Stress-resistant and growth-promoting Coelastrus sp.B2 and application of stress-resistant and growth-promoting Coelastrus sp.B2

Abstract

The invention discloses a Coelastrus sp.B2 algal strain, which can obviously improve the soil quality, increase the soil nutrient content, enhance the microbial activity and promote the nutrient conversion and utilization. The algal strain also can synthesize a metabolite with plant growth regulation and stress resistance enhancement functions, so that the salt resistance of plants is improved. Meanwhile, insecticidal active metabolites are generated, and natural insect-resistant protection is provided for plants. Besides, the Coelastra sp.B2 increases the abundance of various beneficial microorganisms in the soil, and the microorganisms play an important role in promoting plant growth, enhancing stress resistance, promoting nitrogen absorption, enhancing heavy metal pollution tolerance, participating in pesticide stress response, inhibiting pathogenic bacteria and the like, so that the soil environment is improved, and the healthy growth of plants is promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and specifically discloses a stress-resistant and growth-promoting monostar algae Coelastrella sp. B2 and application thereof. Background Art

[0002] Agriculture is the primary industry in my country and an important prerequisite for the sustainable development of other industries. Developing ecological agriculture, combining agricultural production with ecological environmental protection, and promoting sustainable development of the agricultural economy are the inevitable trends in the development of agricultural production in my country. Among them, biotechnology with agricultural microbial resources as the core is conducive to increasing food production and maintaining environmental ecological health, and also meets the needs of the development of modern ecological agriculture.

[0003] In recent years, my country's agricultural microorganism market has developed rapidly, but the market space is still large. Among them, microalgae is a type of tiny algae group that requires the help of a microscope to distinguish its morphology. It has the characteristics of fast reproduction and strong environmental adaptability. In addition, microalgae cultivation has many advantages and broad application prospects, including no need to occupy arable land; it can use seawater and save fresh water; it can also use livestock and poultry wastewater to manage the environment; it can efficiently utilize CO2 as a resource. Therefore, microalgae is considered to be a treasure trove of new and strategic biological resource development, and it is also a hot research and development direction of the international biotechnology industry. At present, there are relatively few agricultural microalgae species and products, and there is a lot of room for development.

[0004] The Coelastrella sp. species that have been discovered so far are mainly used to remove pollutants such as ammonia nitrogen from wastewater and as raw materials for biodiesel production. In the agricultural field, there are only reports on the tolerance range of NaCl concentration and pH for Coelastrella sp. SDEC-28, and its effect on reducing the conductivity and pH of saline-alkali soil leachate. There is still a lack of reports on Coelastrella sp. species on plant growth and stress resistance, soil nutrients and soil microbial composition, and its metabolites. Summary of the invention

[0005] The present invention aims to solve the problems existing in the prior art and introduces a Coelastrella sp. B2 strain. This strain has multiple benefits: it can significantly improve soil quality, specifically by increasing the organic matter content, alkaline nitrogen, available phosphorus, available potassium, and total nitrogen and total phosphorus levels in the soil, while enhancing soil microbial activity, including increasing microbial biomass carbon and microbial biomass nitrogen, thereby effectively promoting the conversion and utilization of soil nutrients. In addition, the strain can synthesize metabolites with plant growth regulating functions, which can not only directly promote plant growth and development, but also enhance the plant's stress resistance, especially improve its salt resistance. More prominently, Coelastrella sp. B2 can also produce metabolites with insecticidal activity, providing plants with natural insect protection, and is expected to significantly improve the plant's ability to resist insect pests. In addition, the algae strain increased the abundance of microorganisms of the genera Pontibacter, Nitrospira, Archangium, Nocardioides and Actinophytocola of the Actinobacteria in the soil. These microorganisms play an important role in promoting plant growth and enhancing plant stress resistance, or promoting plant nitrogen nutrient absorption, or enhancing plant tolerance to heavy metal pollution and participating in plant response to pesticide stress, or inhibiting plant pathogens, thereby improving the soil environment and promoting healthy plant growth.

[0006] The present invention is achieved through the following technical solutions:

[0007] The present invention discloses Coelastrella sp. B2 isolated from grassland soil in Shijiazhuang City, Hebei Province, China. The algae strain has been preserved in China Center for Type Culture Collection (CCTCC), with a preservation address of Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, a preservation date of December 31, 2024, and a preservation number of CCTCC NO: M20242971.

[0008] The stress-resistant and growth-promoting monostar algae Coelastrella sp. B2 has a colony in the form of dark green protrusions with smooth edges.

[0009] The stress-resistant and growth-promoting Coelastrella sp. B2 has a tufA gene sequence as shown in SEQ ID NO. 1, and belongs to the genus Coelastrella.

[0010] The stress-resistant and growth-promoting monostar algae Coelastrella sp. B2 can regulate soil nutrients and promote the effectiveness of soil nutrients, which is mainly manifested in an increase of 2.72% to 5.81% in soil organic matter, about 10.18% in alkaline nitrogen, 7.19% to 22.26% in available phosphorus, 10.31% to 17.86% in available potassium, 0.70% to 5.12% in total nitrogen, 9.42% to 9.62% in total phosphorus, and about 0.76% to 10.49% in total potassium.

[0011] The stress-resistant growth-promoting monostar algae Coelastrella sp. B2 can promote plant growth and improve plant salt resistance under 8.72g / kg (NaCl / dry soil) salt stress conditions. Taking wheat plants as an example, the main performance is that the aboveground fresh weight increases by 10.81% to 54.05%, the plant height increases by 10.07% to 10.44%, and the malondialdehyde content of the plant (including in the stems and leaves) decreases by 5.72% to 12.45%.

[0012] The stress-resistant and growth-promoting monostellate algae Coelastrella sp. B2 of the present invention can produce a variety of metabolites with obvious biological activities. Specifically:

[0013] The monostar algae can produce a series of metabolites that can be used as plant growth regulators, including diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide, which have obvious regulatory effects on plant growth.

[0014] In addition, the monostar algae can also produce metabolites that promote plant growth or enhance plant stress resistance, such as palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline and L-isoleucine-L-threonine. These metabolites perform well in improving plant growth performance and stress resistance.

[0015] It is worth noting that the stress-resistant and growth-promoting Coelastrella sp. B2 can also produce capsaicin, a metabolite with insecticidal activity, providing new possibilities for the development of biological pesticides.

[0016] At the same time, the present invention also reveals the positive impact of the monostellate algae on the structure of soil microbial communities. Specifically, it can increase the abundance of beneficial microorganisms such as Pontibacter, Nitrospira, Archangium, Nocardioides and Actinophytocola of the Actinobacteria in the soil, thereby improving the soil environment and promoting healthy plant growth.

[0017] Based on the above findings, the present invention further proposes a variety of application solutions:

[0018] A microalgae preparation comprises the above-mentioned stress-resistant and growth-promoting Coelastrella sp. B2 or its extract and culture.

[0019] A microbial fertilizer, comprising at least the stress-resistant and growth-promoting Coelastrella sp. B2, its culture or processed product, or the microalgae preparation, to provide the nutrients required by plants and promote their growth.

[0020] A soil conditioner also comprises the stress-resistant and growth-promoting Coelastrella sp. B2, its culture or processed product, or the microalgae preparation, and is used for improving soil structure and enhancing soil fertility.

[0021] A plant growth regulator comprises the stress-resistant and growth-promoting Coelastrella sp. B2, its culture or processed product, or the microalgae preparation, to precisely regulate the growth process of plants.

[0022] A biostimulant also comprises the stress-resistant and growth-promoting Coelastrella sp. B2, its culture or processed product, or the microalgae preparation, and is used for stimulating the growth and development of plants.

[0023] A biological pesticide is composed of a carrier and an active ingredient, wherein the active ingredient comprises the above-mentioned stress-resistant and growth-promoting monostellate algae Coelastrella sp. B2, a culture or a processed product thereof, and provides a green and environmentally friendly pest control solution for agricultural production.

[0024] In addition, the present invention also proposes the use of the above-mentioned stress-resistant and growth-promoting monostar algae Coelastrella sp. B2, microalgae preparations or microbial fertilizers in the following fields:

[0025] Improve crop stress resistance, especially salt resistance, and help crops maintain healthy growth even in adverse environments;

[0026] Promote crop growth by providing necessary nutrients and bioactive substances to accelerate the growth process of crops;

[0027] Soil improvement creates more favorable environmental conditions for crop growth by improving the soil microbial community structure and increasing soil fertility.

[0028] Finally, the present invention also proposes a corresponding implementation method:

[0029] A method for improving crop stress resistance, promoting crop growth and improving soil, the method comprising adding the stress-resistant and growth-promoting Coelastrella sp. B2, microalgae preparations or microbial fertilizers to the soil where crops are planted.

[0030] A method for preparing a biological pesticide, which is prepared by using the stress-resistant and growth-promoting Coelastrella sp. B2, its culture or processed product, and provides a new technical approach for the production of the biological pesticide.

[0031] The advantages and beneficial effects of the present invention are:

[0032] The stress-resistant and growth-promoting monostar algae Coelastrella sp. B2 of the present invention exhibits many obvious advantages and beneficial effects, which are specifically manifested in the following aspects:

[0033] 1. Soil improvement and nutrient enhancement:

[0034] The monostar algae can significantly increase the content of organic matter, alkaline nitrogen, effective phosphorus and quick-acting potassium in the soil, and at the same time improve the levels of total nitrogen, total phosphorus and total potassium, thereby comprehensively improving the soil nutrient status. By increasing the soil microbial biomass carbon and microbial biomass nitrogen, the present invention promotes the effectiveness of soil nutrients, improves the ability of the soil to provide nutrients to plants, and provides valuable resources and technical support for the development of efficient and environmentally friendly soil improvement technology.

[0035] 2. Enhance plant salt resistance and growth promotion:

[0036] Under high salt stress conditions (such as 8.72g / kg NaCl / dry soil), Coelastrella sp.B2 exhibits excellent stress resistance, which can significantly promote the growth of crops such as wheat, increase aboveground fresh weight and plant height, and reduce the content of malondialdehyde (MDA) in plants, effectively alleviating the damage of salt stress to plants. This characteristic makes this monostellate algae an ideal material for the preparation of microbial agents and biofertilizers, opening up a new path for the development of microalgae-based crop salt resistance and yield increase technology.

[0037] 3. Rich in plant growth regulators:

[0038] Coelastrella sp.B2 can produce a variety of metabolites with plant growth regulating effects, such as diethylene glycol, isophorone, erucic acid amide, hexadecanoic acid, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide; as well as metabolites that can promote plant growth or improve plant stress resistance, including palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, L-isoleucine-L-threonine. These substances play an important role in promoting plant growth and improving plant stress resistance. Especially under salt stress conditions, these metabolites can further enhance the salt resistance of plants, reduce the degree of lipid peroxidation in stem and leaf cell membranes, and protect plants from salt damage.

[0039] 4. Insecticidal activity and insect resistance potential:

[0040] It is worth noting that this monophylla can also produce capsaicin, a metabolite with insecticidal activity, which provides new possibilities for the development of biological pesticides, and is expected to improve the insect resistance of plants, reduce the use of chemical pesticides, and promote sustainable agricultural development.

[0041] 5. Increase the abundance of beneficial microorganisms in the soil:

[0042] The monostellate algae can significantly increase the abundance of a variety of beneficial microorganisms in the soil, including Pontibacter, Nitrospira, Archangium, Nocardioides and Actinophytocola of the Actinobacteria. These microorganisms play a vital role in the soil. They can not only promote plant growth, but also enhance plant stress resistance, such as salt resistance and drought resistance. These microorganisms can also promote the absorption and utilization of nitrogen by plants, improve the nutritional status of plants, and further promote plant growth and development. At the same time, they can also enhance the tolerance of plants to heavy metal pollution and protect plants from environmental pollution.

[0043] 6. Broad application prospects:

[0044] Based on the above advantages and beneficial effects, Coelastrella sp.B2 has shown broad application prospects in many fields such as soil conditioners, microbial fertilizers, plant growth regulators, biostimulants and biopesticides. It not only provides green and environmentally friendly solutions for agricultural production, but also provides rich resources and technical support for the development of new and efficient agricultural biotechnology products.

[0045] In summary, the stress-resistant and growth-promoting Coelastrella sp. B2 described in the present invention has multiple advantages and beneficial effects such as obvious soil improvement, plant growth promotion, stress resistance enhancement and insecticidal activity, which injects new vitality into the sustainable development of modern agriculture.

[0046] Collection Information

[0047] Coelastrella sp.B2, this strain has been deposited, the depository unit: China Center for Type Culture Collection, the deposit address: Wuhan University, Wuhan, China, the deposit date: December 31, 2024, the deposit number: CCTCC NO: M20242971. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 It is a colony observation picture of Coelastrella sp.B2 of the present invention, (a) front side, (b) back side;

[0049] Figure 2 is a phylogenetic tree of the tufA gene sequence of Coelastrella sp. B2 of the present invention;

[0050] Figure 3 This is an observation diagram of the algal cells of Coelastrella sp. B2 of the present invention promoting wheat growth under salt stress conditions;

[0051] Figure 4 This is an observation diagram of the culture supernatant of Coelastrella sp. B2 of the present invention promoting wheat growth under salt stress conditions;

[0052] Figure 5 The invention relates to the effects of algal cells and culture supernatant of Coelastrella sp. B2 on plant height and aboveground fresh weight of wheat under salt stress conditions;

[0053] Figure 6 The invention relates to the effects of algal cells and culture supernatant of Coelastrella sp. B2 on the malondialdehyde (MDA) content of wheat plants under salt stress conditions;

[0054] Figure 7 The effect of the algal cells and culture supernatant of Coelastrella sp. B2 of the present invention on the content of soil organic matter;

[0055] Figure 8 The effect of algal cells and culture supernatant of Coelastrella sp. B2 of the present invention on the content of soil nutrients (alkaline nitrogen, available phosphorus and available potassium);

[0056] Fig. 9 The effect of algal cells and culture supernatant of Coelastrella sp. B2 of the present invention on the content of soil nutrients (total nitrogen, total phosphorus and total potassium);

[0057] Fig.10 The invention relates to the effects of algal cells and culture supernatant of Coelastrella sp. B2 on soil microbial biomass carbon, nitrogen and phosphorus.

[0058] Fig.11 The invention relates to the effects of the algal cells and culture supernatant of Coelastrella sp. B2 on soil microbial species and their abundance.

[0059] For ordinary technicians in this field, other relevant drawings can be obtained based on the above drawings without any creative work. DETAILED DESCRIPTION

[0060] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described below in conjunction with specific embodiments.

[0061] In this document, the terms “stress-resistant and growth-promoting Coelastrella sp. B2”, “Coelastrella sp. B2”, “Coelastrella sp. B2” and “B2” can be used interchangeably.

[0062] Example 1: Isolation, purification and cultivation of Coelastrella sp. B2

[0063] Sample source: grassland soil in Shijiazhuang City, Hebei Province, China.

[0064] Preparation of A&A culture medium: refer to the patent "A growth-promoting Chlamydomonas strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0065] Preparation of BG11 medium: Prepare according to the requirements of BG11 medium (Haibo Biotechnology, catalog number HB8793), sterilize with high-pressure steam, and cool to room temperature.

[0066] Separation and purification steps: refer to the patent "A growth-promoting Chlamydomonas strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0067] Example 2: Identification of Coelastrella sp. B2

[0068] 1) Identification of biological characteristics

[0069] The colonies of Coelastrella sp. B2 on BG11 medium are dark green and protruding, and the edges of the colonies are smooth ( Figure 1 ).

[0070] 2) Systematic classification and identification

[0071] Take an appropriate amount of B2 culture medium into a sterile 2mL centrifuge tube, centrifuge repeatedly, and remove the supernatant until a certain amount of microalgae B2 cells are obtained. Transfer B2 algae cells to The B2 genomic DNA was extracted in the Lysing Matrix E tube provided by the SPIN kit (MPBiomedicals, USA) according to its operating procedures. The tufA gene sequence was amplified using primers tufAF (5'-GGNGCNGCNCAAATGGAYGG-3') and tufAR (5'-CCTTCNCGAATMGCRAAWCGC-3') (Ao Yuan, 2020). The PCR reaction system was 50 μL, which contained 10 μL EasyTaq buffer, 5 μL dNTPs, 0.5 μL primer 18F, 0.5 μL primer 18R, 1.5 μL DNA template, 2 μL Easy Taq DNA polymerase, and finally sterile ultrapure water was added to 50 μL. The PCR reaction procedure was: (i) 95℃3min pre-denaturation; (ii) 35 cycles of 94℃30s denaturation, 56℃30s annealing, 72℃1min extension; (iii) the final extension condition was 72℃7min. The PCR amplification product was submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The tufA gene sequence of B2 obtained by sequencing is shown in the sequence listing as SEQ ID NO.1.

[0072] The tufA gene sequences obtained by sequencing were compared for homology using the NCBI (National Center for Biotechnology Information) database website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed ( Figure 2), the results showed that the tufA gene of Asterarcys B2 formed a relatively stable evolutionary branch (bootstrap value was 78) with the tufA genes of three Asterarcys from Scenedesmaceae, including Scenedesmaceae sp.YH-2023b, Asterarcys sp.GP-2019 and Coelastrellasaipanensis strain KM2-2, and the tufA gene of Coelastrella saipanensis strain KM2-2 was the closest to the evolutionary distance. In addition, the tufA gene sequence of Coelastrella tenuitheca isolate FACHB-2315 (MH176147), Coelastrella sp. QW-2021 strain FACHB-3315 (MW729747) and Coelastrella sp. QW-2021 strain FACHB-3314 (MW729746) has the highest similarity, with similarities of 100%, 97.16% and 97.26%, respectively. Therefore, it is determined that the monostar algae B2 obtained in the present invention is a monostar algae genus (Coelastrella) of the subfamily Coelastroideae of the family Sphaeropleales of the class Chlorophyceae, and it is named Coelastrella sp. B2.

[0073] Example 3: Effects of Coelastrella sp. B2 on wheat growth and salt resistance under salt stress

[0074] The wheat pot experiment was set up with the following treatment groups: negative control (marked as Control), positive control (marked as BG11, its main function is to compare with the culture supernatant to eliminate the influence of the culture medium itself and verify the effectiveness of B2 metabolites), experimental group applied Coelastrella sp. B2 algae cell suspension (marked as B2 (algae cells)) and applied Coelastrella sp. B2 culture supernatant (marked as B2 (supernatant)). The culture solution of Coelastrella sp. B2 was divided into 50 mL sterile centrifuge tubes and centrifuged at 8500 rpm for 40 minutes. Slowly pour the supernatant into a new sterile triangular flask, which is used as the supernatant of Coelastrella sp. B2 culture. After the supernatant was completely removed, the algae cells were resuspended and washed twice with sterile water (centrifuged at 8500rpm for 40min, the supernatant was removed, and this operation was repeated twice), and the algae cells were resuspended with sterile water to serve as the Coelastrella sp. B2 algae cell suspension; the algae cell content in 20mL Coelastrella sp. B2 algae cell suspension was 0.0047g~0.0132g. This experiment included a total of 4 treatment groups, each of which was repeated 3 times to ensure the reliability of the experimental results (see the wheat growth observation diagram for details). Figure 3 and Figure 4 ).

[0075] The experiment used saline-alkali farmland soil that was screened with a 2mm sieve and fully mixed. The salt content of the soil was 0.9g / kg (NaCl / dry soil). The soil was divided into pots according to the standard of 330g of dry soil per pot, and the "Malan No. 1" wheat variety was uniformly planted. 16 wheat seeds were sown in each pot. After the seedlings emerged neatly, the seedlings were thinned out, and finally 6 strong wheat seedlings were retained in each pot.

[0076] The experimental culture conditions were set at a constant temperature of 25 ° C, and a photoperiod of 16 hours of light and 8 hours of darkness was implemented. In the early growth stage of wheat seedlings, sterile water was used for irrigation to maintain their normal growth. When the wheat seedlings grew to the thriving stage, salt stress treatment was implemented, that is, 4g / L NaCl solution was used for irrigation. The watering frequency was adjusted according to soil moisture and plant growth requirements. Watering was once every 1 to 3 days, and the watering was continued until the soil NaCl content reached about 8.72g / kg (NaCl / dry soil) and then the NaCl solution was stopped. Subsequently, 20mL of Coelastrella sp.B2 algae cell suspension and Coelastrella sp.B2 culture supernatant were respectively irrigated into the soil, and a negative control (Control) irrigated with sterile water and a positive control (BG11) irrigated with BG11 medium were used. A total of 5 irrigations were made in this stage to ensure the adequacy of the experimental treatment.

[0077] The experimental results are as follows Figure 3 , Figure 4 , Figure 5 and Figure 6 As shown. Under severe salt stress (8.72g / kg NaCl / dry soil), both the B2 (algae cells) and B2 (supernatant) treatment groups significantly promoted the growth of wheat. Specifically, compared with the negative control (Control), the aboveground fresh weight of wheat treated with B2 (algae cells) increased by 10.81%; and the aboveground fresh weight of wheat treated with B2 (supernatant) increased significantly by 54.05%, and increased by 29.55% compared with the positive control (BG11). In addition, the plant height of wheat treated with B2 (supernatant) also increased significantly, increasing by 10.07% compared with the negative control (Control) and 10.44% compared with the positive control (BG11).

[0078] In summary, the Coelastrella sp. B2 algae cells and the culture supernatant thereof described in the present invention have a significant promoting effect on the growth of wheat under severe salt stress conditions. These promoting effects are mainly reflected in the increase of the above-ground fresh weight and plant height of wheat plants, and the reduction of the malondialdehyde (MDA) content of plants (including stems and leaves), thereby effectively reducing the degree of cell membrane lipid peroxidation of wheat under salt stress conditions and alleviating the damage caused by salt stress to wheat.

[0079] Example 4: Effect of Coelastrella sp. B2 on soil nutrients under salt stress

[0080] Soil samples were collected after wheat harvest in Example 3, and the soil was comprehensively and detailedly tested, including seven nutrient indicators such as organic matter, alkaline nitrogen, available phosphorus, available potassium, total nitrogen, total phosphorus, and total potassium, as well as three microbial biomass indicators such as microbial biomass carbon, microbial biomass nitrogen, and microbial biomass phosphorus, a total of 10 key indicators. The test results are as follows: Figure 7 , Figure 8 , Fig. 9 and Fig.10 The specific improvements are as follows:

[0081] (1) Comprehensive effects under severe salt stress conditions:

[0082] Under severe salt stress (8.72 g / kg NaCl / dry soil), both B2 (algae cells) and B2 (supernatant) treatments significantly increased the content of available nutrients such as organic matter, alkaline nitrogen, available phosphorus and available potassium in the soil, and also increased the total nutrient reserves such as total nitrogen, total phosphorus and total potassium. More importantly, these two treatments also significantly increased soil microbial biomass carbon and microbial biomass nitrogen, indicating that soil microbial activity was enhanced, thereby improving the effectiveness and ability of the soil to provide nutrients for plant growth.

[0083] (2) Comparison with negative control (Control) treatment:

[0084] Compared with the negative control (Control) without any special treatment, the soil organic matter, alkaline nitrogen, available phosphorus, available potassium, total nitrogen and total phosphorus under B2 (algae cell) treatment increased by 5.81%, 10.18%, 22.26%, 17.86%, 5.12% and 9.62%, respectively, showing its comprehensive soil improvement effect. The B2 (supernatant) treatment also showed obvious soil improvement effect, with soil organic matter, available phosphorus, available potassium, total nitrogen, total phosphorus and total potassium increasing by 2.72%, 7.19%, 10.34%, 0.70%, 9.42% and 0.76%, respectively. Although the increase in some indicators was slightly lower than that of the B2 (algae cell) treatment, it also had obvious soil improvement effect. The soil microbial biomass carbon and microbial biomass nitrogen under B2 (algae cells) treatment increased by 38.02% and 4.61%, respectively, and the soil microbial biomass carbon and microbial biomass nitrogen under B2 (supernatant) treatment increased by 38.97% and 72.24%, respectively, which improved the soil's ability to provide nutrients to plants and was beneficial to promoting plant growth.

[0085] (3) Comparison with positive control (BG11):

[0086] In order to further verify the soil improvement effect of B2 (algae cells) and B2 (supernatant), we also compared them with the positive control (BG11). The results showed that compared with the BG11 treatment, the B2 (algae cells) treatment increased the soil organic matter, available potassium, total nitrogen and total potassium by 1.02%, 17.83%, 1.82% and 7.33%, respectively, indicating that it has better performance in these key nutrient indicators. Similarly, the B2 (supernatant) treatment also showed advantages, with its soil available potassium and total potassium increasing by 10.31% and 10.49%, respectively. Although the increase in indicators such as soil organic matter and total nitrogen was not obvious, it showed obvious advantages in potassium supply. The soil microbial biomass carbon under the B2 (algae cell) treatment increased by 32.99%, and the soil microbial biomass carbon and microbial biomass nitrogen under the B2 (supernatant) treatment increased by 33.90% and 19.11%, respectively, which improved the ability of the soil to provide nutrients to plants and was beneficial to promote plant growth.

[0087] Example 5: Determination of metabolites of Coelastrella sp. B2

[0088] Pick a single colony of Coelastrella sp.B2 that grows well on solid BG11 medium and inoculate it into 50mL of autoclaved liquid BG11 medium. Cultivate at 25℃, 160r / min shaker speed, with a photoperiod of 12h light / 12h dark for 14 days to ensure full growth and reproduction of the algae. Subsequently, take an appropriate amount of Coelastrella sp.B2 algae liquid and inoculate it again into 50mL of fresh BG11 liquid medium, and set up 6 repeated experiments to improve the reliability of the data. Continue to cultivate under the same culture conditions (25℃, 160r / min, 12h light / 12h dark) until the algae reaches the predetermined growth stage. Afterwards, collect the supernatant by centrifugation at 8000rpm and 5min. The supernatant is rich in metabolites produced by Coelastrella sp.B2 and is labeled as B2.

[0089] At the same time, in order to conduct a control experiment, 50 mL of BG11 liquid culture medium without inoculation of Coelastrella sp. B2 algae liquid was used, and 6 replicates were set up and cultured under the same culture conditions. The collected supernatant was used as a control sample and marked as Control.

[0090] The B2 and Control supernatant samples collected above were promptly stored in a -80°C refrigerator to maintain their stability. Subsequently, the samples were submitted to Shanghai Paisonno Biotechnology Co., Ltd. for professional metabolomics testing. The metabolomics test results showed that the Coelastrella sp. B2 strain of the present invention can produce a variety of metabolites with biological activity.

[0091] Among them, metabolites such as diethylene glycol, isophorone, erucamide, hexadecanoic acid, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide can be used as plant growth regulators and have a significant promoting effect on plant growth. In addition, metabolites such as palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, L-isoleucine-L-threonine, etc., not only have the effect of promoting plant growth, but also can improve the stress resistance of plants, especially under salt stress conditions, can significantly improve the salt resistance of plants, reduce the degree of plant cell membrane lipid peroxidation in plants such as wheat under salt stress conditions, thereby effectively alleviating the damage caused by salt stress to plants. It is worth mentioning that the algae strain can also produce capsaicin, a metabolite with insecticidal activity. This shows that Coelastrella sp. B2 not only has the potential to promote plant growth and improve plant stress resistance, but also may have application prospects in improving plant insect resistance, providing new biological resources and technical support for sustainable agricultural development.

[0092] Example 6: Effect of Coelastrella sp. B2 on soil microbial composition under salt stress

[0093] The soil samples after wheat harvest in Example 3 were collected by The SPIN kit (MP Biomedicals, USA) was used to extract soil microbial DNA in strict accordance with the operating procedures provided. Subsequently, the extracted soil microbial DNA samples were submitted to Shanghai Paisono Biotechnology Co., Ltd. for amplification and sequencing of bacterial 16S rRNA genes using sequencing technology. The sequencing results are shown in Figure 2. Fig.11 As shown, through comparative analysis, it is found that:

[0094] Compared with Control and BG11 treatments:

[0095] Both the B2 (algae cell) treatment and the B2 (supernatant) treatment significantly increased the abundance of microorganisms such as Pontibacter, Nitrospira and Archangium in the soil. In particular, the B2 (supernatant) treatment also increased the abundance of Nocardioides and Actinophytocola microorganisms in the soil. These microorganisms play an important role in the soil ecosystem. They not only participate in the circulation and transformation of soil nutrients, but also promote plant growth and development by producing various bioactive substances. In addition, these microorganisms also have the ability to decompose and utilize complex organic matter, which may play an important role in promoting plant nitrogen nutrition absorption and enhancing plant stress resistance.

[0096] These microorganisms have shown significant functions and potential in promoting plant growth, enhancing plant stress resistance, promoting plant nitrogen absorption, enhancing plant tolerance to heavy metal pollution, participating in plant responses to pesticide stress, and inhibiting plant pathogens. Their presence and increase in abundance undoubtedly provide strong support for improving the soil environment and promoting healthy plant growth.

[0097] SEQ ID NO:1

[0098] >B2_tufA

[0099] >B2_843bp

[0100] TAAATTAATTGAACTGTTACTTCGATACGGTCTCCAGGCATAGCCATTTTATTTGAATGTT

[0101] CTTCAGCTACTGAAGAAGGGTTTTTCATTTGAATATGACTAAAACTTACGATTTTTCCAG

[0102] TTACATCAGTAGTACGAATGAAGAACTGTGGTTGATATCCAACTAAAAAAGGTGAGTGA

[0103] CGACCACCTTCTTCTTTTGTTAAAACATAAACTTGTGCTTCAAATTTTGTATGCGGAGTAA

[0104] TTGAACCTGGTTTTGCTAAAACCATTCCACGTTCTACATCTTTTTTTGAATACCACGTAA

[0105] AAGTACACCTACATTATCACCAGCCATTGTTTCATCTAATGTTTTTTTGAACATTTCAAGA

[0106] CCTGTTACAACTGTAGATTTTGTATCTTTTAATCCAACAAGTTCAACGTTTTTCACCTACTT

[0107] TTAAAGTTCCTCTTTCAACACGTCCTGTTGCCACAGTTCCACGACCTGTGATAGATAAAA

[0108] CATCTTCAACTGCTAATAAGAAAGGTTTTTCTGTTTCACGATCTGGTGTTGGAATGTATTT

[0109] ATCTACTTGATCCATTAAATCATAGATTTTGTCTACCCATGTATTTTCACCACGTTTAACTG

[0110] AAGGTTTTCAACTAGAGCTTCTAAAGCTAATAAAGCTGATCCACTTACAACTGGAATTT

[0111] CATCTCCTGGAAATTCATATTTATCTAATGTTTCACGAACTTCTAATTCAACTAATTCTAAT

[0112] AATTCAGCATCGTCAACTTGGTCTTCTTTATTTAAGAATACAACCATGTTTGGTACACCTA

[0113] CTTGTTTTGCTAATAAGATGTGTTCTTTTGTTTGGGGCATGGGACCATCTGCA

[0114] The present invention is described above by way of example. It should be noted that, without departing from the core of the present invention, any simple deformation, modification or other equivalent replacement that can be made by those skilled in the art without inventive effort falls within the protection scope of the present invention.

Claims

1. A stress-resistant and growth-promoting monostellate algae Coelastrella sp. B2, characterized in that: It was deposited in the China Center for Type Culture Collection on December 31, 2024, and its deposit number is: CCTCC NO:M 20242971.

2. A microalgae preparation, characterized in that: It comprises the stress-resistant and growth-promoting Coelastrella sp. B2 or its extract or culture thereof according to claim 1.

3. The microalgae preparation according to claim 2, characterized in that: The microalgae preparation is a microbial fertilizer or a soil conditioner or a plant growth regulator or a biostimulant.

4. Use of the stress-resistant and growth-promoting Coelastrella sp. B2 according to claim 1, the microalgae preparation according to claim 2 or claim 3 in improving crop stress resistance, promoting crop growth or improving soil.

5. The use according to claim 4, characterized in that The crop is a gramineous crop, preferably a wheat crop.

6. The use according to claim 4, characterized in that The improving of crop stress resistance is improving crop salt resistance.

7. The use according to claim 4, characterized in that: Add the stress-resistant and growth-promoting Coelastrella sp. B2 of claim 1, the microalgae preparation of claim 2 or claim 3 to the soil for growing crops.

8. A biological pesticide, characterized in that: The active ingredient in the biological pesticide is the stress-resistant and growth-promoting Coelastrella sp. B2 or its extract or culture thereof as described in claim 1.

9. The biopesticide according to claim 8, characterized in that: The biopesticide is prepared by using the stress-resistant and growth-promoting Coelastrella sp. B2 or a culture thereof or a processed product thereof.

10. The biopesticide according to claim 8, characterized in that: The biological pesticide is a biological insecticide.

Images