests or diseases, and a plant height of more than 1 meter were selected. DNA was extracted from their young leaves using the CTAB method and diluted to about 20 ng / μL.

[0093] (2) The primers were subjected to KASP typing test, and specific primers were used to perform PCR amplification of SNP markers. The reaction system was as follows: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 95°C for 21 s, annealing / extension at 61°C for 61 s, with a decrease of 0.7°C for each cycle, for a total of 10 cycles; Step 3: denaturation at 95°C for 21 s, annealing / extension at 61°C for 61 s, for a total of 26 cycles. After the reaction was completed, the PCR product was placed in a fluorescence quantitative PCR instrument for fluorescence data reading.

[0094] (3) Titratable acid content measurement

[0095] The titratable acid content, i.e., TA, is determined by NaOH titration. When the fruit is ripe, 10 fruits of uniform size are taken from each individual plant and cut into pieces. About 5g of the pulp is taken, ground into a homogenate, and then fixed to a 100mL volumetric flask. Shake well, let it stand in the refrigerator for 30 minutes, take 20mL of the supernatant and put it into a 100mL beaker, drop 2 drops of phenolphthalein, and titrate with calibrated 0.01mol / LNaOH until a light pink color appears. At the same time, the pH value is 8.4 with an acidity meter. The milliliters of NaOH used at this time are counted and calculated according to the following formula. The TA content is converted to malic acid with a conversion coefficient of 0.067, and repeated 3 times. TA>1.6 is high acid, and TA<1.0 is low acid.

[0096] The results are as follows Figure 4 As shown, the typing was successful, with a total of 38 samples, of which 21 samples were AC heterozygous and 17 samples were AA homozygous. After TA content determination, 20 of the 38 samples were low acid and 18 were high acid. According to the identification results of the present invention, 35 samples were accurately identified, with an accuracy rate of 83.33%.

[0097] Example 4

[0098] In the spring of 2024, the following experiments were conducted at a European plum breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0099] Primer preparation: Synthesize primers according to Table 1.

[0100] (1) Among natural resources with known acidity, 20 high-acid varieties and 21 low-acid varieties were selected. Young leaves were taken from seedlings that were healthy, free of pests and diseases, and had a plant height of more than 1 meter. DNA was extracted using the CTAB method and diluted to about 20 ng / μL.

[0101] (2) The primers were subjected to KASP typing test, and specific primers were used to perform PCR amplification of SNP markers. The reaction system was as follows: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, with a decrease of 0.6°C for each cycle, for a total of 10 cycles; Step 3: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles. After the reaction was completed, the PCR product was placed in a fluorescence quantitative PCR instrument for fluorescence data reading.

[0102] The results are as follows Figure 5 As shown, the typing was successful with a total of 41 samples, of which 19 samples were AC heterozygous, 21 samples were AA homozygous, 1 sample could not be determined, and 35 samples were accurately identified, with an accuracy rate of 85.37%.

[0103] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0104] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A SNP marker that affects the acidity of European plum, characterized in that: The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and a single nucleotide A to C mutation occurs at the 201 bp site.

2. Use of the SNP marker as claimed in claim 1 in identifying the acidity of hybrid offspring of European plum.

3. The use of the SNP marker as claimed in claim 2 in identifying the acidity of hybrid offspring of Prunus persica, characterized in that: The acidity when the base at the 201 bp position of the SNP marker is A is higher than the acidity when the base at the position is C.

4. A method for identifying the acidity of European plum, characterized in that: The following steps are involved: (1) Select the test sample to extract DNA and dilute the DNA to 10 ng / μL to 20 ng / μL; (2) using specific primers to perform PCR amplification on the SNP marker of claim 1, and reading the fluorescence data of the PCR product; the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3; (3) When the fluorescence data is read as a HEX signal, the genotype is AA; when the fluorescence data is read as a heterozygous signal, the genotype is AC. The acidity of the European plum with the genotype of AA is higher than that with the genotype of AC.

5. The method according to claim 4, characterized in that Select European plum seedlings that are free of pests and diseases and have a plant height of more than 1 meter as test samples.

6. The method according to claim 4, characterized in that The PCR reaction procedure is as follows: Step 1: pre-denaturation at 93℃~95℃ for 14min~16min; Step 2: denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, decrease the temperature by 0.5℃~0.7℃ in each cycle, for a total of 10 cycles; Step 3: denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, for a total of 26 cycles.

7. The method according to claim 6, characterized in that The PCR reaction system is as follows: Step 1: pre-denaturation at 94°C for 15 min; Step 2: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, decreasing 0.6°C each cycle, for a total of 10 cycles; Step 3: denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.

8. Use of the SNP marker as claimed in claim 1 in genetic breeding of European plum.

9. The use of the SNP marker in Prunus persica genetic breeding as claimed in claim 8, characterized in that: By selecting individuals with AA genotype as parents, the acidity of European plum offspring can be increased.

10. The use of the SNP marker in Prunus persica genetic breeding as claimed in claim 8, characterized in that: The acidity of European plum offspring can be reduced by selecting individuals with AC genotype as parents.

Images