Non-immunogenic cyclic non-viral DNA vectors

Abstract

The present disclosure relates to cyclic non-viral DNA vectors, compositions comprising one or more of the disclosed vectors, and methods of delivering and / or expressing one or more therapeutic genes (e.g., proteins) in mammals, e.g., human patients. In some embodiments, the present disclosure relates to cyclic non-viral DNA vectors, such as cyclic non-viral DNA vectors comprising at least two inverted repeats, where the at least two inverted repeats are separated by a non-repeating nucleotide sequence that is not part of the at least two inverted repeats. In some embodiments, the disclosed cyclic non-viral DNA vectors do not include "DD elements". In some embodiments, the disclosed cyclic non-viral DNA vectors do not include a "DD element", but include at least a portion of a bacterial origin of replication.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This disclosure claims the benefit of the filing date of U.S. Provisional Patent Application No. 63 / 390,515, filed on July 19, 2022, the disclosure of which is hereby incorporated by reference in its entirety. Technical Field

[0003] The present disclosure relates to non-viral DNA vectors, which include one or more nucleotide sequences encoding one or more therapeutic proteins. In some embodiments, the non-viral DNA vector can be used to treat hypophosphatasia or treat, alleviate or prevent one or more symptoms of hypophosphatasia in a subject in need of treatment thereof. Background Art

[0004] Gene therapy is an innovative approach in medicine that aims to treat inherited and acquired diseases by delivering new genetic material into a patient's cells to compensate for or suppress the function of mutated genes and / or to treat genetic disorders.

[0005] The vectors used in gene therapy are divided into two major categories: viral vectors and non-viral vectors. Viral gene therapy vectors include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and poxviruses. (Lundstrom K. Viral Vectors in Gene Therapy. Diseases. 2018 May 21; 6(2)). Viral vectors can actively enter host cells and transfect efficiently. The main advantage of viral vectors is that they deliver therapeutic genetic material to cells quickly and efficiently due to the natural properties of the virus. However, considering the risks of inflammation, immune response to gene therapy, cytotoxicity, mutagenesis, and carcinogenesis, the application of viral vectors in clinical practice is quite limited. There is still a need for non-viral vectors for therapeutic gene delivery. Summary of the invention

[0006] The present disclosure relates to circular non-viral DNA vectors; compositions comprising one or more of the disclosed circular non-viral DNA vectors; and methods of delivering and / or expressing one or more therapeutic genes from the disclosed circular non-viral DNA in mammals (e.g., human patients). The circular non-viral DNA vectors disclosed herein are capable of promoting sustained expression of transgenes delivered to cells by the vector.

[0007] The first aspect of the present disclosure is a separated circular non-viral DNA vector comprising: a first part comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second part capable of forming at least one cruciform structure. In some embodiments, the second part comprises at least two inverted repeat sequences. In some embodiments, the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0008] In some embodiments, the non-viral DNA vector has substantially no CpG sequence. In some embodiments, the non-viral DNA vector comprises less than about 750 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 700 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 600 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 400 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 300 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 200 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 150 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 50 CpG / vector.

[0009] In some embodiments, the non-repetitive nucleotide sequence comprises at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 15 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 20 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 25 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 3 nucleotides and encodes at least a portion of a bacterial replication origin. In some embodiments, the replication origin includes a sequence derived from pMB1, pBR322, ColE1, p15A, pSC101 or F1. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial repressor tRNA. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial RNAi repressor. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes an antisense RNA. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial operon sequence or a portion thereof. In some embodiments, the bacterial operator sequence comprises the lac operator.In some embodiments, the bacterial operator sequence comprises the tet operator.

[0010] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector includes one or more recombination sites. In some embodiments, the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, for example, Lox511 or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled.

[0011] In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more regions of negative supercoil.In some embodiments, the non-viral DNA vector is non-immunogenic.

[0012] In some embodiments, each inverted repeat sequence is derived from a nucleic acid sequence present in one or more AAV serotypes. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 85% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 90% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 91% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 92% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 93% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 94% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 95% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises any one of SEQ ID NOs: 1-18.

[0013] In some embodiments, the non-viral DNA vector does not comprise a DD element. In some embodiments, the non-viral DNA vector does not comprise a DD element but comprises at least a portion of a bacterial origin of replication. In some embodiments, the non-viral DNA vector does not comprise a DD element but comprises at least a portion of a bacterial origin of replication as part of the second portion. In some embodiments, the non-viral DNA vector does not comprise a DD element but comprises at least a portion of a bacterial origin of replication, but not within the second portion.

[0014] In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 91% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 92% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 93% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 94% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 58-59. In some embodiments, a non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence having a nucleotide sequence of any one of SEQ ID NOs: 58-59.

[0015] In some embodiments, the second portion comprises a first nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0016] The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. The isolated circular non-viral DNA vector of any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0017] In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0018] In some embodiments, the second portion comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence having any one of SEQ ID NOs: 35 and 60.

[0019] In some embodiments, the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 64, 65, 66, or 69), ATP7B (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 70 or 83), AlAT (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 67), BDF8 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 71 or 72), NO:68 having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity) and variants thereof. In some embodiments, the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

[0020] A second aspect of the present disclosure is an isolated circular non-viral DNA vector comprising: a first portion comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, wherein the second portion has the formula XYX′, wherein X and X′ are each an inverted repeat sequence, and wherein Y is not repeated and comprises a nucleotide sequence having at least 3 nucleotides.

[0021] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 400 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 300 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 200 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 150 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 50 CpG / vector.

[0022] In some embodiments, Y comprises at least 5 nucleotides. In some embodiments, Y comprises at least 10 nucleotides. In some embodiments, Y comprises at least 15 nucleotides. In some embodiments, Y comprises at least 20 nucleotides. In some embodiments, Y encodes at least a portion of a bacterial origin of replication. In some embodiments, Y encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, Y encodes a bacterial repressor tRNA. In some embodiments, Y encodes a bacterial RNAi repressor. In some embodiments, Y encodes an antisense RNA. In some embodiments, Y encodes a bacterial operon sequence. In some embodiments, the bacterial operon sequence comprises a lac operon. In some embodiments, the bacterial operon sequence comprises a tet operon.

[0023] In some embodiments, the non-viral DNA vector lacks drug resistance genes. In some embodiments, the non-viral DNA vector includes one or more recombination sites. In some embodiments, the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, for example, Lox511 or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled. In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negative supercoiled regions. In some embodiments, the non-viral DNA vector is non-immunogenic.

[0024] In some embodiments, X and X' are derived from nucleic acid sequences present in one or more AAV serotypes. In some embodiments, X and X' each comprise a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 91% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 92% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 93% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 94% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprises a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprises a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprises a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 1-18. In some embodiments, X and X' each comprises a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 1-18. In some embodiments, the non-viral DNA vector does not comprise a DD element. In some embodiments, the non-viral DNA vector does not comprise a DD element, but comprises at least a portion of a bacterial origin of replication.

[0025] In some embodiments, Y has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 91% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 92% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 93% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 94% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the nucleotide sequence of Y has any one of SEQ ID NOs: 58-59. In some embodiments, Y does not include a bacterial origin of replication or any portion thereof.

[0026] In some embodiments, the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but wherein the bacterial origin of replication or a portion of the bacterial origin of replication is not included in the second portion. In some embodiments, the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but wherein the bacterial origin of replication or a portion of the bacterial origin of replication is not included in Y. In some embodiments, the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NO: 64 or 65), ATP7B (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NO: 70 or 83), AlAT (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NO: 67), BDF8 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NO: 71), NO:68 having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity) and variants thereof. In some embodiments, the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

[0027] The third aspect of the present disclosure is a kind of isolated circular non-viral DNA vector, which comprises the following elements operably connected in the 5' to 3' direction: (i) a first repeat sequence; (ii) a non-repetitive nucleotide sequence having at least 3 nucleotides; (iii) a second repeat sequence; and (iv) an expression cassette. In some embodiments, the non-viral DNA vector comprises less than about 400 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 300 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 250 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 200 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 150 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 100 CpGs / vector. In some embodiments, the non-viral DNA vector comprises less than about 50 CpGs / vector. In some embodiments, the expression cassette includes one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter.

[0028] In some embodiments, the non-repetitive nucleotide sequence comprises at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 15 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 20 nucleotides. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes at least a portion of a bacterial replication origin. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial suppressor tRNA. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial suppressor RNAi repressor. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes antisense RNA. In some embodiments, the non-repetitive nucleotide sequence with at least 3 nucleotides encodes a bacterial operon sequence. In some embodiments, the bacterial operon sequence comprises a lac operon. In some embodiments, the bacterial operon sequence comprises a tet operon.

[0029] In some embodiments, the non-viral DNA vector lacks drug resistance genes. In some embodiments, the non-viral DNA vector includes one or more recombination sites. In some embodiments, the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, for example, Lox511 or Lox66 sites. In some embodiments, the non-viral DNA vector is non-immunogenic. In some embodiments, the non-viral DNA vector is substantially double-stranded.

[0030] In some embodiments, the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 64, 65, 66, or 69), ATP7B (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 70 or 83), AlAT (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 67), BDF8 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 71 or 72), NO:68 having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity) and variants thereof. In some embodiments, the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

[0031] The fourth aspect of the present disclosure is an isolated circular non-viral DNA vector comprising: a first portion comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by at least a portion of a bacterial replication origin.

[0032] In some embodiments, the non-viral DNA vector has substantially no CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 400 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 300 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 250 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 200 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 150 CpG / vector. In some embodiments, the non-viral DNA vector comprises less than about 50 CpG / vector.

[0033] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector includes one or more recombination sites. In some embodiments, the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, for example, Lox511 or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled.

[0034] In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more regions of negative supercoil.In some embodiments, the non-viral DNA vector is non-immunogenic.

[0035] In some embodiments, each inverted repeat sequence is derived from a nucleic acid sequence present in one or more AAV serotypes. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 85% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 90% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 91% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 92% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 93% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 94% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence having at least 95% identity with any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat comprises a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat comprises a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat comprises a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat comprises a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 1-18. In some embodiments, the non-viral DNA vector does not comprise a DD element. In some embodiments, the non-viral DNA vector does not comprise a DD element, but comprises at least a portion of a bacterial origin of replication.

[0036] In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the nucleotide sequence of at least a portion of the bacterial origin of replication has any one of SEQ ID NOs: 58-59.

[0037] In some embodiments, the second portion comprises a first nucleic acid sequence at least 85% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 85% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 85% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.In some embodiments, the second portion comprises a first nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 99% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 99% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 99% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0038] In some embodiments, the second portion comprises a nucleic acid sequence at least 80% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence at least 85% identical to any one of SEQ ID NOs: 35 and 60.

[0039] In some embodiments, the second portion comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 92% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence having any one of SEQ ID NOs: 35 and 60.

[0040] In some embodiments, the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 64, 65, 66, or 69), ATP7B (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 70 or 83), A1AT (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to SEQ ID NO: 67), BDF8 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 71 or 72), NO:68 having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity) and variants thereof. In some embodiments, the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

[0041] In some embodiments, the non-viral DNA vector further comprises an S / MAR element. In some embodiments, the non-viral DNA vector further comprises an insulator element. In some embodiments, the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

[0042] The fifth aspect of the present disclosure is an isolated circular non-viral DNA vector comprising: a first part comprising an expression cassette, the expression cassette comprising a nucleic acid sequence encoding a polypeptide having any one of formulas (IA) to (IE), wherein the nucleic acid sequence encoding the polypeptide is operably linked to a promoter; and a second part capable of forming at least one cruciform structure, wherein the second part comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides;

[0043] [A] v -[B]-[C] w -[R] q -([D] x -[E] y ) z (IA),

[0044] [A]-[B]-[C]-[R] q -([D] x -[E] y ) (IB),

[0045] ([A]-[B])-([D] x -[E] y ) z (IC),

[0046] ([A]-[B])-([E]y) (ID), and

[0047] [A]-[B]-[R] q -([E] y ) (IE)

[0048] in

[0049] A comprises an amino acid sequence encoding a secretory signal peptide;

[0050] B contains the amino acids encoding alkaline phosphatase;

[0051] C contains the amino acid sequence encoding the GPI anchor;

[0052] R is -(M o (Fc)N p)-, wherein M and N each independently comprise 1 to 6 amino acids, wherein Fc is an Fc domain, and o and p each independently are 0, 1 or 2;

[0053] D comprises an amino acid sequence of 4 to 6 amino acids, or is F(G) t F, wherein each F is the same amino acid, G is an amino acid sequence of 3, 4 or 5 amino acids, and t is an integer in the range of 2-5;

[0054] E comprises an amino acid sequence having 1 to 8 amino acids;

[0055] q is 0 or 1;

[0056] v is 0 or 1;

[0057] w is 0 or 1;

[0058] x is 0 or an integer in the range of 1 to 6;

[0059] y is 0 or an integer in the range of 1 to 16; and

[0060] z is 0 or an integer in the range of 1 to 6.

[0061] In some embodiments, when v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid -DI-, M is diamino acid -LK-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130, and x is 0, then [E] y Does not contain ten to sixteen consecutive aspartic acid residues.

[0062] In some embodiments, E comprises 3 amino acids. In some embodiments, E is -DSS-. In some embodiments, E is -DSS- and y is in the range of 1 to 16. In some embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 2. In some embodiments, E is -DSS-, y is 6, z is 1, x is 2, and q is 1.

[0063] The sixth aspect of the present disclosure is an isolated circular non-viral DNA vector having a nucleic acid sequence with at least 80% identity to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73, for example, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the isolated circular non-viral DNA is provided in a pharmaceutically acceptable medium. In some embodiments, the isolated circular non-viral DNA is formulated with one or more lipid nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more polymer nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more proteolipid nanoparticles.

[0064] The seventh aspect of the present disclosure is an isolated circular non-viral DNA vector, whose nucleic acid sequence has any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73. In some embodiments, the isolated circular non-viral DNA is provided in a pharmaceutically acceptable medium. In some embodiments, the isolated circular non-viral DNA is formulated with one or more lipid nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more polymer nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more protein lipid nanoparticles.

[0065] The eighth aspect of the present disclosure is a pharmaceutical composition comprising any of the isolated circular non-viral DNA vectors of any of the foregoing embodiments and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated with a lipid-based delivery vehicle. In some embodiments, the pharmaceutical composition is formulated into lipid nanoparticles. In some embodiments, the pharmaceutical composition is formulated into lipid nanocapsules. In some embodiments, the pharmaceutical composition is formulated with one or more polymers.

[0066] The ninth aspect of the present disclosure is a method for treating a patient in need of treatment thereof, the method comprising administering any of the above-mentioned pharmaceutical compositions. In some embodiments, the pharmaceutical composition is administered weekly. In some embodiments, the pharmaceutical composition is administered monthly. In some embodiments, the pharmaceutical composition is administered every two months. In some embodiments, the pharmaceutical composition is administered every six months. In some embodiments, the pharmaceutical composition is administered annually. In some embodiments, the pharmaceutical composition is administered every two years. In some embodiments, the pharmaceutical composition is administered every several years.

[0067] The tenth aspect of the present disclosure is a method for treating hypophosphatasia, comprising administering a therapeutically effective amount of any of the above-mentioned isolated circular non-viral DNA vectors or a pharmaceutical composition comprising the same.

[0068] The eleventh aspect of the present disclosure is a method for treating, alleviating or preventing the symptoms of hypophosphatasia, comprising administering a therapeutically effective amount of any of the above-mentioned isolated circular non-viral DNA vectors or a pharmaceutical composition comprising the same.

[0069] A twelfth aspect of the present disclosure relates to use of any of the above-mentioned isolated circular non-viral DNA vectors (or pharmaceutical compositions comprising the same) for treating hypophosphatasia. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Reference is made to the accompanying drawings for an overall understanding of the features of the present disclosure. In the accompanying drawings, the same reference numerals are used throughout to identify the same elements.

[0071] Figure 1A A non-viral DNA vector is illustrated, comprising: (i) a first portion comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides. Here, the first portion comprises a nucleic acid encoding human tissue non-specific alkaline phosphatase (TNALP), the nucleic acid being controlled by a promoter, including any of those described herein. In some embodiments, the cruciform structure comprises a Holliday knot.

[0072] Figure 1B and 1C Indicated Figure 1A The non-viral DNA vector is shown and at least one cruciform structure formed is shown. The inverted DNA repeat sequence element that leads to the formation of the cruciform DNA structure may contain Figure 1B These smaller internal inverted DNA repeat elements can form additional secondary structures, thereby stabilizing the formation of a larger cruciform structure. Figure 1BAs shown in the figure, the cross-shaped structure is formed between certain repeat sequence elements, however, due to the nature of these repeat sequences, the cross can be formed between other repeat sequence elements, or between the inverted repeat sequence and the rest of the non-viral DNA vector. In some embodiments, the inverted repeat sequence elements may also be discontinuous, with regions of non-base pairing or single-stranded DNA. One such region containing non-base pairing or single-stranded DNA is in a region comprising a non-repetitive nucleotide sequence of at least 3 nucleotides, which region is inside the cross-shaped structure (see Figure 1A In view of the components of the non-viral DNA vector of the present disclosure, it is believed that at least two inverted repeat sequences, each separated by a non-repetitive nucleotide sequence of at least 3 nucleotides, facilitate the formation of a single cruciform structure having two long arms terminated by regions of single-stranded DNA.

[0073] Figure 1D Indicated Figure 1A A non-viral DNA vector is shown, and at least one cruciform structure formed is schematically illustrated, and the secondary structure of the incorporated portion having a non-repetitive nucleotide sequence of at least 3 nucleotides, which portion can be part of a bacterial replication origin.

[0074] Figure 1E The predicted secondary structure of the bacterial origin of replication between two inverted terminal repeats is depicted. This single large cruciform structure contains many regions of single-stranded and non-repeat-forming DNA in the region of the bacterial origin of replication.

[0075] Figure 2A , 2B , 2C, 2D and 2E depict the predicted DNA secondary structure of the zero CpG internal repeat sequence of the circular non-viral DNA vector (SEQ ID NO: 29, 30 and 31) according to the present disclosure, as well as the calculated Gibbs free energy, the normalized calculated Gibbs free energy per bp, and the melting temperature (Tm). Based on this assessment, although the two long inverted repeat sequences contain smaller internal inverted repeat sequences, internal secondary structures may not form within the two long inverted repeat sequences when containing parts of the bacterial replication origin.

[0076] Figure 3 Three representative transmission electron micrographs of circular non-viral DNA vectors of the present disclosure are provided, which include at least two inverted repeat sequences separated by at least a portion of a bacterial origin of replication (M012—SEQ ID NO: 10).

[0077] Figure 4The dissociation of the circular non-viral vector DNA reporter constructs containing a cruciform structure (P004-SEQ ID NO: 35; P006-SEQ ID NO: 14) of the present disclosure delivered by polyethyleneimine (PEI) and SM-102-based lipid nanoparticles (LNP) in 293 cells is illustrated. The data show that the dissociation of the reporter constructs delivered with LNP and PEI begins at day 6. The data also show that different inverted repeat sequences will have different dissociation efficiencies.

[0078] Figure 5 Demonstrated are simultaneous green fluorescent protein (GFP) and red fluorescent protein (RFP) expression at day 3 and predominant RFP expression at day 8 in non-dividing induced pluripotent stem cell (iPSC)-derived human hepatocytes transfected with a circular non-viral DNA vector including an RFP / GFP reporter (SEQ ID NO: 32).

[0079] Figure 6 The gene expression and persistence of firefly luciferase from two different constructs, namely a circular non-viral DNA vector from the present disclosure (SEQ ID NO: 30) and a plasmid (SEQ ID NO: 31) in post-mitotic human iPSC-derived hepatocytes were compared. The data revealed that the transgene expression from the circular non-viral DNA vector of the present disclosure (SEQ ID NO: 30) with a cruciform structure was much higher and more stable than the plasmid construct (SEQ ID NO: 31).

[0080] Figure 7 The secreted ALP activity of human tissue non-specific alkaline phosphatase (TNALP) in post-mitotic iPSC-derived hepatocytes from three different constructs, namely, from a circular non-viral DNA vector of the present disclosure containing a cruciform structure consisting of a long inverted repeat sequence containing a bacterial origin of replication (M012-SEQ ID NO: 28), from a circular non-viral DNA vector of the present disclosure containing a cruciform structure consisting of a shorter inverted repeat sequence without a bacterial origin (M013-SEQ ID NO: 29), and from a conventional plasmid vector (P020-SEQ ID NO: 33), respectively. The data demonstrate significantly enhanced transgene (TNALP) expression from a vector consisting of a long inverted repeat sequence containing a bacterial origin of replication.

[0081] Fig. 8A Schematically, compared with the rapid decay of the control luciferase plasmid, the circular non-viral DNA vector encoding the luciferase reporter according to the present disclosure (M014-SEQ ID NO: 30) showed a persistent bioluminescent signal in mouse liver tissue harvested from week 1 to week 4 and week 5 after administration by hydrodynamic tail vein injection. Figure 8B The DNA copy number results match the gene expression of the two DNA vectors. The DNA copy number of the circular non-viral DNA vector was maintained in the mouse liver tissue for one month, while the copy number of the control luciferase plasmid (P021-SEQ ID NO: 31) in the mouse hepatocytes decreased significantly from the 1st week to the 5th week, as shown in Figure 2. Figure 8B as shown in .

[0082] Fig. 9 Data from a single time point comparing two different studies are shown. The first study used a circular non-viral DNA vector including nucleic acid encoding TNALP; while the second study used mobilized human hematopoietic stem cells transduced with a lentiviral vector expressing TNALP. Similar plasma ALP activity was mediated in mice in these two different studies.

[0083] Fig.10 The classical mechanism of Holliday knot dissociation is illustrated. (A) Antiparallel stacking-X Holliday knot with two-fold symmetry. (B) Classical Holliday knot dissociation enzymes are dimerases that induce structural changes in the knot when bound, resulting in the knot unfolding. Dissociation is achieved by introducing two coordinated and symmetrically related gaps in the same polarity chain at or very close to the branch point. (C) Symmetric dissociation produces a pair of gapped DNA duplexes, each of which can be directly repaired by gap connection, or homology sequences can serve as templates for non-homologous end joining (NHEJ) or homology-directed repair (HDR). Asterisks indicate given DNA chains.

[0084] Fig.11 The dissociation mechanism of the circular non-viral DNA vector containing at least one cross structure (Holliday knot) (form A) disclosed herein is illustrated. Once introduced into a eukaryotic cell, the Holliday knot dissolution enzyme will introduce two coordinated and symmetrically related gaps in the chain of the same polarity at or very close to the branch point. Symmetrical dissociation produces a circular or linear DNA duplex with a gap, which can be directly repaired by gap connection (generating form B), or a homology sequence can serve as a template for NHEJ or HDR (generating form C). It is also expected that the process can be repeated to produce a linear or circular form of higher molecular weight.

[0085] Fig. 12A and 12BThe persistence of the circular non-viral DNA vectors of the present disclosure (M027 and M032 - SEQ ID NO: 74 and SEQ ID NO: 75) encoding the murine secreted embryonic alkaline phosphatase (SEAP) reporter in a rodent model injected by hydrodynamic tail vein at 15 μg DNA per mouse per dose is shown. High plasma SEAP activity in mouse plasma was maintained from day 1 to day 190 following double dose injection by hydrodynamic tail vein at 15 μg DNA per mouse per dose. In addition, analysis of DNA vector copy number per diploid cell showed that three constructs according to the present disclosure (M027 - SEQ ID NO: 74; M032 - SEQ ID NO: 75) were maintained in the mouse liver for 183 days ( Fig. 12C ).

[0086] Fig.13A and 13B A comparison of two constructs according to the present disclosure at day 3 in iPSC-derived hepatocytes is illustrated, wherein the two constructs have two different cruciform structures, namely M012 (SEQ ID NO: 30) and M056 (SEQ ID NO: 73). Fig.13A It was shown that cells transfected with construct M056 (SEQ ID NO: 73) having a further optimized cruciform structure had much higher ALP secretion levels in the culture medium than those transfected with M012 (SEQ ID NO: 30) using both FuGENE and SM102-based lipid nanoparticle formulations. Fig. 13B It was shown that two constructs with different structures (M012 - SEQ ID NO: 30 and M056 - SEQ ID NO: 73) had no significant effect on the viability of the transfected cells.

[0087] Fig.14A , 14B and 14C illustrate enhanced nuclear entry of constructs according to the present disclosure having a cruciform structure (M012 - SEQ ID NO: 28; M013 - SEQ ID NO: 29) compared to DNA without a cruciform structure (M022 - SEQ ID NO: 33) in post-mitotic non-dividing iPSC-derived hepatocytes after transfection. Fig.14ARepresentative images are shown, where DAPI staining (blue) represents the nucleus, green foci without green circles represent the disclosed constructs in the cytoplasm, and green foci marked with green circles represent the disclosed constructs in the nucleus. The fluorescently labeled circular non-viral DNA vector (M012-SEQ ID NO: 28) comprising a nucleic acid encoding TNALP and also comprising a double inverted repeat sequence showed the highest number of foci per cell nucleus at days 3 and 6 compared to (i) a circular non-viral DNA vector comprising a single inverted repeat sequence without an intervening heterologous sequence (DD-ITR construct) (M013-SEQ ID NO: 29) and (ii) a control with no cruciform structure at all (M022-SEQ ID NO: 33). Fig. 14B There was a correlation between the number of foci per cell nucleus and the ALP activity measured in the cell culture medium ( Fig. 14C ).

[0088] Fig.15A and 15B It is illustrated that the construct of the present disclosure including firefly luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) results in much higher luciferase activity than the control DNA without a cruciform structure (SEQ ID NO: 74) across species in both human and cynomolgus monkey hepatocytes. The construct according to the present disclosure (SEQ ID NO: 73) with luciferase DNA and the control luciferase DNA without a cruciform structure (SEQ ID NO: 74) were transfected into hepatocytes using a SM102-based lipid nanoparticle formulation.

[0089] Fig.16 It is illustrated that the construct according to the present disclosure having a luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) also results in much higher luciferase activity in mice than a control DNA without a cruciform structure (SEQ ID NO: 74). A circular non-viral DNA vector (SEQ ID NO: 73) including a firefly luciferase reporter and a control DNA without a cruciform structure (SEQ ID NO: 74) were administered to mice by hydrodynamic tail vein injection (15 μg per mouse), and mouse liver tissues were harvested on days 7 and 14, and then luciferase activity assays were performed.

[0090] Fig.17Schematically, the construct according to the present disclosure (SEQ ID NO: 43) has high durability compared to mRNA. The construct according to the present disclosure (SEQ ID NO: 43) and the chemically modified mRNA encoding the cynomolgus monkey soluble TNALP transgene were transfected into primary human hepatocytes via a SM102-based lipid nanoparticle formulation. The ALP activity of the construct according to the present disclosure in the culture medium increased from day 1 to day 3, and then remained from day 3 to day 6. At the same time, the ALP activity of the mRNA transfected cells decreased from day 1 to day 5 and disappeared on day 6.

[0091] Fig.18 Co-localization of PARP1 (purple) and a construct according to the present disclosure (green) (M012-SEQ ID NO: 28) in the cytoplasm of 293 cells 24 hours after transfection is illustrated. PARP1 is a well-known first responder that detects DNA damage and then promotes genomic DNA repair pathways. The co-localization data suggests that PARP1 may be one of the factors involved in innate immune evasion, dissociation, nuclear entry, recombination, and nuclear retention of the construct according to the present disclosure.

[0092] Fig.19A , 19B and 19C illustrate the immunomodulatory effects of circular non-viral constructs according to the present disclosure. Fig.19B It is shown that the human TNALP DNA construct according to the present disclosure with an optimized cruciform structure (M012 - SEQ ID NO: 28) results in much higher ALP activity, more sustained transgene expression and lack of immune response in mice (as shown by the ability to repeat dosing) compared to a non-viral human TNALP DNA vector with an earlier version of the cruciform structure (comprising a single inverted repeat sequence without an intervening heterologous sequence) (DD-ITR construct) (M013 - SEQ ID NO: 29) ( Fig.19A ). Fig.19C Schematic representation of an optimized cynomolgus monkey TNALP DNA construct (M026-SEQ ID NO: 43) according to the present disclosure with an improved cruciform structure further improving the potency and persistence of transgene expression while maintaining the ability for repeated dosing compared to a similar construct without gene cassette optimization. The non-viral DNA construct was repeatedly administered at 3-week intervals by hydrodynamic tail vein injection (15 μg per mouse) and plasma samples were collected weekly to assess ALP activity. DETAILED DESCRIPTION

[0093] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are described unless explicitly stated to the contrary.

[0094] References in the specification to "one embodiment", "an embodiment", "an illustrative embodiment", etc. indicate that the described embodiment may include a particular feature, structure, or characteristic, but each embodiment may or may not necessarily include the particular feature, structure, or characteristic. Furthermore, such statements do not necessarily refer to the same embodiment. Furthermore, when a particular feature, structure, or characteristic is described in conjunction with one embodiment, it should be considered that it is within the knowledge of those skilled in the art to affect such feature, structure, or characteristic in conjunction with other embodiments, whether or not explicitly described.

[0095] As used herein, the singular forms "a", "an", and "the" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. The definition of the term "comprising" is inclusive, thus "comprising A or B" means comprising A, B, or A and B.

[0096] As used herein in the specification and in the claims, "or" shall be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as inclusive, for example, including at least one of a plurality of elements or a list of elements, but also including more than one, and optionally including additional unlisted items. Only terms that explicitly indicate the opposite, such as "only one of..." or "exactly one of...", or when used in the claims, "consisting of..." will mean including a plurality of elements or exactly one element of a list of elements. In general, the term "or" as used herein when followed by an exclusive term such as "any of...", "one of...", "only one of..." or "exactly one of..." shall only be interpreted as indicating exclusive alternatives (e.g., "one or the other but not both"). When used in the claims, "consisting essentially of..." shall have its ordinary meaning as used in the field of patent law.

[0097] As used herein, the terms "comprising," "including," "having," and the like are used interchangeably and have the same meaning. Similarly, "comprises," "includes," "has," and the like are used interchangeably and have the same meaning. Specifically, the definition of each of these terms is consistent with the general definition of "comprising" in U.S. patent law and is therefore interpreted as an open term meaning "at least the following," and is also interpreted as not excluding additional features, limitations, aspects, and the like. Thus, for example, "a device having components a, b, and c" means that the device includes at least components a, b, and c. Similarly, the statement "a method involving steps a, b, and c" means that the method includes at least steps a, b, and c. In addition, although the steps and processes may be outlined in a particular order herein, those skilled in the art will recognize that the ordering of the steps and processes may be different.

[0098] As used herein in the specification and in the claims, when referring to a list of one or more elements, the expression "at least one" should be understood to mean at least one element selected from any one or more elements in the list of elements, but does not necessarily include at least one of each element specifically listed in the list of elements, nor does it exclude any combination of elements in the list of elements. This definition also allows that elements may optionally be present in addition to the elements specifically identified in the list of elements to which the expression "at least one" refers, whether related or unrelated to those specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or equivalently "at least one of A or B" or equivalently "at least one of A and / or B" may refer to at least one, optionally including more than one A without B (and optionally including elements other than B) in one embodiment; to at least one, optionally including more than one B without A (and optionally including elements other than B) in another embodiment; to at least one, optionally including more than one A and at least one, optionally including more than one B (and optionally including elements other than B) in yet another embodiment; and so on.

[0099] As used herein, the term "about" refers to a measurable value such as the length of a nucleotide sequence, polynucleotide or polypeptide sequence, dosage, time, temperature, etc., and is intended to encompass variations of 20%, 10%, 5%, 1%, 0.5% or even 0.1% of the specified amount.

[0100] As used herein, the term "Fc" refers to the human IgG Fc domain. Subtypes of IgG such as IgG1, IgG2, IgG3, and IgG4 are all considered for use as the Fc domain.

[0101] As used herein, the term "heterologous gene" refers to a nucleotide sequence that is not naturally associated with the host animal into which it is introduced, including, for example, an exon coding sequence from a human gene introduced into a host nematode as a chimeric heterologous gene.

[0102] As used herein, the term "host cell" refers to any cell type susceptible to transformation, transfection, transduction, etc. of a nucleic acid construct or expression vector comprising a polynucleotide of the present disclosure. In some embodiments, the term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. Host cells may include packaging cells, production cells, and cells infected with viral vectors. In specific embodiments, host cells infected with viral vectors of the present disclosure are administered to a subject in need of treatment. In some embodiments, host cells are transduced ex vivo. In other embodiments, host cells are transduced in vivo.

[0103] As used herein, the terms "hypophosphatasia" and "HPP" refer to a rare inherited skeletal disorder caused by one or more loss-of-function mutations in the ALPL (alkaline phosphatase, liver / bone / kidney) gene, e.g., encoding tissue nonspecific alkaline phosphatase (TNALP). HPP can be further characterized as, e.g., infantile HPP or perinatal HPP (e.g., benign perinatal HPP or lethal perinatal HPP). For example, "infantile HPP" describes a patient who develops HPP at about three years of age or younger, while "perinatal HPP" describes a patient who develops HPP immediately before or after birth (e.g., one to four weeks after birth). The age of onset of HPP (such as when a subject exhibits symptoms of HPP) can also be classified, e.g., as perinatal onset HPP and infantile onset HPP. Patients with HPP may exhibit symptoms of HPP including, but not limited to, skeletal deformities, hypotonia, movement disorders, gait disorders, bone deformities, joint pain, bone pain, fractures, muscle weakness, myalgia, rickets (e.g., growth plate cartilage defects), premature loss of primary teeth, incomplete bone mineralization, elevated blood and / or urine levels of phosphoethanolamine (PEA), PPi, pyridoxal 5′-phosphate (PLP), hypomineralization, spinous ribs, hypercalciuria, short stature, HPP-associated seizures, inadequate weight gain, craniosynostosis, and / or deposition of calcium pyrophosphate dihydrate crystals (CPPD) in the joints leading to, for example, chondrocalcinosis and premature death. Symptoms of HPP may also include TBM and symptoms of TBM such as cardiorespiratory arrest, tracheostomy, cardiac arrest, respiratory distress, sputum retention, wheezing, cough, hypoxic episodes, cyanosis, bradycardia, tachycardia, spontaneous hyperextension of the neck, prolonged expiratory respiratory period, failure to thrive, sternal retraction, substernal retraction, intercostal retraction, intermittent or persistent dyspnea, and recurrent bronchitis or pneumonia.

[0104] As used herein, the term "nucleic acid" refers to polynucleotides, such as DNA or RNA. Nucleic acids can be single-stranded, partially or completely double-stranded, and in some cases partially or completely triple-stranded. Nucleic acids include genomic DNA, cDNA, mRNA, etc. Nucleic acids can be purified from natural sources, produced using a recombinant expression system and optionally purified, chemically synthesized, etc. When appropriate, for example, in the case of chemically synthesized molecules, nucleic acids can include nucleoside analogs such as analogs with chemically modified bases or sugars, main chain modifications, etc. As used herein, the term "nucleic acid sequence" can refer to the nucleic acid material itself, and is not limited to characterizing the sequence information (i.e., the continuity of the letters selected in the five base letters A, G, C, T or U) of a specific nucleic acid (e.g., DNA or RNA molecule) in a biochemical manner. Unless otherwise indicated, nucleic acid sequences are presented in a 5' to 3' direction. The term "nucleic acid fragment" is used herein to refer to a nucleic acid sequence that is a part of a longer nucleic acid sequence.

[0105] As used herein, the term "operably linked" or "operably associated" refers to a functional relationship between two nucleic acids in which the expression, activity, localization, etc. of one sequence is controlled, directed, regulated, modulated, etc. by the other nucleic acid. The two nucleic acids are described as being operably linked or operably associated or in operably associated. "Operably linked" or "operably associated" can also refer to a relationship between two polypeptides in which the expression of one polypeptide is controlled, directed, regulated, modulated, etc. by the other polypeptide. For example, transcription of a nucleic acid is directed by an operably linked promoter; post-transcriptional processing of a nucleic acid is directed by an operably linked processing sequence; translation of a nucleic acid is directed by an operably linked translation regulatory sequence (such as a translation initiation sequence); transport, stability or localization of a nucleic acid or polypeptide is directed by an operably linked transport or localization sequence (such as a secretion signal sequence); post-translational processing of a polypeptide is directed by an operably linked processing sequence. Typically, a first nucleic acid sequence operably linked to a second nucleic acid sequence or a first polypeptide operably linked to a second polypeptide is covalently linked directly or indirectly to such a sequence, but any effective three-dimensional association is acceptable. One of ordinary skill in the art will appreciate that multiple nucleic acids or multiple polypeptides can be operably linked or associated with each other.

[0106] As used herein, the term "pharmaceutically acceptable excipient", "carrier" or "diluent" refers to a pharmaceutical component that does not alter the therapeutic properties of the active agent with which it is administered. An exemplary pharmaceutically acceptable carrier substance is normal saline. For example, a pharmaceutically acceptable carrier can include sodium chloride (e.g., 150 mM sodium chloride) and sodium phosphate (e.g., 25 mM sodium phosphate). Other physiologically acceptable excipients, carriers and diluents and their formulations are known to those skilled in the art and are described, for example, in Remington: The Science and Practice of Phamlacy (22nd Edition), Allen (2012). For example, a pharmaceutically acceptable excipient, carrier or diluent can include disodium hydrogen phosphate heptahydrate, sodium dihydrogen phosphate monohydrate and sodium chloride at a pH between 7.2 and 7.6.

[0107] As used herein, the term "pharmaceutical composition" refers to a composition containing an active agent as described herein, formulated with at least one pharmaceutically acceptable excipient, carrier or diluent. The pharmaceutical composition can be manufactured or sold under the approval of a government regulatory agency as part of a treatment regimen for treating or preventing a patient (e.g., an infant with HPP, such as an infant with perinatal onset HPP, or an infant with infantile onset HPP, or an adolescent onset HPP, or a patient with childhood onset HPP) disease or event. The pharmaceutical composition can be formulated, for example, for subcutaneous administration, intravenous administration (e.g., as a sterile solution that does not contain particulate emboli and in a solvent system suitable for intravenous use), for oral administration (e.g., tablets, capsules, caplets, caplets or syrups) or any other formulation described herein, for example, in unit dosage form.

[0108] As used herein, unless otherwise indicated, the terms "polypeptide", "polypeptide fragment", "peptide" and "protein" are used interchangeably and are used according to the conventional meaning, i.e., a sequence of amino acids. Polypeptides are not limited to a specific length, for example, they may comprise a fragment of a full-length protein sequence or a full-length protein, and may include post-translational modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, etc., and other modifications known in the art, including naturally occurring and non-naturally occurring. In various embodiments, the polypeptides encompassed herein include a signal (or leader) sequence at the N-terminus of the protein, which guides the transfer of the protein during or after translation. Any of a variety of well-known recombinant and / or synthetic techniques can be used to prepare polypeptides. In some embodiments, the polypeptides encompassed herein include alkaline phosphatase, or a sequence having a deletion, addition and / or replacement of one or more amino acids of a CAR as disclosed herein.

[0109] As used herein, "prevent" and similar words such as "prevented", "preventing", etc. refer to methods for preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of a disease or condition. It also refers to delaying the onset or recurrence of a disease or condition or delaying the onset or recurrence of symptoms of a disease or condition. As used herein, "prevent" and similar words also include reducing the intensity, effects, symptoms, and / or burden of a disease or condition before the onset or recurrence of the disease or condition.

[0110] As used herein, the term "promoter" as used herein refers to a DNA sequence that determines the transcription start site of RNA polymerase. The promoter sequence contains a motif recognized and bound by a polypeptide, i.e., a transcription factor. The transcription factor should recruit RNA polymerase II, preferably RNA polymerase I, II or III, more preferably RNA polymerase II or III, and most preferably RNA polymerase IL after binding, so as to start the expression of the nucleic acid operably connected to the transcription control sequence. It should be understood that, depending on the type of nucleic acid to be expressed, the expression referred to herein may include transcribing the DNA sequence into RNA polynucleotides (suitable for, for example, antisense methods, RNAi methods or ribozyme methods), or may include transcribing the DNA sequence into RNA polynucleotides, followed by translation of the RNA polynucleotides into polypeptides (suitable for, for example, gene expression and recombinant polypeptide production methods). In order to control the expression of the nucleic acid sequence, the transcription control sequence may be positioned immediately adjacent to the nucleic acid to be expressed, i.e., physically connected to the 5' end of the nucleic acid. Alternatively, it may be located at a physically adjacent position. However, in the latter case, the sequence must be located at a position that allows functional interaction with the nucleic acid to be expressed.

[0111] As used herein, the term "regulatory sequence" or "regulatory element" refers to a nucleic acid sequence that regulates one or more steps in the expression (particularly transcription, but in some cases other events, such as splicing or other processing) of a nucleic acid sequence to which it is operably linked. The term includes promoters, enhancers, and other transcriptional control elements that direct or enhance transcription of an operably linked nucleic acid. Regulatory sequences can direct constitutive expression (e.g., expression in most or all cell types in culture or in an organism under typical physiological conditions), cell type-specific, lineage-specific, or tissue-specific expression, and / or regulatable (inducible or repressible) expression. For example, expression can be induced or repressed by the presence or addition of an inducer (such as a hormone or other small molecule), by increasing the temperature, and the like. Non-limiting examples of cell type, lineage or tissue specific promoters suitable for use in mammalian cells include lymphoid specific promoters (see, e.g., Calame et al., Adv. Immunol. 43:235, 1988), such as T cell receptor promoters (see, e.g., Winoto et al., EMBO J. 8:729, 1989) and immunoglobulin promoters (see, e.g., Banerji et al., Cell 33:729, 1983; Queen et al., Cell 33:741, 1983), and neuron specific promoters (e.g., neurofilament promoter; Byrne et al., Proc. Natl. Acad. Sci. USA 86:5473, 1989). Developmentally regulated promoters include hox promoters (see, e.g., Kessel et al., Science 249:374, 1990) and alpha-fetoprotein promoters (Campes et al., Genes Dev. 3:537, 1989). Some regulatory elements can inhibit or reduce the expression of operably linked nucleic acids. Such regulatory elements can be referred to as "negative regulatory elements". Regulatory elements whose activity can be induced or inhibited by exposure to inducers or inhibitors and / or by changing environmental conditions are referred to herein as "regulatable" elements.

[0112] As used herein, the term "signal peptide" refers to a short peptide (about 5 to about 30 amino acids long) at the N-terminus of a polypeptide that directs the polypeptide toward a secretory pathway (e.g., the extracellular space). In some embodiments, the signal peptide is typically cleaved during secretion of the polypeptide. In some embodiments, the signal sequence can direct the polypeptide to an intracellular compartment or organelle. In some embodiments, the signal sequence can be identified by homology or biological activity with a peptide with a known function of targeting a polypeptide to a specific region of a cell.

[0113] As used herein, the term "subject" refers to any animal subject, including laboratory animals (e.g., primates, rats, mice), livestock (e.g., cattle, sheep, goats, pigs, turkeys, chickens), domestic pets (e.g., dogs, cats, rodents, etc.), and humans.

[0114] As used herein, the term "therapeutically effective amount" refers to a virus or transduced therapeutic cell that can vary with factors such as the disease state, age, sex, and weight of the individual, and the ability of stem cells and progenitor cells to elicit a desired response in the individual. In some embodiments, a therapeutically effective amount is also an amount in which the therapeutically beneficial effects of the virus or transduced therapeutic cell outweigh any toxic or deleterious effects. In some embodiments, the term "therapeutically effective amount" includes an amount effective to "treat" a subject (e.g., a patient).

[0115] As used herein, the term "treatment" or "treating" refers to any beneficial or desired effect on the symptoms or pathology of a disease or pathological condition, and may include even a minimal reduction in one or more measurable markers of the disease or condition being treated. In some embodiments, treatment may optionally involve alleviating or ameliorating the symptoms of a disease or condition, or delaying the progression of a disease or condition. "Treatment" does not necessarily mean complete eradication or cure of a disease or condition or its associated symptoms.

[0116] As used herein, the term "variant" refers to a nucleic acid or polypeptide that is different from a reference nucleic acid or polypeptide but retains its essential properties. Typically, variants are very similar overall and identical to the reference nucleic acid or polypeptide in many regions. Thus, the "variant" forms of transcription factors are very similar overall and are able to bind to DNA and activate gene transcription.

[0117] As used herein, the term "vector" refers to a nucleic acid molecule that can transfer or transport another nucleic acid molecule. In some embodiments, the nucleic acid transferred is usually connected to a carrier nucleic acid molecule, for example, inserted into a carrier nucleic acid molecule. In some embodiments, the vector may include a sequence for autonomous replication in the instructing cell, or may include a sequence sufficient to allow integration into the host cell DNA. Available vectors include, for example, plasmids (usually DNA plasmids, but RNA plasmids are also available), cosmids, and viral vectors. As will be apparent to those skilled in the art, the term "viral vector" is widely used to refer to nucleic acid molecules (for example, plasmids), which include viral-derived nucleic acid elements that usually promote the transfer of nucleic acid molecules or the integration into the cell genome, or refer to viral particles that mediate nucleic acid transfer. In some embodiments, viral particles generally include various viral components, and sometimes also include host cell components other than nucleic acid.

[0118] Circular Allium Virus DNA Vector

[0119] The present disclosure relates to a circular non-viral DNA vector, such as a circular non-viral DNA vector comprising at least two inverted repeats, wherein the at least two inverted repeats are separated by a non-repetitive nucleotide sequence that is not a part of the at least two inverted repeats. In some embodiments, the non-repetitive nucleotide sequence comprises at least 3 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 4 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 5 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 7 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 10 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 15 nucleotides. In other embodiments, the non-repetitive nucleotide sequence comprises at least 20 nucleotides. Examples of suitable non-repetitive nucleotide sequences include, but are not limited to, TTG, AAT, TAA, TAG, AGTT, AGTA, TAAA, TCAA, GAGTA, AAGTGCA, AGTACAAATTG and ACCTTAGAGGCTA.

[0120] In some embodiments, the non-repetitive nucleotide sequence comprises a minimal bacterial replication origin. In other embodiments, the non-repetitive nucleotide sequence comprises a heterologous gene or a portion of a heterologous gene, such as a gene encoding a bacterial repressor tRNA, an RNAi repressor, or an antisense RNA. In other embodiments, the non-repetitive nucleotide sequence comprises a bacterial operon sequence, such as a lac operon or a tet operon.

[0121] In some embodiments, the circular non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the circular non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0122] In some embodiments, the circular non-viral DNA vector lacks a drug resistance gene. In some embodiments, the circular non-viral DNA vector includes two inverted repeat sequences separated by a non-repetitive nucleotide sequence; wherein the vector also includes at least a portion of a bacterial replication origin, and wherein at least a portion of the bacterial replication origin is not included in any of the two inverted repeat sequences or in the non-repetitive nucleotide sequence. In some embodiments, at least a portion of the bacterial replication origin is located adjacent to a heterologous gene. In some embodiments, the circular non-viral DNA vector includes one or more recombination sites, for example, LoxP sites, FRT sites, attB and attP sites or their product sites attL or attR, or alternative recombination target sites derived from these sites, for example, Lox7, Lox511 or Lox66 sites.

[0123] In some embodiments, the circular non-viral DNA vector is substantially double-stranded. In other embodiments, the circular non-viral DNA vector is substantially supercoiled. In other embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negative supercoiled regions.

[0124] In some embodiments, the circular non-viral DNA vector is non-immunogenic (e.g., has a reduced likelihood of triggering an immune response compared to other non-viral DNA vectors or viral vectors such as lentiviral vectors, adenoviral vectors, and adeno-associated viral (AAV) vectors). It is also believed that the circular non-viral DNA vectors of the present disclosure are suitable for repeated administration, as further described herein. In addition, the reduction in immunostimulatory CpG content facilitates repeated administration, which is believed to be important for pediatric patients.

[0125] In some embodiments, the circular non-viral DNA vectors of the present disclosure promote the sustained in vivo expression of one or more heterologous genes encoding one or more therapeutic proteins. Without wishing to be bound by any particular theory, it is believed that the non-viral DNA vectors of the present disclosure act like endogenous genes in the nucleus to enhance the persistence of gene expression. In some embodiments, the circular non-viral DNA vector lasts for at least about 4 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 6 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 8 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 10 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 12 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 14 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 16 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector lasts for at least about 20 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 24 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 36 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 48 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 1 year after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 2 years after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 4 years after in vivo administration.

[0126] It is believed that the transgene carried by the circular non-viral DNA vector of the present disclosure is taken up by the cell and expressed at a level similar to the transgene expression of the viral vector; and the duration is similar to the duration of the non-integrating viral vector. Without wishing to be bound by any particular theory, it is believed that the circular non-viral DNA vector of the present disclosure works similarly to some non-integrating viral vectors by adopting a molecular form that allows for sustained gene expression. Such similarities may be related to the chromatin factors that the circular non-viral DNA vector of the present disclosure interacts with the viral vector, or to the chromatin structure adopted by the viral vector and the non-viral DNA vector of the present disclosure. Chromatin is a term that describes the structure that organizes DNA within the nucleus of a eukaryotic cell. In its simplest concept, chromatin consists of histones that form nucleosomes on DNA. However, the spacing and modifications of these histones are complex and non-random, and provide structure and signaling capabilities for the protein scaffolds around genes or structural elements. The role of chromatin in viral biology depends largely on the type of virus, but for all viruses that traverse the cell nucleus, interaction with chromatin is inevitable. The importance of chromatin dynamics in regulating basic viral vector processes, including entry, gene expression, and persistence, is beginning to be understood. The circular non-viral DNA vectors of the present disclosure are believed to exploit various aspects of chromatin dynamics in a manner similar to viral vectors. Such properties may include chromatin structures that promote interaction with the nuclear matrix, structures that regulate epigenetic factors that affect gene expression, structures that mediate nuclear organization, or structures that promote transcriptionally active chromatin states, etc.

[0127] In some embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 15 nucleotides.

[0128] In some embodiments, the second portion does not include a bacterial origin of replication or any portion thereof. In other embodiments, the non-repetitive nucleotide sequence does not include a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector includes a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or a portion thereof is not located in the second portion. In still other embodiments, at least a portion of the bacterial origin of replication is included in the first portion or in a third portion adjacent to the first or second portion, but not in the second portion.

[0129] In some embodiments, the cruciform structure comprises a Holliday junction.

[0130] In some embodiments, each inverted repeat sequence comprises or is derived from a nucleic acid sequence present within an AAV serotype (including any of those disclosed herein).

[0131] In some embodiments, the non-repetitive nucleotide sequence is single-stranded, and the remainder of the second part is double-stranded. In some embodiments, the non-viral DNA vector does not have a CpG sequence substantially. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / carriers, less than about 450 CpG / carriers, less than about 400 CpG / carriers, less than about 350 CpG / carriers, less than about 300 CpG / carriers, less than about 250 CpG / carriers, less than about 200 CpG / carriers, less than about 150 CpG / carriers, less than about 100 CpG / carriers, less than about 75 CpG / carriers, less than about 50 CpG / carriers, less than about 25 CpG / carriers, less than about 20 CpG / carriers, less than about 15 CpG / carriers, less than about 10 CpG / carriers etc.

[0132] In other embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion has the formula XYX', wherein X and X' are each inverted repeat sequences, and wherein Y is not repeated and comprises nucleotides having at least 3 nucleotides, e.g., at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, etc. In some embodiments, the second portion does not include a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector includes a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or a portion thereof is not located within the second portion.

[0133] In some embodiments, the inverted repeat sequence (X and X') is derived from a nucleic acid sequence present in the AAV genome. In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0134] In yet other embodiments, the non-viral DNA vector comprises the following elements operably linked in a 5' to 3' direction: (i) a first repetitive sequence; (ii) a non-repetitive nucleotide sequence having at least 3 nucleotides; (iii) a second repetitive sequence; and (iv) an expression cassette. In some embodiments, the non-repetitive nucleotide sequence has at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 15 nucleotides.

[0135] In some embodiments, the non-repetitive nucleotide sequence does not include a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector includes a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or a portion thereof is not part of the non-repetitive nucleotide sequence or is not included in the non-repetitive nucleotide sequence. In some embodiments, the first and second repetitive sequences include or are derived from nucleic acid sequences present in the AAV genome (including any of those disclosed herein).

[0136] In some embodiments, the expression cassette includes one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter. In some embodiments, the expression cassette includes one or more of an enhancer and / or promoter, a 3' untranslated region (with or without introns), a translation initiation region, a transgene (protein coding region, which itself can be broken down into several components), a 5' untranslated region, and a polyadenylation addition region.

[0137] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0138] In further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, wherein the at least two inverted repeat sequences are separated by at least a portion of a bacterial origin of replication. In some embodiments, each inverted repeat sequence comprises or is derived from a nucleic acid sequence present within an AAV serotype. In some embodiments, the cruciform structure comprises a Holliday knot.

[0139] In some embodiments, at least a portion of the bacterial origin of replication is single-stranded.

[0140] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0141] In still further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion has the formula XYX′, wherein X and X′ are each an inverted repeat sequence, and wherein Y comprises at least a portion of a bacterial origin of replication. In some embodiments, the inverted repeat sequence comprises or is derived from a nucleic acid sequence present in the AAV genome. In some embodiments, when the repeat sequence forms a cruciform structure, at least a portion of the bacterial origin of replication is single-stranded. In some embodiments, the cruciform structure comprises a Holliday knot.

[0142] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0143] In even further embodiments, the non-viral DNA vector comprises the following elements operably linked in a 5' to 3' direction: (i) a first repeat sequence; (ii) a minimal bacterial origin of replication; (iii) a second repeat sequence; and (iv) an expression cassette. In some embodiments, the first and second repeat sequences comprise or are derived from nucleic acid sequences present within the AAV genome. In some embodiments, when the repeat sequences form a cruciform structure, at least a portion of the minimal bacterial origin of replication is single-stranded. In some embodiments, the cruciform structure comprises a Holliday knot.

[0144] In some embodiments, the expression cassette includes one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter. In some embodiments, the expression cassette includes one or more of an enhancer and / or promoter, a 3' untranslated region (with or without introns), a translation initiation region, a transgene (protein coding region, which itself can be broken down into several components), a 5' untranslated region, and a polyadenylation addition region.

[0145] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0146] In yet even further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences separated by a non-repetitive nucleotide sequence comprising a heterologous gene or a portion of a heterologous gene. In some embodiments, at least a portion of a bacterial origin of replication is included in the circular non-viral DNA vector, but not in the second portion. In some embodiments, at least a portion of a bacterial origin of replication is included in the first portion or in a third portion adjacent to the first or second portion, but not in the second portion. In some embodiments, the cruciform structure comprises a Holliday knot. In some embodiments, the inverted repeat sequence comprises or is derived from a nucleic acid sequence present in an AAV serotype. In some embodiments, the non-repetitive nucleotide sequence comprising a heterologous gene or a portion thereof is single-stranded, while the remainder of the second portion is double-stranded.

[0147] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpG / vector, less than about 450 CpG / vector, less than about 400 CpG / vector, less than about 350 CpG / vector, less than about 300 CpG / vector, less than about 250 CpG / vector, less than about 200 CpG / vector, less than about 150 CpG / vector, less than about 100 CpG / vector, less than about 75 CpG / vector, less than about 50 CpG / vector, less than about 25 CpG / vector, less than about 20 CpG / vector, less than about 15 CpG / vector, less than about 10 CpG / vector, etc.

[0148] In some embodiments, each inverted repeat sequence is a nucleic acid sequence comprising about 20 to about 500 bp, about 20 bp to about 450 bp, about 20 bp to about 400 bp, about 20 bp to about 300 bp, about 20 bp to about 250 bp, about 20 bp to about 200 bp, about 20 bp to about 160 bp, about 60 bp to about 160 bp, about 70 bp to about 150 bp, about 80 bp to about 140 bp, about 90 bp to about 130 bp, etc. In some embodiments, each inverted repeat sequence has about 115 bp, 116 bp, 117 bp, 118 bp, 119 bp, 120 bp, 121 bp, 122 bp, 123 bp, 124 bp, 125 bp, 126 bp, 127 bp, 128 bp, 129 bp, 130 bp, 131 bp, 132 bp, 133 bp, 134 bp, 135 bp, 136 bp, 137 bp, 138 bp, 139 bp, 140 bp, 141 bp, 142 bp, etc.

[0149] In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 85% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 1-18.

[0150] In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 91% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 92% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 93% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each inverted repeat sequence has a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 1-18. In some embodiments, the nucleic acid sequence of each inverted repeat sequence has any one of SEQ ID Nos: 1-18.

[0151] In some embodiments, each inverted repeat sequence comprises or is derived from an AAV inverted terminal repeat sequence element (e.g., an element derived from any of an AAV serotype such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, and / or AAV7). For example, each inverted repeat sequence group can include one or more of the A, A', B, B', C, C', D, and / or D' elements of an inverted terminal repeat sequence element from one or more AAV serotypes.

[0152] In some embodiments, the 5'A element comprises at least 90% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5'A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3'A element comprises at least 90% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3'A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5'B element comprises at least 90% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5'B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3'B element comprises at least 90% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 5'C element comprises at least 90% identity to CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 3'C element comprises at least 90% identity to GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 3'C element comprises GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 5'D element comprises at least 90% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 3'D element comprises at least 90% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81). In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0153] In some embodiments, the 5'A element comprises at least 95% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5'A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3'A element comprises at least 95% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3'A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5'B element comprises at least 95% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5'B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3'B element comprises at least 95% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 5'C element comprises at least 95% identity to CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 3'C element comprises at least 95% identity to GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 3'C element comprises GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 5'D element comprises at least 95% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 3'D element comprises at least 95% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0154] In some embodiments, the 5'A element comprises at least 97% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5'A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3'A element comprises at least 97% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3'A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5'B element comprises at least 97% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5'B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3'B element comprises at least 97% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 5'C element comprises at least 97% identity to CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 3'C element comprises at least 97% identity to GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 3'C element comprises GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 5'D element comprises at least 97% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 3'D element comprises at least 97% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0155] In some embodiments, the 5'A element comprises at least 99% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5'A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3'A element comprises at least 99% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3'A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5'B element comprises at least 99% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5'B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3'B element comprises at least 99% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 5'C element comprises at least 99% identity to CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO: 78). In some embodiments, the 3'C element comprises at least 99% identity to GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 3'C element comprises GCCCGGGCG (SEQ ID NO: 79). In some embodiments, the 5'D element comprises at least 99% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO: 80). In some embodiments, the 3'D element comprises at least 99% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0156] In some embodiments, the first inverted repeat sequence may have the formula DACC'-BB'-A', and the second inverted repeat sequence may have the formula -ABB'-CC'-A'-D'. In some embodiments, the first inverted repeat sequence may have the formula DACC'-BB'-A', and the second inverted repeat sequence may have the formula -ABB'-CC'-A'-D', but does not include a DD element as described herein. As described herein, each of these first and second inverted repeat sequences is separated by a non-repetitive nucleotide sequence having at least 3 nucleotides (e.g., at least a portion of a bacterial origin of replication, such as at least a portion of a bacterial origin of replication derived from R6K0).

[0157] In some embodiments, the non-viral DNA vectors of the present disclosure do not include or form DD-ITRs, "double D" ITRs, or "DD elements". In some embodiments, the non-viral DNA vectors do not contain DD elements, but contain at least a portion of a bacterial replication origin. In some embodiments, the circular non-viral DNA vectors lack drug resistance genes and do not include DD elements. In other words, the D and D' elements included in the inverted repeat sequences of the non-viral DNA vectors of the present disclosure are separated by heterologous non-repetitive elements, which may contain at least a portion of a bacterial replication origin. Surprisingly, the applicant has found that the non-viral vectors of the present disclosure without "DD elements" direct higher amounts of linked heterologous gene expression and can last as long or longer in vivo than those vectors that include "DD elements". In addition, the structure of the repeat sequence elements within the non-viral DNA vectors of the present disclosure is not formed by the circularization process of the viral genome (e.g., AAV genome or AAV vector genome) or linear DNA fragments via inverted terminal repeat sequences.

[0158] In some embodiments, the inverted repeat sequence is adjacent to and flanked by a non-repetitive nucleic acid sequence having at least three nucleotides. In some embodiments, the non-repetitive nucleic acid sequence having at least three nucleotides comprises at least a portion of a bacterial origin of replication. In some embodiments, at least a portion of the bacterial origin of replication is derived from plasmid R6K (e.g., its γ origin of replication (oriR6Kγ). In some embodiments, the bacterial origin of replication derived from R6K has been modified to reduce the CpG content, for example, the CpG content is reduced by at least 60%, at least 50%, at least 40%, at least 30%, at least 25%, at least 20%, at least 10%, at least 5%, etc. In some embodiments, at least a portion of the bacterial origin of replication includes one or more internal direct repeat sequences. In some embodiments, at least a portion of the bacterial origin of replication includes one or more regions of internal secondary structure, which are believed to be important for helping to maintain the cruciform structure.

[0159] In some embodiments, at least a portion of the bacterial origin of replication has at least 90% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 91% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 92% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 93% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 94% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 95% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 96% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 97% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 98% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 99% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has any one of SEQ ID NOs: 58-59.

[0160] In some embodiments, the second portion comprises a first nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 91% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 91% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 91% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 93% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 93% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 93% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0161] In some embodiments, the second portion comprises a first nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 97% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 97% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 97% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18. In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, or 17; a second nucleic acid sequence having any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence having any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, or 18.

[0162] In some embodiments, the second portion comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 91% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 92% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 93% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 35 and 60. In some embodiments, the second portion comprises a nucleic acid sequence having SEQ ID NO: 60.

[0163] In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 85% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 91% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 92% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 93% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOs: 28-30, 38, 40-48, and 72-73.

[0164] One or more nucleic acid sequences encoding one or more peptides or polypeptides

[0165] In some embodiments, the circular non-viral DNA vectors of the present disclosure include one or more nucleic acid sequences encoding one or more peptides, polypeptides, etc. In some embodiments, the circular non-viral DNA vectors of the present disclosure include one or more nucleic acid sequences encoding one or more reporter genes. In still other embodiments, the circular non-viral DNA vectors of the present disclosure include one or more heterologous genes encoding one or more therapeutic proteins.

[0166] In some embodiments, the size of the one or more nucleic acid sequences encoding one or more therapeutic proteins ranges from about 1 Kb to about 150 Kb, for example, from about 1 Kb to about 120 Kb, from about 1 Kb to about 100 Kb, from about 1 Kb to about 80 Kb, from about 1 Kb to about 60 Kb, from about 1 Kb to about 40 Kb, from about 1 Kb to about 30 Kb, from about 1 Kb to about 25 Kb, from about 1 Kb to about 20 Kb, from about 1 Kb to about 15 Kb, from about 1 Kb to about 12 Kb, from about 1 Kb to about 11 Kb, from about 1 Kb to about 10 Kb, from about 1 Kb to about 9 Kb, from about 1 Kb to about 8 Kb, from about 1 Kb to about 7 Kb, from about 1 Kb to about 6 Kb, etc. In some embodiments, the size of the one or more nucleic acid sequences encoding one or more therapeutic proteins is about 5 Kb, about 6 Kb, about 7 Kb, about 7.5 Kb, about 8 Kb, about 8.5 Kb, about 9 Kb, about 9.5 Kb, about 10 Kb, about 10.5 Kb, about 11 Kb, about 12 Kb, about 13 Kb, about 14 Kb, about 15 Kb, about 16 Kb, about 17 Kb, about 18 Kb, about 19 Kb, about 20 Kb, about 21 Kb, etc.

[0167] Therapeutic proteins include, but are not limited to, ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 64, 65, 66, or 69), ATP7B (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 69, 70, or 83), AlAT (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 66), ABCB11, anti-CD19-anti-CD3 (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 67), BDFS (at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any one of SEQ ID NOs: 68), NO: 68) and variants thereof. Examples of diseases that can be treated according to the methods of the present invention include, but are not limited to, hypophosphatasia, anti-alpha-1 antitrypsin deficiency (such as with a protein that is at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identical to any of SEQ ID NO: 68), familial hypercholesterolemia, hyperlipidemia, and progressive familial intrahepatic cholestasis types 1, 2, and 3.

[0168] In some embodiments, the non-viral DNA vectors of the present disclosure include one or more nucleic acid sequences encoding alkaline phosphatase or its variants. In other embodiments, the non-viral DNA vectors of the present disclosure include a nucleic acid sequence encoding a polypeptide, the polypeptide including an amino acid sequence encoding alkaline phosphatase.

[0169] For example, in some embodiments, a polypeptide comprising an amino acid sequence encoding alkaline phosphatase has any one of Formulas (IA) to (IE):

[0170] [A] v -[B]-[C] w -[R] q -([D] x -[E] y ) z (IA),

[0171] [A]-[B]-[C]-[R] q -([D] x -[E] y ) (IB),

[0172] ([A]-[B])-([D] x -[E] y ) z (IC),

[0173] ([A]-[B])-([E] y ) (ID), and

[0174] [A]-[B]-[R] q -([E] y ) (IE)

[0175] in

[0176] A comprises an amino acid sequence encoding a secretory signal peptide;

[0177] B contains the amino acids encoding alkaline phosphatase;

[0178] C contains the amino acid sequence encoding the GPI anchor;

[0179] R is -(M o (Fc)N p )-, wherein M and N each independently comprise 1 to 6 amino acids, wherein Fc is an Fc domain, and o and p each independently are 0, 1 or 2;

[0180] D comprises an amino acid sequence of 4 to 6 amino acids, or is F(G) t F, wherein each F is the same amino acid, G is an amino acid sequence of 3, 4 or 5 amino acids, and t is an integer in the range of 2-5;

[0181] E comprises an amino acid sequence having 1 to 8 amino acids;

[0182] q is 0 or 1;

[0183] v is 0 or 1;

[0184] w is 0 or 1;

[0185] x is 0 or an integer in the range of 1 to 6;

[0186] y is 0 or an integer in the range of 1 to 16; and

[0187] z is 0 or an integer in the range of 1 to 6. ;

[0189] Provided that, when v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid -DI-, M is diamino acid -LK-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130, and x is 0, then [E] yDoes not contain ten to sixteen consecutive aspartic acid residues.

[0190] In some embodiments, the polypeptide of any one of Formulae (IA) to (IE) is not conjugated to dextran. In other embodiments, the polypeptide of any one of Formulae (IA) to (IE) has catalytic ability to allow the formation of hydroxyapatite crystals in bone.

[0191] In some embodiments, E comprises 3 amino acids. In some embodiments, the 3 amino acids are selected from aspartic acid, serine, lysine, threonine, tyrosine, alanine, methionine, valine, tryptophan, proline, arginine, glutamine. In other embodiments, the 3 amino acids are selected from aspartic acid and serine. In some embodiments, E is -DSS-. In other embodiments, E is -DDS-. In other embodiments, E is -DDD. In other embodiments, E is -DSS-.

[0192] In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 16. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 12. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 12. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 10. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 10. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 8. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 8. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 6. In some embodiments, E comprises 3 amino acids, and y is in the range of 3 to 6. In some embodiments, E comprises 3 amino acids, and y is in the range of 3 to 6, and q is 0.

[0193] In some embodiments, E is -DSS-, and y is in the range of 1 to 16. In some embodiments, E is -DSS-, and y is in the range of 1 to 12. In some embodiments, E is -DSS-, and y is in the range of 1 to 10. In some embodiments, E is aspartic acid, and y is in the range of 1 to 8. In some embodiments, E is -DSS-, and y is 6, i.e., [E]y is [-DSS-]6. In other embodiments, E is -DSS-, y is 6 and z is 1. In some embodiments, E is -DSS-, y is 6 and q is 0. In other embodiments, E is -DSS-, y is 6, z is 1, and q is 0. In other embodiments, E is -DSS-, y is 6, z is 1, and q is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 2.

[0194] In some embodiments, E is -DSS-, y is 6 and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, x is 0, and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, x is 2, and q is 1.

[0195] Other examples of polypeptides encoding soluble alkaline phosphatases are described in PCT Publication No. WO / 2022 / 051555, the disclosure of which is hereby incorporated by reference in its entirety.

[0196] In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 96% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 97% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 98% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 99% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having SEQ ID NOs: 20-21 and 23-24.

[0197] In some embodiments, the one or more heterologous genes are reporter genes. As used herein, a "reporter gene" is any gene whose expression can be measured. In some embodiments, the reporter gene can have a previously determined reference range for detectable expression. In some embodiments, the reporter gene can express a selectable or screenable marker. In some embodiments, selectable markers can also be used to select organisms or cells containing exogenous genetic material.

[0198] The reporter gene can encode enzymes such as β-lactamase, β-galactosidase, murine secreted embryonic alkaline phosphatase (MUSEAP), and luciferase (for β-lactamase, see WO 96 / 30540 to Tsien, published on October 3, 1996). The reporter gene can also encode a fluorescent protein, such as green fluorescent protein (GFP) or a mutant thereof, as known in the art or later developed (see U.S. Pat. No. 5,625,048, issued to Tsien on April 29, 1997; WO 96 / 23810, issued to Tsien on August 8, 1996; WO 97 / 28261, issued to Tsien on August 7, 1997; and PCT / TSJ97 / 12410, issued to Tsien on July 16, 1996). The product of the reporter gene can be detected using methods known in the art, such as using a chromogenic or fluorogenic substrate for the enzyme. Chromogenic or fluorescent readouts can be detected using, for example, optical methods such as absorbance or fluorescence.

[0199] Examples of selectable markers include, but are not limited to, the neo gene, which encodes kanamycin resistance, and can be selected using kanamycin, GUS, green fluorescent protein (GFP), neomycin phosphotransferase II (nptII), luciferase (LUX), or antibiotic resistance coding sequences. In some embodiments, screenable markers can be used to monitor expression. In some embodiments, exemplary screenable markers include, for example, β-glucuronidase or uidA genes (GUS), which encode enzymes of various known chromogenic substrates; β-lactamase genes, genes encoding enzymes of various known chromogenic substrates (e.g., PADAC, chromogenic cephalosporins); luciferase genes; tyrosinase genes, which encode enzymes capable of oxidizing tyrosine to dopa and dopaquinone (which in turn condenses into melanin); and α-galactosidase, which can convert chromogenic α-galactose substrates.

[0200] Promoter

[0201] Any promoter used in the art can be used to drive the expression of one or more nucleic acid sequences in the expression vector described herein, for example, to drive the expression of the nucleic acid sequence encoding the polypeptide. In some embodiments, the promoter is a promoter that is functional in mammalian cells. High-level constitutive promoters are preferably used in vectors according to the present disclosure. Examples of such promoters include, but are not limited to, retroviral Rous sarcoma virus (RSN) LTR promoter (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally with CMV enhancer) [see, for example, Boshart et al., Cell, 41: 521-530 (1985)], SN40 promoter, dihydrofolate reductase promoter, β-actin promoter, β-active promoter connected to enhancer derived from cytomegalovirus (CMN) immediate early (IE) promoter, phosphoglycerol kinase (PGK) promoter, and EF1α promoter [Invitrogen]. Inducible promoters are regulated by exogenous compounds and include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, and the T7 polymerase promoter system [WO 98 / 10088]; ecdysone insect promoter [No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], tetracycline repressible system [Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], tetracycline inducible system [Gossen et al., Science, 268:1766-1769 (1995); see also Harvey et al., Curr. Opin. Chem. Biol, 2:512-518 (1998)], RU486-inducible system [Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther., 4: 432-441 (1997)] and the rapamycin inducible system [Magari et al., J Clin. Invest., 100: 2865-2872 (1997)]. Other types of inducible promoters useful in the present disclosure are those that are regulated by specific physiological states (e.g., temperature, acute phase, a specific differentiation state of the cell, or only in replicating cells).

[0202] Illustrative ubiquitous expression control sequences suitable for use in particular embodiments include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the simian virus 40 (SV40) (e.g., early or late), the Moloney murine leukemia virus (MoMLV) LTR promoter, the Rous sarcoma virus (RSV) LTR, the herpes simplex virus (HSV) (thymidine kinase) promoter, the H5, P7.5 and P11 promoters from vaccinia virus, the short elongation factor 1-alpha (EF1α-short) promoter, the long elongation factor I-alpha (EF1α-long) promoter, the early growth response 1 (EGR1), ferritin H (FerH), ferritin L (FerL), 3-phosphoglyceraldehyde dehydrogenase (GAPDH), the eukaryotic translation initiation factor 4A1 (EIF4A1), the heat shock 70 kDa protein 5 (HSPA5), the heat shock protein 90 kDa beta member 1 (HSP90B1), heat shock protein 70 kDa (HSP70), beta-kinesin ((3-KIN), human ROSA 26 locus (Orions et al., Nature Biotechnology 25, 1477-1482 (2007)), ubiquitin C promoter (UBC), phosphoglycerate kinase-1 (PGK) promoter, cytomegalovirus enhancer / chicken beta-actin (CAG) promoter, beta-actin promoter and myeloproliferative sarcoma virus enhancer, negative regulatory region deleted d1 587rev primer binding site displacement (MND) promoter (Challita et al., J Viral. 69 (2): 748-55 (1995)).

[0203] In some embodiments, the promoter can be selected from the cytomegalovirus (CMV) minimal promoter, more preferably, selected from human CMV (hCMV), such as the minimal promoter derived from the hCMV immediate early promoter, as described in, for example, Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). Modified promoters can also be used, including insertion and deletion mutations of natural promoters and combinations or arrangements thereof. An example of a modified promoter is the "minimal CMV promoter" as described by Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). In any case, the effectiveness of any promoter in the tetracycline responsive expression system described herein can be easily tested by replacing the minimal CMV promoter described herein.

[0204] In some embodiments, the promoter is the MND promoter. In some embodiments, the promoter is the EF1α promoter. In some embodiments, the promoter is the CD11b promoter. In some embodiments, the promoter is the EFS promoter. In some embodiments, the promoter is the Ube promoter. In some embodiments, the promoter is the CD68LPp promoter.

[0205] In some embodiments, the promoter is a tissue-specific promoter, wherein the tissue-specific promoter is used to achieve cell type-specific, lineage-specific or tissue-specific expression of the desired polynucleotide sequence (e.g., expressing a specific nucleic acid encoding a polypeptide only in a portion of cell types or tissues or during a specific developmental stage). Illustrative examples of tissue-specific promoters include, but are not limited to: B29 promoter (B cell expression), runt transcription factor (CBFa2) promoter (stem cell-specific expression), CD14 promoter (monocyte expression), CD43 promoter (leukocyte and platelet expression), CD45 promoter (hematopoietic cell expression), CD68 promoter (macrophage expression), CYP450 3A4 promoter (hepatocyte expression), desmin promoter (muscle expression), elastase 1 promoter (pancreatic acinar cell expression), endoglin promoter (endothelial cell expression), fibroblast-specific protein 1 promoter (FSP1) promoter (fibroblast expression), fibronectin promoter (fibroblast expression), fms-related tyrosine kinase 1 (FLT1) promoter (endothelial cell expression), glial fibrillary acidic protein (GFAP) promoter (astrocyte expression), insulin promoter (pancreatic β cell expression), integrin α2b (ITGA2B) promoter (megakaryocyte expression), intracellular adhesion molecule 2 (ICAM-2) promoter (endothelial expression) cells), interferon β (IFN-β) promoter (hematopoietic cells), keratin 5 promoter (keratinocyte expression), myoglobin (MB) promoter (muscle expression), myogenic differentiation 1 (MYOD1) promoter (muscle expression), renin promoter (podocyte expression), bone γ-carboxyglutamate protein 2 (OG-2) promoter (osteoblast expression), 3-oxoacid coenzyme A transferase 2B (Oxct2B) promoter (haploid spermatid expression), surfactant protein B (SP-B) promoter (lung expression), synapsin promoter (neuronal expression), Wiskott-Aldrich syndrome protein (WASP) promoter (hematopoietic cell expression).

[0206] In some embodiments, the natural promoter of the transgene is used. In some embodiments, when it is desired that the expression of the gene should mimic natural expression, a natural promoter may be preferred. In some embodiments, when the expression of the gene must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimulus, a natural promoter can be used. In some embodiments, other natural expression control elements such as enhancer elements, polyadenylation sites or Kozak consensus sequences can also be used to mimic natural expression. In some embodiments, the transgenic product or other desired product to be expressed can be operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is required, a promoter active in muscle should be used. These include promoters of genes encoding skeletal α-actin, myosin light chain 2A, dystrophin, muscle creatine kinase, and synthetic muscle promoters with activity higher than naturally occurring promoters [see Li et al., Nat. Biotech, 17: 241-245 (1999)]. Examples of tissue-specific promoters are known for liver [albumin, Miyatake et al., J Viral, 71:5124-32 (1997); human thyroid binding globulin (TBG) promoter (see Yan et al., Gene. 201215;506(2):289-94 (2012), the disclosure of which is hereby incorporated by reference in its entirety; hepatitis B virus core promoter, Sandig et al., Gene Ther., 3:1002-9 (1996); and alpha-fetoprotein (AFP), Arbuthnot et al., Hum. Gene Ther, 7:1503-14 (1996)], for bone [osteocalcin, Stein et al., Mol. Biol. Rep., 24:185-96 (1997); and bone sialoprotein, Chen et al., J Bone Miner. Res., 11: 654-64 (1996)], for lymphocytes [CD2, Hansal et al., J Immunol, 161: 1063-8 (1998); immunoglobulin heavy chain; T cell receptor α chain], for neurons [neuron-specific enolase (NSE) promoter, Andersen et al., Cell. Mol. Neurobiol, 13: 503-15 (1993); neurofilament light chain gene, Piccioli et al., 1991, Proc. Natl. Acad. Sci. USA, 88: 5611-5 (1991); and neuron-specific vgf gene, Piccioli et al., Neuron 15: 373-84 (1995)]; etc.

[0207] Transcription can be increased by inserting an enhancer sequence into the non-viral DNA vector of the present disclosure. An enhancer is typically a cis-acting element of DNA, often about 10 to 300 bp in length, that acts on a promoter to increase its transcription. Many enhancer sequences are currently known to come from mammalian genes (globin, elastase, albumin, alpha-fetoprotein, and insulin) and eukaryotic cell viruses. Examples include the SV40 enhancer (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer can be spliced ​​into the 5′ or 3′ position of the antigen-specific polynucleotide sequence in the vector, but is preferably located at the 5′ site of the promoter.

[0208] In some embodiments, the carrier of the present disclosure includes an insulator element, for example, a cHS insulator.

[0209] Inhibitory sequence of Toll-like receptor 9

[0210] It has been well documented that Toll-like receptor 9 (TLR9), a DNA immune sensor, plays a central role in the detection of non-viral DNA vectors and in the activation of innate immune and CD8+ T cell responses. TLRs are a class of innate immune sensors conserved across mammalian species and are found on endosomes or plasma membranes of immune or other cells. TLR9 typically senses DNA invasion by pathogenic DNA viruses and bacteria containing unmethylated cytosine-phosphate-guanine (CpG) motifs. Upon binding to TLR9, CpG-rich motifs of DNA lead to its dimerization and activation of TLR9 signaling through MyD88, promoting the induction of type I interferons and pro-inflammatory cytokines. Innate immune responses, such as interferon induction, trigger an antiviral state in cells, while inflammation recruits other immune cells to the site of infection and triggers an acquired immune response.

[0211] One solution to block TLR9 activation is to include specific short DNA oligonucleotides that will antagonize TLR9 activation into the non-viral DNA vector of the present disclosure. In some embodiments, the vector of the present disclosure comprises one copy of such a sequence (SEQ ID NO: 39). In some embodiments, the vector of the present disclosure comprises two or more copies of such a sequence (SEQ ID NO: 39).

[0212] In vivo dissociation

[0213] The non-viral DNA vector of the present disclosure dissociates in vivo. In some embodiments, the non-viral DNA vector enters the cell through an endosomal mechanism (receptor-mediated endocytosis, pinocytosis, phagocytosis, etc.) or a non-endosomal mechanism (electroporation, ultrasound-induced microbubbles, membrane fusion by fusion-promoting complexes, etc.). Once in the endosome, the non-viral DNA vector will "escape" the endosome and enter the cytosol, and then the endosome fuses with the lysosome and the DNA is degraded. It is believed that the formulation of the non-viral DNA vector determines how the DNA escapes from the endosome.

[0214] Once in the cytosol, the DNA needs to enter the nucleus in order to be expressed. This process is believed to be aided by the cruciform structure (repeat sequence element) of the circular non-viral DNA vectors disclosed herein. Cellular proteins or protein complexes known to bind to the cruciform structure or known to be involved in the dissociation of the Holliday junction are believed to have a nuclear localization motif. In other words, the structure is believed to bind to proteins that direct its transport into the nucleus. Since the protein that helps mediate nuclear translocation is the same as (or is part of) the protein that mediates dissociation, it is not clear whether the dissociation occurs in the cytoplasm or the nucleus, but it is expected that the dissociation occurs in the nucleus. For example, PARP1 was identified as co-localized with the constructs according to the present disclosure in the cytoplasm of 293 cells after transfection (see, e.g. Fig.18 ). Generally speaking, PARP1 is a nuclear protein that shuttles into the cytoplasm to help transport DNA into the nucleus.

[0215] Although the "dissociation" process is largely unknown, we can talk about the events that appear to occur. It should be noted that the process of normal endogenous Holliday junction dissociation is also largely unknown, and may occur through a variety of pathways involving a variety of different proteins / enzymes in different cell types or at different stages of the cell cycle. For example, the first step is recognition of the cruciform structure by a protein or protein complex. This binding may be related to nuclear localization as described above, but it is believed that a slight unwinding of the DNA is required to allow the next enzymatic step. In some embodiments, the first enzymatic activity will cleave the structure (see, e.g., Figure 10-11 ). After cleavage, it is believed that a linear molecule is formed by a ligation process. It is believed that several DNA topoisomerases and / or DNA ligases may be involved in this process. It is also believed that there are several potential processes / pathways through which this can occur. It is believed that DNA protein kinase (DNA-PK) is involved in these pathways to convert the circular non-viral vector of the present disclosure into a linear form. In particular, DNA-PK is believed to be involved in non-homologous end joining (NHEJ) reactions and is believed to be part of a large multi-protein complex.

[0216] In some embodiments, other homology-mediated pathways may be involved in concatemer formation (see, e.g. Fig.11 ).

[0217] Pharmaceutical composition comprising a circular non-viral DNA vector

[0218] Another aspect of the disclosure relates to compositions comprising one or more circular non-viral DNA vectors, such as circular non-viral DNA vectors having at least 95%, 96%, 97%, 98% or 99% identity to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

[0219] In some embodiments, the present disclosure provides a composition comprising one or more of the circular non-viral DNA vectors described herein and a carrier (e.g., a pharmaceutically acceptable carrier). The composition is preferably a physiologically acceptable (e.g., pharmaceutically acceptable) composition comprising a carrier (e.g., a physiologically (e.g., pharmaceutically) acceptable carrier) and a non-viral DNA vector. Any suitable carrier can be used in the context of the present disclosure, and such carriers are well known in the art, including any of those described above.

[0220] In some embodiments, non-viral DNA vectors can be formulated with a delivery vehicle. In some embodiments, the delivery vehicle is a lipid-based delivery vehicle. In some embodiments, the delivery vehicle is a lipid nanoparticle. As used herein, the term "lipid nanoparticle" or "LNP" refers to any lipid composition that can be used to deliver a therapeutic product, including but not limited to liposomes or vesicles, wherein the aqueous volume is encapsulated by an amphipathic lipid bilayer, or wherein the lipid-coated inside comprises the therapeutic product, or lipid aggregates or micelles, wherein the lipid-encapsulated therapeutic product is contained in a relatively disordered lipid mixture.

[0221] In some embodiments, lipid nanoparticles include compositions based on lipids, which have a solid lipid core stabilized by a surfactant. In some embodiments, the core lipid can be a mixture of fatty acids, acylglycerols, waxes and these surfactants. In some embodiments, biomembrane lipids such as phospholipids, sphingomyelin, bile salts (sodium taurocholate) and sterols (cholesterol) can be used as stabilizers.

[0222] In some embodiments, lipid nanoparticles can be formed using different lipid molecules of a defined ratio, including but not limited to one or more cations, anions or neutral lipids of a defined ratio. In some embodiments, lipid nanoparticles can be encapsulated in an outer membrane shell by molecules (such as disclosed non-viral DNA vectors), and can subsequently contact with target cells to deliver encapsulated molecules (such as disclosed non-viral DNA vectors) to host cell cytosol. In some embodiments, lipid nanoparticles can be modified or functionalized with non-lipid molecules (including non-lipid molecules on its surface) (for example, CD3, CD4, CD8, CD19, CD20, CD22, CD38, CD47, CD117, transferrin, ApoE, folic acid, etc.). In some embodiments, lipid nanoparticles can be modified to specifically bind to one or more receptors (for example, 1 or more receptors, 2 or more receptors, 3 or more receptors, 4 or more receptors, etc.) on the surface of target cells. "Specific binding" refers to a binding affinity of the lipid nanoparticle to a receptor on the surface of a target cell that is at least 2 times higher than the binding affinity to a receptor on the surface of a non-target cell, for example, at least 3 times, 4 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 25 times, 50 times, or 100 times higher. The cell surface receptors to which the modified lipid nanoparticles can bind include, but are not limited to, integrins, transferrin receptor types 1 and 2, EGF receptors, VEGF receptors, NGF receptors, CD3, CD4, CD7, CD8, CD19, CD20, CD22, CD33, CD43, CD38, CD56, CD69, asialoglycoprotein receptor (ASGPR), N-acetyl-D galactose (GalNAc) receptor, folate receptor, and sigma receptor. In some embodiments, the first and / or second targeting ligand binds to an asialoglycoprotein receptor (ASGPR) or a GalNAc receptor. Therefore, in some embodiments, the modified lipid nanoparticles specifically bind to ASGPR or GalNAc receptors on the surface of hepatocytes. In some embodiments, the targeting ligand for modifying lipid nanoparticles is a carbohydrate or a carbohydrate conjugate. Carbohydrate-based targeting ligands include but are not limited to glucose, multivalent glucose, fucose, D-mannose, multivalent mannose, lactose, multivalent lactose, D galactose, multivalent galactose, GalNAc, multivalent GalNAc (e.g., GalNAc2 and GalNAc3), acetyl-galactosamine, N-acetyl-glucosamine, glycosylated polyamino acids and lectins. The term "multivalent" means that there are one, two, three or four monosaccharide units. Such monosaccharide subunits can be interconnected or connected to a scaffold molecule by a glycosidic bond. In some embodiments, lipid nanoparticles can be single layer (monolayer) or multiple layers (multilayer). In some embodiments, lipid nanoparticles can be compounded with nucleic acids.Unilamellar lipid nanoparticles can be complexed with nucleic acids, wherein the nucleic acids are in the aqueous interior. In some embodiments, multilamellar lipid nanoparticles can be complexed with nucleic acids, wherein the nucleic acids are in the aqueous interior, or formed or sandwiched.

[0223] In some embodiments, liposome particles can be formed, for example, from a mixture of zwitterionic, cationic, and anionic lipids, which can be saturated or unsaturated, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) (zwitterionic, saturated), 1,2-dilinoleoyloxy-3-dimethylaminopropane (DlinDMA) (cationic, unsaturated) and / or 1,2-dimyristoyl-rac-glycerol (DMG) (anionic, saturated). In some embodiments, liposomes will typically include a helper lipid. Useful helper lipids include zwitterionic lipids such as DPPC, DOPC, DSPC, dodecylphosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE) and 1,2-diphytoyl-sn-glycero-3-phosphoethanolamine (DPyPE); sterols such as cholesterol; and PEGylated lipids such as PEG-DMPE (PEG conjugated to 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)]) or PEG-DMG (PEG conjugated to 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol). In some embodiments, suitable PEGylated lipids include PEG2K-DMPE (PEG-conjugated 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]) or PEG2K-DMG (PEG-conjugated 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol-2000). In some embodiments, LNPs used with the non-viral DNA vectors of the present disclosure include zwitterionic lipids that can form liposomes, optionally in combination with at least one cationic lipid such as N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAPB, (2-methacryloyl)oxyethyl disulfide (DSDMA), 2,3-dioleoyloxy-1-(dimethylamino)propane (DODMA), 1,2-dilinoleoyloxy-3-dimethylaminopropane (DLinDMA), N,N-dimethyl-3-aminopropane (DLenDMA), etc.

[0224] In some embodiments, the lipid nanoparticles have an average diameter in the range of about 20 nm to about 300 nm, for example, about 20 nm to about 250 nm, about 30 nm to about 200 nm, about 40 nm to about 180 nm, about 50 nm to about 150 nm, about 60 nm to about 140 nm, etc. The lipid nanoparticle size can be determined by quasi-elastic light scattering using, for example, a Malvern Zetasizer Nano ZS (Malvern, UK) system or electron microscopy, for example, using a FEI Quanta200 scanning electron microscope or a FEI Tecnai Twin 120 kV transmission electron microscope.

[0225] Examples of LNPs are described in Schoeenmaker et al., “mRNA-lipid nanoparticle COVID-19 vaccines: Structure and stability,” Int J Pharm. 2021 May 15;601:120586, the disclosure of which is hereby incorporated by reference in its entirety. Other exemplary LNPs are described by Eygeris et al., “Chemistry of Lipid Nanoparticles for RNA Delivery,” Ace Chem Res. 2022 Jan 4;55(1):2-12. doi: 10.1021 / acs.accounts.1c00544. Epub 2021 Dec 1. PMID: 34850635, the disclosure of which is hereby incorporated by reference in its entirety. Other suitable LNPs for use with the non-viral DNA vectors of the present disclosure are described in U.S. Patent Publication Nos. 2021 / 0371877, 2022 / 0175968, 2022 / 0042035, and 2022 / 0062409, the disclosures of which are hereby incorporated by reference in their entirety.

[0226] The non-viral DNA vectors of the present disclosure can also be formulated with one or more polymers. Various polymers or copolymers can be used as vehicles for the non-viral DNA vectors of the present disclosure. Exemplary polymer materials include poly (D, L-lactic acid-co-glycolic acid) (PLGA), poly (caprolactone) (PCL), ethylene-vinyl acetate polymer (EVA), poly (lactic acid) (PLA), poly (L-lactic acid) (PLLA), poly (glycolic acid) (PGA), poly (L-lactic acid-co-glycolic acid) (PLLGA), poly (D, L-lactide) (PDLA), poly (L-lactide) (PLLA), PLGA-b-poly (ethylene glycol)-PLGA (PLGA-bPEG-PLGA), PLLA-bPEG-PLLA, PLGA-PEG-maleimide (PLGA-PEG-mal), poly (D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyolefins such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), poly(terephthalate), alkylene esters such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinyl pyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl cellulose, polymers of acrylic acid such as poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate), poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly((meth)acrylate) acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate), (polyacrylic acid) and copolymers and mixtures thereof, polydioxanones and copolymers thereof, polyhydroxyalkanoates, polypropylene fumarate), polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, polyvinyl pyrrolidone, polyorthoesters, polyphosphazenes, poly([β]-amino esters (PBAE) and polyphosphates, and blends and / or block copolymers of two or more of such polymers.Polymer-based systems may also include cyclodextrin polymer (CDP)-based nanoparticles, such as, for example, CDP-adamantane (AD)-PEG conjugates and CDP-AD-PEG-transferrin conjugates.

[0227] Non-limiting examples of polymer particle systems for delivering the disclosed non-viral DNA vectors include U.S. Pat. No. 5,543,158, U.S. Pat. No. 6,007,845, U.S. Pat. No. 6,254,890, U.S. Pat. No. 6,998,115, U.S. Pat. No. 7,727,969, U.S. Pat. No. 7,427,394, U.S. Pat. No. 8,323,698, U.S. Pat. No. 8,071,082, U.S. Pat. No. 8,105,652, US 2008 / 0268063, US 2009 / 0298710, US 2010 / 0303723, US 2011 / 0027172, US 2011 / 0065807, US 2012 / 0156135, US 2014 / 0093575, WO The system described in 2013 / 090861, the disclosure of which is hereby incorporated by reference in its entirety.

[0228] In some embodiments, the non-viral DNA vector can be formulated into a pharmaceutically acceptable nanocapsule formulation. Nanocapsules can generally entrain compounds in a stable and reproducible manner (Henry-Michelland et al., 1987; Quintanar-Guerrero et al., 1998; Douglas et al., 1987). In order to avoid side effects caused by intracellular polymer overload, such ultrafine particles (about 0.1 μm in size) should be designed using polymers that can be degraded in vivo. The present invention contemplates the use of biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements. Such particles can be easily prepared, such as Couvreur et al., 1980; Couvreur, 1988; zur Muhlen et al., 1998; Zambaux et al., 1998; Pinto-Alphandry et al., 1995 and U.S. Pat. No. 5,145,684, which are expressly incorporated herein by reference in their entirety.

[0229] In some embodiments, pharmaceutical compositions including non-viral DNA vectors of the present disclosure and suitable for injection include sterile aqueous solutions or dispersions and sterile powders for immediate preparation of sterile injection solutions or dispersions (see U.S. Patent No. 5,466,468, the disclosure of which is hereby incorporated by reference in its entirety). In all cases, the form must be sterile and must be fluid to the extent that there is easy injectability. It must be stable under manufacturing and storage conditions and must prevent contamination by microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), a suitable mixture thereof, and / or a vegetable oil.

[0230] In some embodiments, non-viral DNA vectors can be administered to a patient by physical methods such as electroporation, sonoporation with microbubbles, sonoporation without microbubbles, magnetofection, hydroporation, photoporation, mechanical massage, jet injection, biolistics (gene gun), hydrodynamic injection, needle injection, or microinjection.

[0231] Treatment

[0232] The present disclosure also relates to administering a therapeutically effective amount of a circular non-viral DNA vector capable of expressing one or more transgenes or a pharmaceutical composition comprising a circular non-viral DNA vector capable of expressing one or more transgenes to a patient in need thereof.

[0233] In some embodiments, the present disclosure relates to treating a condition or disease associated with a bone defect characterized by a lack of functional alkaline phosphatase or an insufficient amount of functional alkaline phosphatase. Another aspect of the present disclosure relates to a method of treating hypophosphatasia in a mammal (e.g., a human) in need thereof. Another aspect of the present disclosure relates to a method of treating, alleviating or preventing the symptoms of hypophosphatasia in a mammal (e.g., a human).

[0234] Hypophosphatasia (HPP) is a rare, inherited bone disorder with an incidence of 1 in 100,000 births in the most severe form of the disease. The condition is caused by loss-of-function mutations in the gene encoding tissue nonspecific alkaline phosphatase (TNALP). HPP patients display a range of significant symptoms, ranging from tooth loss or osteomalacia (rickets) to an almost complete absence of bone mineralization in utero. Many patients with HPP display features of skeletal deformities, short stature, muscle and bone pain, impaired mobility, and premature tooth loss. HPP of perinatal onset or infantile onset is also characterized by the presence of rickety chest deformities, vitamin B6-dependent seizures, and failure to thrive. In particular, HPP that presents at less than six months of age is often fatal due to respiratory insufficiency, with low survival rates at one year of age.

[0235] In some embodiments, the methods of the present disclosure provide treatment for hypophosphatasia in mammals. As used herein, the terms "treatment", "treating", etc. refer to obtaining a desired pharmacological and / or physiological effect. In some embodiments, the effect is therapeutic, i.e., the effect partially or completely cures the disease and / or is attributed to adverse symptoms of the disease. In some embodiments, a "therapeutically effective amount" of a composition comprising a non-viral DNA vector is administered to a subject in need of its treatment. "Therapeutically effective amount" refers to an amount effective in achieving the desired therapeutic outcome within the necessary dosage and time period.

[0236] In some embodiments, hypophosphatasia can be treated by administering a therapeutically effective amount of a pharmaceutical composition comprising a circular non-viral DNA vector comprising one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 28-30, 38, 40-48, and 72-73). In other embodiments, treating, alleviating, or preventing symptoms of hypophosphatasia in a mammal comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a circular non-viral DNA vector comprising one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 28-30, 38, 40-48, and 72-73).

[0237] In some embodiments, the therapeutically effective amount may vary depending on factors such as the disease state, age, sex, and weight of the individual.

[0238] The pharmaceutical composition can be administered by any suitable route of administration to carry out the method provided herein. The route of administration can be local or systemic. Exemplary routes of administration include, for example, nose, lung, inhalation, intraarterial, intradermal, intralesional, intramuscular, intraperitoneal, intravenous, intrathecal, intravesical, parenteral, rectal, subcutaneous and transmucosal. In some embodiments, non-viral DNA vectors are administered by subcutaneous, intraocular, intravitreal, parenteral, subcutaneous, intravenous, intracerebroventricular, intramuscular, intrathecal, oral, intraperitoneal, by oral or nasal inhalation or by direct injection into one or more cells, tissues or organs with the appropriately formulated pharmaceutical composition disclosed herein. The method of administration may also include those described in U.S. Patent No. 5,543,158, U.S. Patent No. 5,641,515 and U.S. Patent No. 5,399,363, each of which is incorporated herein by reference as a whole.

[0239] In some embodiments, the subject in need of treatment is treated for a specific duration. In some embodiments, the duration of treatment is about 1 week to about 10 years. In some embodiments, the duration of treatment is about 1 week to about 5 years. In some embodiments, the duration of treatment is about 1 week to about 1 year. In some embodiments, the duration of treatment is about 1 week to about 6 months. In some embodiments, the duration of treatment is about 1 week to about 3 months. In some embodiments, the duration of treatment is about 1 week to about 1 month. In some embodiments, the duration of treatment is about 3 months to about 5 years. In some embodiments, the duration of treatment is about 6 months to about 5 years. In some embodiments, the duration of treatment is about 1 year to about 5 years.

[0240] Each dose may be administered over any suitable time period. In some embodiments, the dose is administered as a bolus dose. In some embodiments, the dose is administered over a time period of about 1 minute to about 4 hours. In some embodiments, the dose is administered over a time period of about 1 minute to about 2 hours. In some embodiments, the dose is administered over a time period of about 1 minute to about 1 hour. In some embodiments, the dose is administered over a time period of about 1 minute to about 30 minutes. In some embodiments, the dose is administered over a time period of about 1 minute to about 15 minutes.

[0241] As described herein, the circular non-viral DNA vector is suitable for repeated administration. In some embodiments, the circular non-viral DNA vector is repeatedly administered for a period of about two weeks to about five years. In some embodiments, the pharmaceutical composition is administered at a specific frequency. In some embodiments, the frequency is every day, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, every 10 days, every 11 days, every 12 days, every 13 days or every 14 days. In some embodiments, the frequency is every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks or every 12 weeks. In some embodiments, the frequency is every 1 month, every 2 months, every 3 months, every 4 months, every 5 months, every 6 months, every 7 months, every 8 months, every 9 months, every 10 months, every 11 months, every 12 months, every 13 months, every 14 months, every 15 months, every 16 months, every 17 months, or every 18 months. In some embodiments, the frequency is every 2 years, every 3 years, every 4 years, or every 5 years.

[0242] Example

[0243] Example 1 - In vitro dissociation of reporter non-viral DNA constructs in IPSC-derived hepatocytes

[0244] exist Figure 5In the present invention, non-dividing iPSC-derived hepatocytes transfected with the circular non-viral DNA vector (including RFP / GFP reporter) (SEQ ID NO: 32) of the present disclosure showed simultaneous GFP and RFP expression on day 3, and mainly showed RFP expression on day 8. The data showed that the circular non-viral DNA vector containing the cruciform structure can be dissociated into a linear form in non-dividing primary human iPSC-derived hepatocytes.

[0245] A reporter system was developed to evaluate the dissociation of circular non-viral DNA vectors into linear forms once introduced into mammalian cells. The circular molecule will express both red fluorescent protein (RFP) and green fluorescent protein (GFP), while GFP expression in the circular form will be interrupted by splicing of mRNA on the cruciform DNA structure, and the linearized molecule will express only RFP.

[0246] method

[0247] Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm. On day 0, plating medium was prepared by adding 1.5 mL B27 supplement, 0.15 mL 10 μg / mL oncostatin stock solution, 1.5 μL 5 mM dexamethasone stock solution, 37.5 μL 25 μg / mL gentamicin, and 1.5 mL iCell Hepatocyte 2.0 Medium Supplement to 72 mL RPMI medium according to Fujifilm's recommendations.

[0248] Filter the plating medium through a 0.22 μm PES filter unit. On day 1, remove the iCell Hepatocyte 2.0 cryovial from the liquid nitrogen storage tank. Submerge the cryovial in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, gently transfer the contents of the iCell Hepatocyte 2.0 cryovial to a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. Centrifuge the cell suspension at 200 x g for 3 minutes at room temperature. Carefully aspirate the supernatant under vacuum. Slowly add 2 mL of 37°C plating medium with a wide-bore pipette to resuspend the cell pellet. Plate the hepatocytes in pre-warmed collagen-coated 24 / 48-well plates. Refresh the medium daily from day 1 to day 7, and every other day starting from day 8.

[0249] Prepare the TransIT-LT1 reagent and non-viral vector DNA complex as recommended by the Mirus manufacturer. Add the TransIT-LT1 reagent:DNA complex dropwise to different areas of the well. Gently rock the culture vessel back and forth and side to side to evenly distribute the TransIT-LT1 reagent:DNA complex.

[0250] result

[0251] Figure 5 It was confirmed that iPSC-derived hepatocytes transfected with the circular non-viral DNA reporter vector (including RFP / GFP reporter) (SEQ ID NO: 32) of the present disclosure showed simultaneous GFP and RFP expression on day 3, but mainly showed only RFP expression on day 8. The data showed that the circular non-viral DNA vector containing the cruciform structure can be dissociated into a linear form in non-dividing primary human iPSC-derived hepatocytes.

[0252] Example 2 - In vitro persistent gene expression of firefly luciferase DNA constructs in IPSC-derived hepatocytes

[0253] Transfection with the circular non-viral DNA vector of the present disclosure encoding TNALP (M014-SEQ ID NO: 30) resulted in strong bioluminescent emission in iPSC-derived hepatocytes starting from day 3; and the signal was maintained from day 12 to day 21, while the relative luminescence units (RLU) of cells transfected with the control circular non-viral DNA vector of the present disclosure encoding TNALP (P021-SEQ ID NO: 31) decreased significantly from day 7, as shown in FIG. Figure 6 As shown in . The circular non-viral DNA vector of the present disclosure including a luciferase reporter gene showed robust and persistent luciferase expression, whereas the same control construct carrying an antibiotic resistance gene was much less potent and not sustained.

[0254] method

[0255] Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm. On day 0, plating medium was prepared by adding 1.5 mL B27 supplement, 0.15 mL 10 μg / mL oncostatin stock solution, 1.5 μL 5 mM dexamethasone stock solution, 37.5 μL 25 μg / mL gentamicin, and 1.5 mL iCell Hepatocyte 2.0 Medium Supplement to 72 mL RPMI medium according to Fujifilm's recommendations.

[0256] Filter the plating medium through a 0.22 μm PES filter unit. On day 1, remove the iCell Hepatocyte 2.0 cryovial from the liquid nitrogen storage tank. Submerge the cryovial in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, gently transfer the contents of the iCell Hepatocyte 2.0 cryovial to a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. Centrifuge the cell suspension at 200 x g for 3 minutes at room temperature. Carefully aspirate the supernatant under vacuum. Slowly add 2 mL of 37°C plating medium with a wide-bore pipette to resuspend the cell pellet. Plate the hepatocytes in pre-warmed collagen-coated 24 / 48-well plates. Refresh the medium daily from day 1 to day 7, and every other day starting from day 8.

[0257] Prepare the TransIT-LT1 reagent and non-viral vector DNA complex as recommended by the Mirus manufacturer. Add the TransIT-LT1 reagent:DNA complex dropwise to different areas of the well. Gently rock the culture vessel back and forth and side to side to evenly distribute the TransIT-LT1 reagent:DNA complex.

[0258] For non-invasive bioluminescence readings, luciferin substrate stock was added to the cell plate to achieve a final concentration of 5 mM, and the RLU from each well of the plate was measured by a Molecular Device plate reader iD5.

[0259] Example 3 - In vitro persistent gene expression of TNALP DNA constructs in IPSC-derived hepatocytes

[0260] exist Figure 7 In the present invention, hepatocytes transfected with a circular non-viral DNA vector of the present disclosure (M012-SEQ ID NO: 28) comprising a nucleic acid encoding TNALP and also comprising a series of single inverted repeats without intervening heterologous sequences showed higher ALP secretion than non-dividing iPSC-derived hepatocytes transfected with a circular non-viral DNA vector (M013-SEQ ID NO: 29) comprising a nucleic acid encoding TNALP and also comprising a series of single inverted repeats without intervening heterologous sequences. Cells transfected with both constructs comprising inverted repeats showed higher ALP secretion than cells transfected with a control TNALP construct (P020-SEQ ID NO: 33) comprising an ampicillin resistance gene.

[0261] method

[0262] Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm. On day 0, plating medium was prepared by adding 1.5 mL B27 supplement, 0.15 mL 10 μg / mL oncostatin stock solution, 1.5 μL 5 mM dexamethasone stock solution, 37.5 μL 25 μg / mL gentamicin, and 1.5 mL iCell Hepatocyte 2.0 Medium Supplement to 72 mL RPMI medium according to Fujifilm's recommendations.

[0263] Filter the plating medium through a 0.22 μm PES filter unit. On Day 1, remove the iCell Hepatocyte 2.0 cryovial from the liquid nitrogen storage tank and immerse the cryovial in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, gently transfer the contents of the iCell Hepatocyte 2.0 cryovial to a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. Centrifuge the cell suspension at 200 x g for 3 minutes at room temperature. Carefully aspirate the supernatant under vacuum. Slowly add 2 mL of 37°C plating medium with a wide-bore pipette to resuspend the cell pellet. Plate the hepatocytes in pre-warmed collagen-coated 24 / 48-well plates. Refresh the medium every day from Day 1 to Day 7, and every other day starting from Day 8.

[0264] Prepare the TransIT-LT1 reagent and non-viral vector DNA complex as recommended by the Mirus manufacturer. Add the TransIT-LT1 reagent:DNA complex dropwise to different areas of the well. Gently rock the culture vessel back and forth and side to side to evenly distribute the TransIT-LT1 reagent:DNA complex.

[0265] At different time points, the cell culture medium was removed and the ALP activity in the cell culture medium was determined by ALP colorimetric assay performed on a Molecular Device plate reader iD5.

[0266] Example 4 - Persistence of hepatic luciferase expression by luciferase-containing constructs in adult mice

[0267] The circular non-viral DNA vector encoding the luciferase reporter according to the present disclosure (M014-SEQ ID NO: 30) showed persistent bioluminescent signals in the liver tissue of mice harvested from week 1 to week 4 and week 5 after administration by hydrodynamic tail vein injection (15 μg per mouse), while mice injected with a control luciferase plasmid showed background levels of luminescence, as shown in FIG. Fig. 8A Further analysis of the DNA copy number per diploid cell showed that the M014 construct was maintained in the mouse liver tissue for one month, while the copy number of the control luciferase plasmid (P021-SEQ ID NO: 31) in the mouse hepatocytes decreased significantly from the 1st week to the 5th week, as shown in FIG. Figure 8B as shown in .

[0268] method

[0269] Adult mice (strain: BALB / c) aged 9-11 weeks were ordered from Jackson Laboratory. Animals were randomly divided into groups using a random number generator before the start of the study. Non-viral DNA vector constructs were administered to adult mice by hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 80 mL / kg. At several endpoint time points, luciferase activity and non-viral DNA vector copy number in liver tissue were measured in vitro.

[0270] For DNA copy number measurements of constructs according to the present disclosure, approximately 25 mg of each liver lobe was collected from each animal and stored below -65°C, and then ddPCR assays were performed on the Biorad ddPCR system. Primers / probes targeting the polyA region of the non-viral DNA vector construct were used to measure the non-viral DNA vector construct copy number, while mouse RPP30 was used as a reference gene.

[0271] For luciferase, the remaining tissue from each liver lobe was stored below -65°C to generate lysate / luciferase. Bioluminescence from liver lysates after homogenization was measured using the Spectra Max Glo Steady-Luc Reporter Assay Kit.

[0272] Example 5 - Treatment of mice with circular non-viral DNA vectors expressing TNALP and lentiviral vectors expressing TNALP Comparison of ALP levels in mice

[0273] Fig. 9 It is shown that 1×10 6 Similar plasma ALP levels were found in mice (n=3) dosed with a circular non-viral DNA vector (M013-SEQ ID NO: 29) comprising a nucleic acid encoding TNALP, compared to mice treated with 100% transduced hematopoietic stem / progenitor cells (transduced hematopoietic stem / progenitor cells 2 weeks after dosing).

[0274] method

[0275] Adult mice aged 9-11 weeks were ordered from Jackson Laboratory (strain: B6129SF2 / J). Animals were randomly divided into groups using a random number generator before the start of the study. Non-viral DNA vector constructs were administered to adult mice by hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 80 mL / kg. Luciferase activity and non-viral DNA vector copy number in the liver were measured at several endpoint time points.

[0276] For DNA vector copy number measurement, 25 mg of each liver lobe was collected from each animal and stored below -65 °C before ddPCR assay on the Biorad ddPCR system. Non-viral DNA vector construct copy number was measured using primers / probes targeting the polyA region of the non-viral DNA vector construct, while mouse RPP30 was used as a reference gene.

[0277] At different time points, plasma samples were collected from the animals and stored below -65°C prior to ALP measurement. ALP concentrations were determined by colorimetric assay performed on a Molecular Device plate reader iD5.

[0278] Example 6 - Generation of constructs according to the present disclosure

[0279] In some embodiments, a circular non-viral DNA vector can be generated by "Cre-lox recombination" from a parent plasmid (e.g., pUC or pMB1) that includes both a marker gene and a high copy number replication origin between two loxP sites. Cre recombinase can be induced by metabolic control in bacterial cells carrying the parent plasmid. In this case, recombination produces two circular supercoiled DNA molecules that are topologically unconnected, each containing a single loxP site. One resulting circular supercoiled DNA molecule contains a marker gene and a high copy number replication origin, while the other contains a circular non-viral DNA vector of the present disclosure.

[0280] In some embodiments, other LoxP sites such as Lox511, Lox5171, Lox 2272, M2, M3, M7, M11, Lox 71, Lox 66, LoxPsym or others can be used to generate non-viral DNA vectors from parent DNA plasmids. In some embodiments, other recombinases such as PhiC31, λ integrase and Flp recombinase can be used to generate non-viral DNA vectors. In some embodiments, recombinases such as Cre, PhiC31, λ integrase and F1p recombinase can be recombinantly produced and directly applied to purified parent plasmid DNA to generate non-viral DNA vectors. In some embodiments, marker genes will include those encoding kanamycin resistance, spectinomycin resistance, streptomycin resistance, carbenicillin resistance, bleomycin resistance, erythromycin resistance, polymyxin B resistance, tetracycline resistance or chloramphenicol resistance, etc. In some embodiments, the origin of replication will include those sequences from pMB1, pBR322, ColE1, p15A, pSC101, or F1.

[0281] Example 7 - Persistence of Murine Liver SEAP Expression by Murine SEAP Constructs in Adult Mice

[0282] Circular non-viral DNA vectors using the EF1α and TBG promoters encoding the murine SEAP reporter (M027 and M032 - SEQ ID NO: 74 and SEQ ID NO: 75, respectively) showed persistence of high plasma SEAP activity in mouse samples collected from day 1 to day 190 after administration by hydrodynamic tail vein injection (15 μg per mouse). Fig. 12A and 12B ). Analysis of DNA copy number per diploid cell showed that two constructs according to the present disclosure (M027-SEQ ID NO: 74; and M032-SEQ ID NO: 75) were maintained in the mouse liver for 189 days ( Fig. 12C ).

[0283] method

[0284] Adult mice (strain: BALB / c) aged 9-11 weeks were ordered from Charles River Laboratories. Animals were randomized into groups using a random number generator prior to the start of the study. Adult mice were administered non-viral DNA vector constructs by hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 100 mL / kg. SEAP activity was measured in plasma samples and non-viral DNA vector copy number was measured in liver tissue samples at several endpoint time points.

[0285] For copy number measurement of constructs according to the present disclosure, 25 mg of each liver lobe was collected from each animal and stored below -65°C before ddPCR assays on the BioRad ddPCR system. Primers / probes targeted the polyA region of the reference gene.

[0286] At different time points, plasma samples were collected and stored below -65°C before SEAP assay. SEAP activity was determined by SEAP fluorescence assay performed on a Molecular Device plate reader iD5.

[0287] Example 8 - Nuclear entry of constructs according to the present disclosure

[0288] To determine the extent to which the cruciform structure affects nuclear entry and retention, postmitotic non-dividing iPSC-derived hepatocytes transfected with a fluorescently labeled circular non-viral DNA vector comprising a nucleic acid encoding TNALP and also comprising a series of single inverted repeats without intervening heterologous sequences (DD-ITR construct) (M013 - SEQ ID NO: 29) and a control TNALP construct comprising an ampicillin resistance gene (M022 - SEQ ID NO: 33) showed a higher number of nuclear foci per cell at days 1, 3, and 6 compared to hepatocytes transfected with a circular non-viral DNA vector comprising a nucleic acid encoding TNALP and also comprising a series of single inverted repeats without intervening heterologous sequences (DD-ITR construct) (M013 - SEQ ID NO: 29) and a control TNALP construct comprising an ampicillin resistance gene (M022 - SEQ ID NO: 33). Fig. 14B The number of nuclear foci per cell is correlated with the ALP activity of the culture medium ( Fig. 14C ).

[0289] method

[0290] Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm. On day 0, plating medium was prepared by adding 1.5 mL B27 supplement, 0.15 mL 10 μg / mL oncostatin stock solution, 1.5 μL 5 mM dexamethasone stock solution, 37.5 μL 25 μg / mL gentamicin, and 1.5 mL iCell Hepatocyte 2.0 Medium Supplement to 72 mL RPMI according to Fujifilm's recommendations.

[0291] After thawing iCell Hepatocyte 2.0 Medium Supplement (1x 3.0mL), filter the plating medium through a 0.22μm PES filter unit. On the first day, remove the iCell Hepatocyte 2.0 cryovial from the liquid nitrogen tank. Immerse the cryovial in a 37°C water bath for a full 3 minutes. Using a 2mL serological pipette, gently transfer the contents of the iCell Hepatocyte 2.0 cryovial to a 15mL centrifuge tube containing 10mL 37°C plating medium. Centrifuge the cell suspension at 200x g for 3 minutes at room temperature. After carefully aspirating the supernatant, resuspend the cell pellet using 2mL warm plating medium with a wide-bore pipette. Hepatocytes are seeded in pre-warmed collagen-coated 24 / 48-well plates.

[0292] Transfection reagents were purchased from FuGENE, and DNA transfection followed the manufacturer's recommendations.

[0293] At different time points, the cell culture medium was removed and ALP levels were determined by ALP colorimetric assay performed on a Molecular Device plate reader iD5.

[0294] Cells were fixed at 1, 3, and 6 days post-transfection, stained with DAPI, and mounted for confocal imaging. DAPI staining (blue) represents the nucleus, and green foci represent the disclosed constructs in both the nucleus and cytoplasm within the cell ( Fig.14A ).

[0295] Images were analyzed using ImagePro 11 intelligent segmentation. 2 Nuclear regions of interest (ROI) were identified on the blue channel using a minimum area cutoff of 0.04 μm2. ROIs including the disclosed constructs were identified on the green channel using a minimum area cutoff of 0.04 μm2. Only foci including the disclosed constructs located within the nucleus were counted.

[0296] An average of 400 cells were analyzed for each condition. Data are plotted as the average number of foci per cell nucleus for each condition. Outliers were excluded from the data set using 3 criteria (nuclear area, number of foci, and percentage of foci to nuclear area).

[0297] Example 9 - Expression of somatic genes in IPSC-derived hepatocytes with reporter constructs having different cruciform structures DA

[0298] Fig.13A It was shown that transfection with a circular non-viral DNA vector with a further improved cruciform structure (M056-SEQ ID NO: 73) resulted in stronger ALP levels in the culture medium of iPSC-derived hepatocytes at day 3 than with a circular non-viral DNA vector with an improved cruciform structure (M012-SEQ ID NO: 30) using either FuGENE or SM102-based lipid nanoparticle formulations. Fig. 13B As shown in , neither circular non-viral DNA vector induced significant toxicity in iPSC-derived human hepatocytes using either FuGENE or SM102-based lipid nanoparticle formulations.

[0299] method

[0300] Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm. On day 0, plating medium was prepared by adding 1.5 mL B27 supplement, 0.15 mL 10 μg / mL oncostatin stock solution, 1.5 μL 5 mM dexamethasone stock solution, 37.5 μL 25 μg / mL gentamicin, and 1.5 mL iCell Hepatocyte 2.0 Medium Supplement to 72 mL RPMI according to Fujifilm's recommendations.

[0301] After thawing iCell Hepatocyte 2.0 Medium Supplement (1x3.0mL), filter the plating medium through a 0.22μm PES filter unit. On the first day, remove the iCell Hepatocyte 2.0 cryovial from the liquid nitrogen tank. Immerse the cryovial in a 37°C water bath for a full 3 minutes. Using a 2mL serological pipette, gently transfer the contents of the iCell Hepatocyte 2.0 cryovial to a 15mL centrifuge tube containing 10mL 37°C plating medium. Centrifuge the cell suspension at 200x g for 3 minutes at room temperature. After carefully aspirating the supernatant, resuspend the cell pellet using 2mL warm plating medium with a wide-bore pipette. Hepatocytes are seeded in pre-warmed collagen-coated 24 / 48-well plates.

[0302] Prepare FuGene or SM-102-based lipid nanoparticle transfection reagent and non-viral vector DNA complexes according to the supplier's recommendations. Add the transfection reagent:DNA complex (prepared in step A) dropwise to different areas of the well. Gently shake the culture container back and forth and left and right to evenly distribute the transfection reagent:DNA complex.

[0303] On day 3, the cell culture medium was removed and ALP levels were determined by ALP colorimetric assay performed on a Molecular Device plate reader iD5.

[0304] Example 10 - Expression of reporter constructs with or without a cruciform structure in primary human and cynomolgus hepatocytes Somatic gene expression

[0305] Using the SM102-based lipid nanoparticle formulation, transfection of the disclosed construct comprising luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) resulted in significantly higher luciferase activity in primary human hepatocytes ( Fig.15A ) and cynomolgus monkey hepatocytes ( Fig. 15B ) had much higher luciferase levels.

[0306] method

[0307] Primary human hepatocytes (Lonza) and primary cynomolgus hepatocytes (GIBCO) were seeded in duplicate wells of type I collagen-coated 96-well plates at 80,000 and 70,000 cells per well on day 0. One day after seeding, the constructs of the disclosure and control constructs were delivered via LNP mixtures.

[0308] Prepare a SM-102-based lipid mixture (SM102, DSPC, N / P 6, 1.5% DMG-PEG2K) and mix the DNA with the lipid mixture using a pipette. Add the lipid mixture: DNA complex dropwise to different areas of the well. Gently shake the culture container back and forth and left and right to evenly distribute the lipid DNA mixture.

[0309] Primary human hepatocytes ( Fig.16 A) and primary cynomolgus monkey hepatocytes ( Fig.16 B) Endpoint luciferase activity in cell lysates.

[0310] Example 11 - Firefly luciferase constructs enhance hepatic luciferase expression in adult mice

[0311] The circular non-viral DNA vector (SEQ ID NO: 73) including the firefly luciferase reporter showed higher expression of luciferase activity in mouse liver tissue harvested on days 7 and 14 after administration via tail vein-based hydrodynamic injection (15 μg per mouse) compared to a control firefly luciferase construct (SEQ ID NO: 73). Fig.16 ).

[0312] method

[0313] Adult mice (strain: BALB / c) aged 9-11 weeks were ordered from Charles River Laboratories. Animals were randomized into groups using a random number generator before the start of the study. Non-viral DNA vector constructs were administered to adult mice by hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 100 mL / kg. Firefly luciferase activity was measured in liver samples on days 7 and 14.

[0314] On days 7 and 14, mice were euthanized and liver samples were collected and stored below -65 °C before bioluminescence measurements were determined by bioluminescence assay performed on a Molecular Device plate reader iD5.

[0315] Example 12 - DNA constructs encoding cynomolgus monkey soluble TNALP transgene and chemically modified mRNA in primary human Comparison of in vitro gene expression in hepatocytes

[0316] (i) A construct of the present disclosure comprising cynomolgus monkey soluble TNALP DNA with an improved cruciform structure (SEQ ID NO: 43) and (ii) a chemically modified mRNA encoding the same transgene were delivered to primary human hepatocytes using a SM102-based lipid nanoparticle formulation. The ALP activity of the construct according to the present disclosure in culture medium increased from day 1 to day 3 and then remained constant from day 3 to day 6. Meanwhile, the ALP activity of the mRNA transfected cells decreased continuously from day 1 to day 5 and disappeared on day 6 ( Fig.17 ).

[0317] method

[0318] Primary human hepatocytes (Lonza) were seeded in duplicate wells of a type I collagen-coated 96-well plate at 80,000 cells per well on day 0. One day after seeding, the constructs of the present disclosure and control constructs were delivered via LNP mixtures.

[0319] Prepare a SM-102-based lipid mixture (SM102, DSPC, N / P 6, 1.5% DMG-PEG2K) and mix the DNA with the lipid mixture using a pipette. Add the lipid mixture: DNA complex dropwise to different areas of the well. Gently shake the culture container back and forth and left and right to evenly distribute the lipid DNA mixture.

[0320] Between days 1 and 6, cell culture medium was removed and ALP levels were determined by ALP fluorescence assay performed on a Molecular Device plate reader iD5.

[0321] Example 13 - Constructs according to the present disclosure co-localize with PARP1

[0322] Fig.18 Representative confocal images of 293T cells transfected with a fluorescently labeled construct according to the present disclosure (M012-SEQ ID NO: 28) are shown. The cells were stained with anti-PARP1-AF647 (purple). Since the region of PARP1 overlaps with the construct according to the present disclosure, it suggests that PARP1 may be involved in the intracellular pathway of the construct according to the present disclosure after transfection.

[0323] method

[0324] Prior to transfection, the construct according to the present disclosure (M012 - SEQ ID NO: 28) was labeled with a green fluorescent DNA conjugating reagent. The transfection reagent was purchased from FuGENE, and DNA transfection followed the manufacturer's recommendations.

[0325] 293T cells were fixed on day 3 after transfection, stained with DAPI and anti-PARP1 antibody, and mounted for confocal imaging. Purple represents PARP1, DAPI staining (blue) represents the nucleus, and green represents the construct according to the present disclosure ( Fig.18 ).

[0326] Example 14 - Immunomodulatory effects of constructs according to the present disclosure

[0327] To determine the extent to which the cruciform structure and cassette genes affect immune responses, adult mice (n=7 per group) were dosed three times with three different constructs: (i) a circular non-viral DNA vector carrying human TNALP with a single inverted repeat sequence without intervening heterologous sequences (M013-SEQ ID NO: 29), a high CpG content, a bone tag, and an lg-Fc domain ( Fig.19A ); (ii) a circular non-viral DNA vector according to the present disclosure (M012-SEQ ID NO: 28) carrying a human TNALP transgene with an improved cruciform structure, having a high CpG content, a bone tag and an Fc domain ( Fig.19B ), or (iii) a circular non-viral DNA vector according to the present disclosure carrying cynomolgus monkey TNALP with an improved cruciform structure (SEQ ID NO: 43), but with zero CpG content in the transgene coding, no bone tag and no lg-Fc domain in the gene cassette to increase TNALP protein expression and reduce the immunostimulatory properties of the DNA ( Fig.19C ). Plasma ALP activity from DNA constructs with a single inverted repeat sequence without an intervening heterologous sequence cruciform structure was less potent, less persistent, and demonstrated an inability to repeat dosing, which may be due to humoral or cellular immune responses to inflammatory transgene products or transgene expressing cells. Plasma ALP activity from constructs with an improved cruciform structure according to the present disclosure demonstrated increased potency, more sustained transgene expression, and the ability to repeat dosing, which may be due to invasion of the cytoplasmic DNA signaling (CDS) pathway mediated by the cGAS-STING pathway. Optimization of the gene expression cassette in this construct further improved plasma protein secretion and reduced immune responses, resulting in the highest ALP activity levels observed.

[0328] method

[0329] Adult mice (strain: BALB / c) aged 9-11 weeks were ordered from Charles River Laboratories. Animals were randomized into groups using a random number generator before the start of the study. Non-viral DNA vector constructs were administered to adult mice by hydrodynamic tail vein injection at intervals of 3 weeks at a dose of 15 μg per animal in a volume of 100 mL / kg.

[0330] At different time points, plasma samples were collected and stored below -65°C before ALP assay. ALP activity was determined by TNALP fluorescence assay performed on a Molecular Device plate reader iD5.

[0331] Another implementation plan

[0332] In some embodiments, the present disclosure relates to an amino acid sequence having at least 85% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 91% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 92% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 93% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 94% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to an amino acid sequence having at least 96% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 97% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 98% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 99% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having any one of SEQ ID NOs: 19-27.

[0333] In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 85% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 90% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 91% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 92% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 93% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 94% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 95% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 96% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 97% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 98% identity with any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 99% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having any one of SEQ ID NOs: 19-27.

[0334] In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the present disclosure relates to a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 28-73. In some embodiments, the disclosure relates to a nucleic acid sequence having any one of SEQ ID NOs: 28-73.

[0335] A circular non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 82% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 83% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 84% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 28-30.A circular non-viral DNA vector comprising a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 28-30. A circular non-viral DNA vector comprising a nucleic acid sequence having any one of SEQ ID NOs: 28-30.

[0336] A circular non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 82% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 83% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 84% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 72-73.A circular non-viral DNA vector comprising a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 72-73. A circular non-viral DNA vector comprising a nucleic acid sequence having any one of SEQ ID NOs: 72-73.

[0337] In some embodiments, a circular non-viral DNA vector comprises: a first portion consisting essentially of an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, wherein the second portion consists essentially of at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0338] In some embodiments, a circular non-viral DNA vector is essentially composed of: a first part essentially composed of an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second part capable of forming at least one cruciform structure, wherein the second part is essentially composed of at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0339] In some embodiments, a circular non-viral DNA vector comprises: a first part consisting of an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second part capable of forming at least one cruciform structure, wherein the second part consists of at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0340] In some embodiments, a circular non-viral DNA vector is composed of: a first part consisting of an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and a second part capable of forming at least one cruciform structure, wherein the second part consists of at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0341] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent publications mentioned in this specification and / or listed in the Application Data Sheet are incorporated herein by reference in their entirety. If necessary, aspects of the embodiments may be modified to adopt the concepts of the various patents, applications, and publications to provide yet further embodiments.

[0342] Although the present disclosure has been described with reference to a number of illustrative embodiments, it will be appreciated that numerous other modifications and embodiments can be devised by those skilled in the art that will fall within the spirit and scope of the principles of the present disclosure. More particularly, within the scope of the foregoing disclosure, the drawings and the appended claims, reasonable changes and modifications may be made to the component parts and / or arrangements of the subject combination arrangement without departing from the spirit of the present disclosure.

Claims

1. An isolated circular non-viral DNA vector, comprising: (a) a first part comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (b) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

2. The isolated circular non-viral DNA vector according to claim 1, wherein the non-viral DNA vector is substantially free of CpG sequences.

3. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 400 CpGs / vector.

4. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 300 CpGs / vector.

5. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 150 CpGs / vector.

6. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 50 CpGs / vector.

7. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 5 nucleotides.

8. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 10 nucleotides.

9. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 15 nucleotides.

10. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 20 nucleotides.

11. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes at least a portion of a bacterial origin of replication.

12. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence having at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene.

13. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial repressor tRNA.

14. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial RNAi repressor.

15. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes an antisense RNA.

16. The isolated circular non-viral DNA vector according to any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial operon sequence.

17. The isolated circular non-viral DNA vector of claim 16, wherein the bacterial operator sequence comprises the lac operon.

18. The isolated circular non-viral DNA vector of claim 16, wherein the bacterial operon sequence comprises a tet operator.

19. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-viral DNA vector lacks a drug resistance gene.

20. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector comprises one or more recombination sites.

21. The isolated circular non-viral DNA vector of claim 20, wherein the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites; their product sites attL or attR; or alternative recombination target sites derived from these sites.

22. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-viral DNA vector is substantially double-stranded.

23. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-viral DNA vector is substantially supercoiled.

24. The isolated circular non-viral DNA vector of claim 23, wherein the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions.

25. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-viral DNA vector is non-immunogenic.

26. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences is derived from a nucleic acid sequence present within one or more AAV serotypes.

27. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 1-18.

28. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 1-18.

29. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 1-18.

30. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-viral DNA vector does not comprise a DD element.

31. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59.

32. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59.

33. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59.

34. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides has a nucleotide sequence having any one of SEQ ID NOs: 58-59.

35. An isolated circular non-viral DNA vector according to any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 or 17; a second nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 18.

36. An isolated circular non-viral DNA vector according to any of the preceding claims, wherein the second portion comprises a first nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15 or 17; a second nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59; and a third nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16 or 18.

37. An isolated circular non-viral DNA vector according to any of the preceding claims, wherein the second part comprises a first nucleic acid sequence having any one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15 or 17; a second nucleic acid sequence having any one of SEQ ID NO: 58-59; and a third nucleic acid sequence having any one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16 or 18.

38. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 35 and 60.

39. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs: 35 and 60.

40. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs: 35 and 60.

41. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 35 and 60.

42. The isolated circular non-viral DNA vector according to any one of the preceding claims, wherein the second part comprises a nucleic acid sequence having any one of SEQ ID NOs: 35 and 60.

43. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, A1AT, anti-CD19-anti-CD3, and ABCB11.

44. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

45. An isolated circular non-viral DNA vector, comprising: (a) a first part comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (b) a second portion capable of forming at least one cruciform structure, wherein the second portion has the formula XYX', wherein X and X' are each an inverted repeat sequence, and wherein Y is non-repetitive and comprises a nucleotide sequence having at least 3 nucleotides.

46. ​​The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector is substantially free of CpG sequences.

47. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 400 CpGs per vector.

48. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 300 CpGs per vector.

49. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 150 CpGs per vector.

50. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 50 CpGs per vector.

51. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y comprises at least 5 nucleotides.

52. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y comprises at least 10 nucleotides.

53. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y comprises at least 15 nucleotides.

54. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y comprises at least 20 nucleotides.

55. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes at least a portion of a bacterial origin of replication.

56. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes a heterologous gene or a portion of a heterologous gene.

57. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes a bacterial repressor tRNA.

58. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes a bacterial RNAi repressor.

59. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes antisense RNA.

60. The isolated circular non-viral DNA vector of any one of claims 45-50, wherein Y encodes a bacterial operon sequence.

61. The isolated circular non-viral DNA vector of claim 60, wherein the bacterial operator sequence comprises the lac operon.

62. The isolated circular non-viral DNA vector of claim 60, wherein the bacterial operator sequence comprises a tet operator.

63. The isolated circular non-viral DNA vector according to any one of claims 45-62, wherein the non-viral DNA vector lacks a drug resistance gene.

64. The isolated circular non-viral DNA vector of any one of claims 45-63, wherein the non-viral DNA vector comprises one or more recombination sites.

65. The isolated circular non-viral DNA vector of claim 64, wherein the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites; their product sites attL or attR; or alternative recombination target sites derived from these sites.

66. The isolated circular non-viral DNA vector according to any one of claims 45-65, wherein the non-viral DNA vector is substantially double-stranded.

67. The isolated circular non-viral DNA vector according to any one of claims 45-66, wherein the non-viral DNA vector is substantially supercoiled.

68. The isolated circular non-viral DNA vector of claim 67, wherein the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions.

69. The isolated circular non-viral DNA vector according to any one of claims 45-68, wherein the non-viral DNA vector is non-immunogenic.

70. The isolated circular non-viral DNA vector of any one of claims 45-69, wherein X and X' are derived from nucleic acid sequences present within one or more AAV serotypes.

71. The isolated circular non-viral DNA vector of any one of claims 45-69, wherein X and X' each comprise a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 1-18.

72. The isolated circular non-viral DNA vector of any one of claims 45-69, wherein X and X' each comprise a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 1-18.

73. The isolated circular non-viral DNA vector of any one of claims 45-69, wherein X and X' each comprise a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 1-18.

74. The isolated circular non-viral DNA vector according to any one of claims 45 to 73, wherein the non-viral DNA vector does not comprise a DD element.

75. The isolated circular non-viral DNA vector of any one of claims 45-74, wherein Y has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59.

76. The isolated circular non-viral DNA vector of any one of claims 45-74, wherein Y has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59.

77. The isolated circular non-viral DNA vector of any one of claims 45-74, wherein Y has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59.

78. The isolated circular non-viral DNA vector according to any one of claims 45-74, wherein the nucleotide sequence of Y has any one of SEQ ID NOs: 58-59.

79. The isolated circular non-viral DNA vector of any one of claims 45-78, wherein Y does not comprise a bacterial origin of replication or any portion thereof.

80. The isolated circular non-viral DNA vector according to any one of claims 45 to 78, wherein the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but wherein the bacterial origin of replication or a portion of the bacterial origin of replication is not included in the second portion.

81. The isolated circular non-viral DNA vector of any one of claims 45-78, wherein the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but wherein the bacterial origin of replication or the portion of the bacterial origin of replication is not included in Y.

82. The isolated circular non-viral DNA vector of any one of claims 45-81, wherein the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, A1AT, anti-CD19-anti-CD3, and ABCB11.

83. The isolated circular non-viral DNA vector of any one of claims 45-81, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

84. An isolated circular non-viral DNA vector comprising the following elements operably linked in a 5' to 3' direction: (i) a first repeating sequence; (ii) a non-repetitive nucleotide sequence of at least 3 nucleotides; (iii) a second repeating sequence; and (iv) an expression cassette.

85. The isolated circular non-viral DNA vector of claim 84, wherein the non-viral DNA vector comprises less than about 150 CpGs / vector.

86. The isolated circular non-viral DNA vector of claim 84, wherein the non-viral DNA vector comprises less than about 50 CpGs / vector.

87. The isolated circular non-viral DNA vector of claim 84, wherein the expression cassette comprises one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter.

88. The isolated circular non-viral DNA vector of any one of claims 84-87, wherein the non-repetitive nucleotide sequence comprises at least 5 nucleotides.

89. The isolated circular non-viral DNA vector of any one of claims 84-87, wherein the non-repetitive nucleotide sequence comprises at least 10 nucleotides.

90. The isolated circular non-viral DNA vector of any one of claims 84-87, wherein the non-repetitive nucleotide sequence comprises at least 15 nucleotides.

91. The isolated circular non-viral DNA vector of any one of claims 84-87, wherein the non-repetitive nucleotide sequence comprises at least 20 nucleotides.

92. The isolated circular non-viral DNA vector of any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes at least a portion of a bacterial origin of replication.

93. The isolated circular non-viral DNA vector according to any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene.

94. The isolated circular non-viral DNA vector of any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial repressor tRNA.

95. The isolated circular non-viral DNA vector of any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial RNAi repressor.

96. The isolated circular non-viral DNA vector of any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes an antisense RNA.

97. The isolated circular non-viral DNA vector of any one of claims 84-91, wherein the non-repetitive nucleotide sequence of at least 3 nucleotides encodes a bacterial operon sequence.

98. The isolated circular non-viral DNA vector of claim 97, wherein the bacterial operator sequence comprises a lac operon.

99. The isolated circular non-viral DNA vector of claim 97, wherein the bacterial operator sequence comprises a tet operator.

100. The isolated circular non-viral DNA vector according to any one of claims 84-99, wherein the non-viral DNA vector lacks a drug resistance gene.

101. The isolated circular non-viral DNA vector of any one of claims 84-100, wherein the non-viral DNA vector comprises one or more recombination sites.

102. The isolated circular non-viral DNA vector of claim 101, wherein the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites; their product sites attL or attR; or alternative recombination target sites derived from these sites.

103. The isolated circular non-viral DNA vector according to any one of claims 84-102, wherein the non-viral DNA vector is non-immunogenic.

104. The isolated circular non-viral DNA vector of any one of claims 84-103, wherein the non-viral DNA vector is substantially double-stranded.

105. The isolated circular non-viral DNA vector of any one of claims 84-104, wherein the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, anti-CD19-anti-CD and ABCB11.

106. The isolated circular non-viral DNA vector of any one of claims 84-104, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

107. An isolated circular non-viral DNA vector, comprising: (a) a first part comprising an expression cassette, the expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (b) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by at least a portion of a bacterial origin of replication.

108. The isolated circular non-viral DNA vector of claim 107, wherein the non-viral DNA vector comprises less than about 150 CpGs / vector.

109. The isolated circular non-viral DNA vector of claim 107, wherein the non-viral DNA vector comprises less than about 50 CpGs / vector.

110. The isolated circular non-viral DNA vector according to any one of claims 107-109, wherein the non-viral DNA vector lacks a drug resistance gene.

111. The isolated circular non-viral DNA vector of any one of claims 107-110, wherein the non-viral DNA vector comprises one or more recombination sites.

112. The isolated circular non-viral DNA vector of claim 111, wherein the one or more recombination sites are selected from LoxP sites, FRT sites, attB and attP sites; their product sites attL or attR; or alternative recombination target sites derived from these sites.

113. The isolated circular non-viral DNA vector according to any one of claims 107-112, wherein the non-viral DNA vector is non-immunogenic.

114. The isolated circular non-viral DNA vector of any one of claims 107-113, wherein the one or more therapeutic proteins are selected from ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, anti-CD19-anti-CD and ABCB11.

115. The isolated circular non-viral DNA vector of any one of claims 107-113, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

116. The isolated circular non-viral DNA vector according to any one of claims 107-115, wherein the non-viral DNA vector further comprises an S / MAR element.

117. The isolated circular non-viral DNA vector according to any one of claims 107-116, wherein the non-viral DNA vector further comprises an insulator element.

118. The isolated circular non-viral DNA vector of any one of claims 107-117, wherein the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

119. An isolated circular non-viral DNA vector, comprising: (a) comprising a first part of an expression cassette, the expression cassette comprising a nucleic acid sequence encoding a polypeptide having any one of formula (IA) to (IE), wherein the nucleic acid sequence encoding the polypeptide is operably linked to a promoter; and (b) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides; [A] v -[B]-[C] w -[R] q -([D] x -[E] y ) z ,(IA) [A]-[B]-[C]-[R] q -([D] x -[AND] y ),(IB) ([A]-[B])-([D] x -[E] y ) z ,(IC) ([A]-[B])-([E]y), (ID) [A]-[B]-[R] q -([E] y )(IE) in A comprises an amino acid sequence encoding a secretory signal peptide; B contains the amino acids encoding alkaline phosphatase; C contains the amino acid sequence encoding the GPI anchor; R is -(M o (Fc)N p )-, wherein M and N each independently comprise 1 to 6 amino acids, wherein Fc is an Fc domain, and o and p each independently are 0, 1 or 2; D comprises an amino acid sequence of 4 to 6 amino acids, or is F(G) t F, wherein each F is the same amino acid, G is an amino acid sequence of 3, 4 or 5 amino acids, and t is an integer in the range of 2-5; E comprises an amino acid sequence having 1 to 8 amino acids; q is 0 or 1; v is 0 or 1; w is 0 or 1; x is 0 or an integer in the range of 1 to 6; y is 0 or an integer in the range of 1 to 16; and z is 0 or an integer in the range of 1 to 6.

120. The isolated circular non-viral DNA vector of claim 119, provided that when v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid -DI-, M is diamino acid -LK-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130 and x is 0, then [E] y Does not contain ten to sixteen consecutive aspartic acid residues.

121. The isolated circular non-viral DNA vector of claim 119, wherein E comprises 3 amino acids.

122. The isolated circular non-viral DNA vector of claim 119, wherein E is -DSS-.

123. The isolated circular non-viral DNA vector of claim 119, wherein E is -DSS- and y is in the range of 1 to 16.

124. The isolated circular non-viral DNA vector of claim 119, wherein E is -DSS-, y is 6, z is 1, q is 0, and x is 0; in other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 2.

125. The isolated circular non-viral DNA vector of claim 119, wherein E is -DSS-, y is 6, z is 1, x is 2, and q is 1.

126. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 80% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

127. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 85% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

128. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 90% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

129. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 92% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

130. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 94% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

131. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 95% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

132. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 96% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

133. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 97% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

134. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 98% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

135. An isolated circular non-viral DNA vector having a nucleic acid sequence at least 99% identical to any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

136. An isolated circular non-viral DNA vector, the nucleic acid sequence of which has any one of SEQ ID NOs: 28-30, 38, 40-48 and 72-73.

137. A pharmaceutical composition comprising any of the isolated circular non-viral DNA vectors according to any one of the preceding claims and a pharmaceutically acceptable carrier or excipient.

138. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated with a lipid-based delivery vehicle.

139. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated as lipid nanoparticles.

140. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated as a lipid nanocapsule.

141. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated with one or more polymers.

142. A method of treating a patient in need thereof, the method comprising administering to the patient a pharmaceutical composition according to any one of claims 137-141.

143. The method of claim 142, wherein the pharmaceutical composition is administered weekly.

144. The method of claim 142, wherein the pharmaceutical composition is administered monthly.

145. The method of claim 142, wherein the pharmaceutical composition is administered every two months.

146. The method of claim 142, wherein the pharmaceutical composition is administered every six months.

147. The method of claim 142, wherein the pharmaceutical composition is administered annually.

148. A method for treating hypophosphatasia, the method comprising administering to a patient in need thereof a therapeutically effective amount of the isolated circular non-viral DNA vector according to any one of claims 119-125 or a pharmaceutical composition comprising the isolated circular non-viral DNA vector according to any one of claims 119-125.

149. A method for treating, alleviating or preventing the symptoms of hypophosphatasia, the method comprising administering to a patient in need of treatment thereof a therapeutically effective amount of the isolated circular non-viral DNA vector according to any one of claims 119-125 or a pharmaceutical composition comprising the isolated circular non-viral DNA vector according to any one of claims 119-125.

150. Use of the isolated circular non-viral DNA vector according to any one of claims 119-125 in the treatment of hypophosphatasia.

Images