A SNP labeling, identification method and application for affecting the acidity of Prunus cerasifera

Abstract

This invention relates to the field of breeding technology, specifically to a SNP marker affecting the acidity of European plum, its identification method, and its application. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, with a single nucleotide A to C mutation occurring at position 201 bp. The SNP marker of this invention can be used for acidity selection in European plum hybridization breeding. Identifying the SNP marker of this invention using KASP molecular marker technology allows for rapid and large-scale identification of European plum acidity, greatly simplifying the process and reducing the time required for acidity selection in European plum hybridization breeding.

Description

Technical Field

[0001] This invention relates to the field of breeding technology, specifically to an SNP marker, identification method, and application that affects the acidity of Prunus cerasifera. Background Technology

[0002] The germplasm resources of the European plum are extremely abundant. The fruit is not only rich in nutrients, containing flavonoids, various vitamins and minerals, but also possesses high medicinal value, such as antioxidant, anti-inflammatory, and blood sugar-lowering effects. However, cultivated European plum fruits generally have high acidity, and there are relatively few varieties suitable for fresh consumption, which limits its promotion and application in the fresh food market.

[0003] Currently, European plum breeding mainly improves fruit flavor through wild selection, seedling selection, and hybridization. Wild selection involves choosing individuals with better fruit quality from wild European plums for domestication and cultivation. This method is simple and easy to implement, but the selection range is limited and the selection efficiency is low. Hybridization involves sexual hybridization, crossing European plum varieties with different superior traits to obtain new varieties with excellent overall characteristics. This method can effectively improve breeding efficiency and results, but it also suffers from a long breeding cycle. Seedling selection involves selecting individuals with superior fruit quality from a large number of seedlings through seed propagation. This method can increase the diversity of selection, but it also suffers from a long breeding cycle.

[0004] Therefore, it is essential to mine molecular markers that affect the acidity of Prunus cerasifera at the genomic level and apply them to acidity selection in hybridization breeding. Summary of the Invention

[0005] To address the above issues, this invention provides an SNP marker, identification method, and application that affects the acidity of European plum, thereby shortening the acidity selection cycle in hybridization breeding.

[0006] This invention is achieved through the following technical solution:

[0007] A SNP marker affecting plum acidity, wherein the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and a single nucleotide A to C mutation occurs at position 201 bp.

[0008] SEQ ID NO.1:

[0009] AGTTACTTGCCAAGATAACATGCAGACTGTGCCACTATCCCTAGTCCA ATGCTACCAGGAACAAAACTTTACAAGAATGATGGTGAGTTGTTGGACAA TC[C / A]TTTTCTTTATAGAAGTATTGTCGGAGCTCTTCAATATATTACTTTCA GTAGACCAGACATAGCATATGCAGTTAATTATGCTTGTCAATTCTTGCAAC AA.

[0010] The application of the SNP marker in identifying the acidity of European plum hybrid offspring.

[0011] The acidity at the 201bp site of the SNP marker is higher when the base is A than when the base is C.

[0012] A method for determining the acidity of plum includes the following steps:

[0013] (1) Select test samples to extract DNA, and dilute the DNA to 10 ng / μL to 20 ng / μL.

[0014] (2) The SNP marker was amplified by PCR using specific primers, and the fluorescence data of the PCR product was read. The nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] (3) When the fluorescence data is read as a HEX signal, the genotype is AA; when the fluorescence data is read as a heterozygous signal, the genotype is AC. The acidity of the plum with genotype AA is higher than that with genotype AC.

[0016] Preferably, disease-free and pest-free European plum seedlings with a height of 1 meter or more were selected as test samples.

[0017] Preferably, the PCR reaction procedure is as follows:

[0018] Step 1: Pre-denaturation at 93℃~95℃ for 14min~16min; Step 2: Denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, decreasing by 0.5℃~0.7℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, for a total of 26 cycles.

[0019] Preferably, the PCR reaction procedure is as follows:

[0020] Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for a total of 26 cycles.

[0021] The application of the SNP markers in the genetic breeding of Prunus cerasifera.

[0022] The application of the SNP marker in the genetic breeding of Prunus cerasifera improves the acidity of the offspring by selecting individuals with the genotype AA as parents.

[0023] The application of the SNP markers in the genetic breeding of Prunus cerasifera reduces the acidity of the offspring by selecting individuals with the AC genotype as parents.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] This invention provides a SNP marker affecting the acidity of Prunus cerasifera. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, with a single nucleotide A to C mutation occurring at position 201 bp. The SNP marker of this invention can be used for acidity selection in Prunus cerasifera hybrid breeding. Identifying the SNP marker of this invention using KASP molecular marker technology allows for rapid and large-scale identification of Prunus cerasifera acidity, eliminating the tedious process of managing and measuring each plant in the field. This shortens the time from seedling transplantation to fruit setting and acidity measurement, saving significant manpower and resources, greatly simplifying the process and timeline of acidity selection in Prunus cerasifera hybrid breeding, and achieving a high accuracy rate of 85% when the method is appropriate. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 This is a KASP marker typing diagram of the acidity trait in the hybrid offspring of the European plum of this invention;

[0028] Figure 2 This is a KASP marker genotyping diagram of the F1 generation of the cross between DS-1 and Nongda 6 of this invention;

[0029] Figure 3 This is a KASP marker genotyping diagram of the F1 generation of the cross between DS-1 and Nongda 7 of this invention;

[0030] Figure 4 This is a KASP marker genotyping diagram of the F1 generation of the cross between DS-1 and Green Europe 1 of this invention;

[0031] Figure 5 This is a natural resource KASP tag classification diagram for the present invention. Detailed Implementation

[0032] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0034] The inventive concept of this invention is as follows:

[0035] Prunus cerasifera is a shrub-like fruit tree unique to my country. Its fruits are generally high in acidity, and the flavor of the fruit is mainly improved through wild selection, seedling selection, and hybridization breeding. Traditional breeding methods for determining the acidity of Prunus cerasifera require significant manpower and resources, and are time-consuming, greatly limiting the speed of breeding. Therefore, it is essential to identify molecular markers affecting the acidity of Prunus cerasifera at the genomic level and apply them to acidity selection in hybridization breeding.

[0036] Based on this, the present invention provides a SNP marker affecting the acidity of Prunus cerasifera. The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, with a single nucleotide A to C mutation occurring at position 201 bp. The SNP marker of the present invention can be used for acidity selection in Prunus cerasifera hybrid breeding. By identifying the SNP marker of the present invention, the acidity of Prunus cerasifera can be quickly and in large quantities identified, eliminating the tedious process of managing and measuring each plant in the field, shortening the time from seedling transplanting to fruit setting and acidity measurement, saving a lot of manpower and resources, greatly simplifying the process and time of acidity selection in Prunus cerasifera hybrid breeding, and achieving a high accuracy rate for Prunus cerasifera acidity identification, which can reach 85% under appropriate methods.

[0037] Based on the same inventive concept, a method for identifying the acidity of *Prunus cerasifera* includes the following steps: (1) selecting test samples to extract DNA, and diluting the DNA to 10 ng / μL to 20 ng / μL; (2) using specific primers to perform PCR amplification on the SNP marker described in claim 1, and reading the fluorescence data of the PCR product; the nucleotide sequences of the specific primers are shown in SEQ ID NO. 2 and SEQ ID NO. 3; (3) when the fluorescence data reads as a HEX signal, the genotype is AA; when the fluorescence data reads as a heterozygous signal, the genotype is AC. The acidity of *Prunus cerasifera* with genotype AA is higher than that with genotype AC. This method accurately and rapidly detects the SNP marker of the present invention using KASP technology, realizing rapid and large-scale identification of the acidity of *Prunus cerasifera* hybridization breeding, simplifying the screening process and procedures for the acidity of *Prunus cerasifera*, with high accuracy and short time consumption, thereby shortening the breeding period and accelerating the breeding process.

[0038] The method for identifying the acidity of plum in this invention includes the following steps:

[0039] 1. Construct hybrid offspring of Prunus cerasifera and transplant them.

[0040] 2. Select test samples and extract DNA, then dilute the DNA to 10 ng / μL to 20 ng / μL.

[0041] (1) DNA extraction: Select healthy, disease-free European plum seedlings with a height of more than 1 meter as test samples, and extract DNA from their tender leaves using the CTAB method.

[0042] a. Add 700 μL of 2% CTAB extraction buffer (5 mol / L NaCl, 1 mol / L Tris-HCl, 0.5 mol / L EDTA, 2% CTAB) and 20 μL of β-mercaptoethanol to a 2 ml centrifuge tube, and preheat in a water bath at 65 °C.

[0043] b. Take 1g of leaf and place it in a mortar. Add liquid nitrogen and grind. Add the ground sample to a 2ml centrifuge tube containing extraction buffer and incubate at 65℃ for 45min.

[0044] c. Add equal volumes of chloroform:isoamyl alcohol in a volume ratio of 24:1, mix by inverting the container; centrifuge at 4°C and 12,000 rpm for 10 min in a low-temperature refrigerated centrifuge.

[0045] d. Use a 200 μL pipette to transfer the supernatant into a new 2 mL centrifuge tube.

[0046] e. Add chloroform:isoamyl alcohol at a volume ratio of 24:1 again, mix gently, and centrifuge at 4°C and 12,000 rpm for 10 minutes using a low-temperature refrigerated centrifuge. Collect the supernatant and repeat 2 to 3 times.

[0047] f. Add twice the volume of pre-cooled ice-cold anhydrous ethanol placed in a -20°C freezer; place in a -20°C freezer and precipitate for 30 min to 1 h; centrifuge at 4°C and 12000 rpm for 6 min using a low-temperature refrigerated centrifuge.

[0048] g. Discard the supernatant, wash the DNA with 70% ethanol, centrifuge for 5 min, and repeat twice.

[0049] h. Discard the supernatant, open the centrifuge tube cap, and place it in a fume hood to dry; add 50μL to 100μL of autoclaved TE buffer, and gently pipette with a 200μL pipette to dissolve the DNA.

[0050] i. Take 2 μL of genomic DNA and perform electrophoresis on a 1% agarose gel at 220V. Detect the purity and integrity of the DNA using UV light. Use a NanoDrop 2000 micro spectrophotometer to measure the OD value to verify the extraction quality. Store the DNA sample at -20℃ for later use.

[0051] (2) DNA dilution

[0052] The DNA in the samples to be tested was uniformly diluted to approximately 10 ng / μL to 20 ng / μL.

[0053] 3. KASP genotyping assay: PCR amplification of SNP markers was performed using specific primers, and fluorescence data was read from the PCR products; the nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, and the primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0054] SEQ ID NO.1:

[0055] AGTTACTTGCCAAGATAACATGCAGACTGTGCCACTATCCCTAGTCCA ATGCTACCAGGAACAAAACTTTACAAGAATGATGGTGAGTTGTTGGACAA TC[C / A]TTTTCTTTATAGAAGTATTGTCGGAGCTCTTCAATATATTACTTTCA GTAGACCAGACATAGCATATGCAGTTAATTATGCTTGTCAATTCTTGCAAC AA.

[0056] (1) Primer sequences are shown in Table 1.

[0057] Table 1

[0058]

[0059] (2) The reaction procedure is shown in Table 2.

[0060] Table 2

[0061]

[0062] (3) Fluorescence data reading and analysis are shown in Table 3.

[0063] Table 3

[0064] fluorescence Excitation (nm) Emission (nm) FAM 485 520 HEX 535 556 ROX 575 610

[0065] (4) Add a loop.

[0066] If the fluorescence signal of the data is low and the clustering is scattered, fluorescence reading can be performed after cycling. The conditions for adding cycling are shown in Table 4 below:

[0067] Table 4

[0068]

[0069] 4. Result Reading

[0070] The results are as follows Figure 1 As shown in the scatter plot, the test samples closer to the Y-axis represent HEX signals, with genotype AA and phenotype high acidity, while those on the diagonal represent heterozygous signals, with genotype AC and phenotype low acidity.

[0071] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0072] In 2022, three F1 generations of hybrids were constructed by crossing DS-1 with Nongda 6, Nongda 7, and Lvou 1. These hybrids were planted at the Juxin European Plum Breeding Base of Shanxi Agricultural University. The three hybrid populations began to bear fruit in 2023, and titratable acid content was determined.

[0073] Example 1

[0074] In the spring of 2024, the following experiment was conducted at a Prunus cerasifera breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0075] Primer preparation: Primers were synthesized according to Table 1.

[0076] (1) In the F1 generation of the hybridization of DS-1 and Nongda 6, 43 healthy seedlings with no pests or diseases and a height of more than 1 meter were selected. Their tender leaves were used to extract DNA using the CTAB method, and the DNA was diluted to about 10 ng / μL.

[0077] (2) KASP genotyping was performed on the primers. Specific primers were used for PCR amplification of the SNP markers. The reaction system was as follows: Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 93℃ for 20 s, annealing / extension at 55℃ for 59 s, with a temperature decrease of 0.5℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 93℃ for 19 s, annealing / extension at 55℃ for 59 s, for a total of 26 cycles. After the reaction, the PCR products were placed in a real-time PCR instrument for fluorescence data reading.

[0078] (3) Measurement of titratable acid content

[0079] The titratable acid content, or TA, is determined using the NaOH titration method. At maturity, 10 uniformly sized fruits from each plant are chopped, and approximately 5g of pulp is collected, ground into a homogenate, and diluted to a 100mL volumetric flask. The mixture is shaken well and allowed to stand in the refrigerator for 30 minutes. 20mL of the supernatant is then transferred to a 100mL beaker, and 2 drops of phenolphthalein are added. Titration with standardized 0.01mol / L NaOH continues until a pale pink color appears. Simultaneously, the pH is measured to be 8.2 using a pH meter. The volume of NaOH used is recorded, and the TA content is calculated using the following formula. The conversion factor is 0.067 for malic acid. The calculation is repeated three times. TA > 1.6 indicates high acidity, and TA < 1.0 indicates low acidity.

[0080] The results are as follows Figure 2 As shown, the typing was successful, with a total of 43 samples. Of these, 13 samples were AC heterozygous and 30 were AA homozygous. After TA content determination, 21 of the 43 samples were low in acid and 22 were high in acid. Based on the identification results of this invention, 33 samples were accurately identified, with an accuracy rate of 76.74%.

[0081] Example 2

[0082] In the spring of 2024, the following experiment was conducted at a Prunus cerasifera breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0083] Primer preparation: Primers were synthesized according to Table 1.

[0084] (1) In the F1 generation of the hybridization of DS-1 and Nongda 7, 44 healthy seedlings with no pests or diseases and a height of more than 1 meter were selected. Their tender leaves were used to extract DNA using the CTAB method, and the DNA was diluted to about 15 ng / μL.

[0085] (2) KASP genotyping was performed on the primers. Specific primers were used for PCR amplification of the SNP markers. The reaction system was as follows: Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 94℃ for 20 s, annealing / extension at 58℃ for 60 s, with a temperature decrease of 0.6℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for a total of 26 cycles. After the reaction, the PCR products were placed in a real-time PCR instrument for fluorescence data reading.

[0086] (3) Measurement of titratable acid content

[0087] Titrizable acid content, i.e., TA, is determined using the NaOH titration method. At maturity, 10 uniformly sized fruits from each plant are chopped, and approximately 5g of pulp is collected, ground into a homogenate, and diluted to a 100mL volumetric flask. The mixture is shaken well and allowed to stand in the refrigerator for 30 minutes. 20mL of the supernatant is then transferred to a 100mL beaker, and 2 drops of phenolphthalein are added. Titration with standardized 0.01mol / L NaOH continues until a pale pink color appears. Simultaneously, the pH is measured to be 8.3 using a pH meter. The volume of NaOH used is recorded, and the TA content is calculated using the following formula. The conversion factor is 0.067 for malic acid. The calculation is repeated three times. TA > 1.6 indicates high acidity, and TA < 1.0 indicates low acidity.

[0088] The results are as follows Figure 3 As shown, the typing was successful, with a total of 38 samples. Of these, 17 samples were AC heterozygous and 21 were AA homozygous. After TA content determination, 21 of the 38 samples were low in acid and 17 were high in acid. Based on the identification results of this invention, 35 samples were accurately identified, with an accuracy rate of 78.95%.

[0089] Example 3

[0090] In the spring of 2024, the following experiment was conducted at a Prunus cerasifera breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0091] Primer preparation: Primers were synthesized according to Table 1.

[0092] (1) In the F1 generation of the DS-1 and Green Europe No.1 hybrid, 38 healthy seedlings with no pests or diseases and a height of more than 1 meter were selected. Their tender leaves were used to extract DNA using the CTAB method, and the DNA was diluted to about 20 ng / μL.

[0093] (2) KASP genotyping was performed on the primers. Specific primers were used for PCR amplification of the SNP markers. The reaction system was as follows: Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 95℃ for 21 s, annealing / extension at 61℃ for 61 s, with a temperature decrease of 0.7℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 95℃ for 21 s, annealing / extension at 61℃ for 61 s, for a total of 26 cycles. After the reaction, the PCR products were placed in a real-time PCR instrument for fluorescence data reading.

[0094] (3) Measurement of titratable acid content

[0095] The titratable acid content, or TA, is determined using the NaOH titration method. At maturity, 10 uniformly sized fruits from each plant are chopped, and approximately 5g of pulp is collected, ground into a homogenate, and diluted to a 100mL volumetric flask. The mixture is shaken well and allowed to stand in the refrigerator for 30 minutes. 20mL of the supernatant is then transferred to a 100mL beaker, and 2 drops of phenolphthalein are added. Titration with standardized 0.01mol / L NaOH continues until a pale pink color appears. Simultaneously, the pH is measured to be 8.4 using a pH meter. The volume of NaOH used is recorded, and the TA content is calculated using the following formula. The TA content is converted to malic acid using a conversion factor of 0.067. The calculation is repeated three times. TA > 1.6 indicates high acidity, and TA < 1.0 indicates low acidity.

[0096] The results are as follows Figure 4 As shown, the typing was successful, with a total of 38 samples. Among them, 21 samples were AC heterozygous and 17 samples were AA homozygous. After TA content determination, 20 of the 38 samples were low acid and 18 were high acid. According to the identification results of this invention, 35 samples were accurately identified, with an accuracy rate of 83.33%.

[0097] Example 4

[0098] In the spring of 2024, the following experiment was conducted at a Prunus cerasifera breeding experimental base of Shanxi Agricultural University in Taigu District, Jinzhong City, Shanxi Province:

[0099] Primer preparation: Primers were synthesized according to Table 1.

[0100] (1) Among natural resources with known acidity, 20 high-acid varieties and 21 low-acid varieties were selected. Tender leaves were taken from the seedlings that were growing well, free from pests and diseases, and with a plant height of more than 1 meter. DNA was extracted using the CTAB method and diluted to about 20 ng / μL.

[0101] (2) KASP genotyping was performed on the primers. Specific primers were used for PCR amplification of the SNP markers. The reaction system was as follows: Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 94℃ for 20 s, annealing / extension at 61℃ for 60 s, with a temperature decrease of 0.6℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for a total of 26 cycles. After the reaction, the PCR products were placed in a real-time PCR instrument for fluorescence data reading.

[0102] The results are as follows Figure 5 As shown, the typing was successful. A total of 41 samples were tested, of which 19 samples were AC heterozygous, 21 samples were AA homozygous, 1 sample could not be determined, and 35 samples were accurately identified, with an accuracy rate of 85.37%.

[0103] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0104] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A SNP marker affecting acidity in Aronia, characterized by, The nucleotide sequence of the SNP marker is shown in SEQ ID NO.1, with a single nucleotide A to C mutation occurring at position 201 bp.

2. The application of a reagent for detecting the SNP marker as described in claim 1 in identifying the acidity of Prunus cerasifera hybrid progeny, characterized in that, The hybrid offspring of the European plum are hybrid offspring of DS-1 and Nongda No. 6, Nongda No. 7, and Lvou No. 1; The acidity at the 201bp site of the SNP marker is higher when the base is A than when the base is C.

3. A method for determining the acidity of plum, characterized in that, Includes the following steps: (1) Select test samples to extract DNA, and dilute the DNA to 10 ng / µL~20 ng / µL; (2) PCR amplification of the SNP marker described in claim 1 was performed using specific primers, and fluorescence data was read from the PCR product; the nucleotide sequences of the specific primers are shown in SEQ ID NO.2 and SEQ ID NO.3; (3) When the fluorescence data is read as a HEX signal, the genotype is AA; when the fluorescence data is read as a heterozygous signal, the genotype is AC. The acidity of the European plum with genotype AA is higher than that with genotype AC. The European plum is a hybrid offspring of DS-1 and Nongda No. 6, Nongda No. 7 and Green European No.

1.

4. The method as described in claim 3, characterized in that, Prunus cerasifera seedlings free from pests and diseases and with a height of 1.0m or more were selected as test samples.

5. The method as described in claim 3, characterized in that, The PCR reaction procedure is as follows: Step 1: Pre-denaturation at 93℃~95℃ for 14min~16min; Step 2: Denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, decreasing by 0.5℃~0.7℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 93℃~95℃ for 19s~21s, annealing / extension at 55℃~61℃ for 59s~61s, for a total of 26 cycles.

6. The method as described in claim 3, characterized in that, The PCR reaction system is as follows: Step 1: Pre-denaturation at 94℃ for 15 min; Step 2: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, decreasing by 0.6℃ per cycle, for a total of 10 cycles; Step 3: Denaturation at 94℃ for 20 s, annealing / extension at 55℃ for 60 s, for a total of 26 cycles.

7. The application of a reagent for detecting the SNP marker as described in claim 1 in acidity selection during hybridization breeding of Prunus armeniaca, characterized in that, The European plum mentioned is a hybrid offspring of DS-1 and Nongda No. 6, Nongda No. 7, and Lvou No. 1; The acidity of the offspring of Prunus cerasifera can be increased by selecting individuals with the genotype AA as parents. The acidity of the offspring of Prunus cerasifera was reduced by selecting individuals with the AC genotype as parents.

Images