Bacillus vallismortis LRB-5, biocontrol inoculant, bacterial fertilizer and application of bacillus vallismortis LRB-5

Abstract

The invention relates to the technical field of agricultural microorganisms, and particularly discloses bacillus vallismortis LRB-5, a biocontrol microbial agent, a bacterial fertilizer and application of the bacillus vallismortis LRB-5, the biocontrol microbial agent and the bacterial fertilizer, the bacillus vallismortis LRB-5 is preserved in China General Microbiological Culture Collection Center on January 25, 2018, the preservation number is CGMCC No.15306, and the bacillus vallismortis LRB-5 is classified and named as bacillus vallismortis. The bacillus vallismortis LRB-5 provided by the invention can inhibit the growth of phytopathogen, promote the growth and development of arabidopsis thaliana and apples, and also can alleviate successive cropping obstacles of the apples.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural microorganisms, and specifically relates to a Bacillus vallismortis LRB-5, a biocontrol agent, a bacterial fertilizer and their applications. Background Art

[0002] The apple industry is an important part of China's agricultural economy and plays an important role in industrial structure adjustment, increasing farmers' income and earning foreign exchange through exports. However, due to limited land resources, more than 70% of orchards are facing the problem of aging tree ages and urgently need to be updated. Replanting on the original site of old orchards is inevitable, and apple replant disease (ARD) is very common in this process. ARD can cause problems such as weak tree vigor, poor shoot development, poor root systems, root rot, delayed fruiting and low yields in newly planted apple saplings. Usually, ARD can lead to a 20% - 50% reduction in production, and in severe cases, it may even lead to crop failure. This has brought huge economic losses to fruit farmers and seriously hindered the sustainable development of the apple industry.

[0003] The occurrence of ARD is the result of the combined action of multiple factors, among which soil microbial factors are the main reasons. The roots and residues of previous apple trees carry a large number of soil-borne pathogens, including fungi (such as Rhizoctonia solani, Fusarium spp.), oomycetes (such as Pythium spp. and Phytophthora spp.) and nematodes (such as Pratylenchus spp.), and these pathogens will infect the roots of newly planted apple trees. At the same time, the reduction in the number of beneficial microorganisms leads to an imbalance in the microbial community structure, and harmful microorganisms cannot be effectively inhibited, thus causing root rot and growth retardation, and ultimately affecting the growth and development of the above-ground part. ARD will also cause changes in the physical and chemical properties of the soil, such as nutrient imbalance (especially the excessive consumption of trace elements such as iron, zinc, and manganese), soil compaction, poor air permeability and drainage, and soil acidification, all of which will have a negative impact on root respiration and nutrient absorption. Therefore, it is of great significance to develop an efficient and environmentally friendly prevention and control measure to alleviate apple replant disease.

[0004] Currently, the main methods for preventing and controlling apple replant disease (ARD) include soil improvement (such as deep plowing, adding biochar, reasonable fertilization, adjusting the pH value and chemical fumigation), breeding disease-resistant varieties, and cultivation management (such as rotation, intercropping and mixed cropping), etc. However, these methods have many drawbacks, such as high risk, environmental pollution, long time consumption, high cost, unclear short-term effects, complex operation, etc., and are therefore gradually being phased out. In recent years, biocontrol measures with the addition of beneficial microbial agents have received increasing attention from more and more researchers due to their environmental friendliness and high efficiency. Therefore, it is of great significance to discover new biocontrol bacteria that can prevent soil-borne pathogens for apple cultivation. Summary of the Invention

[0005] To develop a biocontrol bacterium capable of preventing and controlling soil-borne pathogenic bacteria, the present invention provides a strain of Bacillus vallismortis LRB-5, a biocontrol agent, a bacterial fertilizer and their applications. The Bacillus vallismortis LRB-5 provided by the present invention can inhibit the growth of plant pathogenic bacteria, promote the growth and development of Arabidopsis thaliana and apples, and also alleviate the continuous cropping obstacle of apples.

[0006] The present invention provides a Bacillus vallismortis LRB-5, which was deposited at the General Microbiological Center of the China National Center for Culture Collection of Microorganisms on January 25, 2018, with the deposit number CGMCC No. 15306, and the taxonomic name is Bacillus vallismortis.

[0007] The present invention also provides a biocontrol agent containing the above-mentioned Bacillus vallismortis LRB-5.

[0008] Further, the bacterial concentration of Bacillus vallismortis LRB-5 in the biocontrol agent is 1×10 6 CFU·mL -1 ~10×10 9 CFU·mL -1 .

[0009] The present invention also provides an application of the above-mentioned Bacillus vallismortis LRB-5 or the above-mentioned biocontrol agent in inhibiting plant pathogenic bacteria, and the plant pathogenic bacteria are any one or several of Fusarium proliferatum, Fusarium verticillioides, Fusarium solani, Fusarium oxysporum, Alternaria alternata, Rhizoctonia solani, Aspergillus flavus, Albifimbria verrucaria, Penicillium brasilianum, Phoma macrostoma and Phytophthora.

[0010] Further, the Bacillus vallismortis LRB-5 or the biocontrol agent is used to inhibit the mycelial growth and conidia germination of plant pathogenic bacteria.

[0011] The present invention also provides an application of the above-mentioned Bacillus vallismortis LRB-5, the above-mentioned biocontrol agent or the above-mentioned bacterial fertilizer in promoting the growth and development of plants.

[0012] Furthermore, the plants are Arabidopsis thaliana and Malus hupehensis Rehd.

[0013] The present invention also provides an application of the Bacillus vallismortis LRB-5, the biocontrol agent or the bio-fertilizer in alleviating apple replant disorder. The Bacillus vallismortis LRB-5 is used for reducing the content of phenolic acids in soil, increasing the number of beneficial soil microorganisms and enhancing soil enzyme activity.

[0014] Furthermore, the phenolic acids are any one or a combination of several of cinnamic acid, syringic acid, phloridzin, benzoic acid, ferulic acid and p-hydroxybenzoic acid;

[0015] The beneficial soil microorganisms are any one or a combination of bacteria and actinomycetes;

[0016] The soil enzymes are any one or a combination of several of urease, phosphatase, sucrase and catalase.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The present invention firstly isolates a strain of Bacillus vallismortis LRB-5 from the healthy fruit tree roots in a replanted apple orchard. This strain has strong inhibitory effects on Fusarium oxysporum, Fusarium verticillioides, Fusarium proliferatum, Fusarium solani, Alternaria alternata YR9, Rhizoctonia solani, Valsa mali sdau11-175, Aspergillus flavus XW23, Myrothecium verrucaria XW39, Penicillium brasilianum Q9 and Phoma macrostoma HC139. Among them, the antibacterial rates against Fusarium oxysporum, Alternaria alternata YR9 and Valsa mali sdau11-175 are relatively high, reaching 76.00%, 83.26% and 82.30% respectively, and the antibacterial rates against Rhizoctonia solani, Phoma macrostoma HC139, Penicillium brasilianum Q9, Fusarium verticillioides, Fusarium proliferatum and Fusarium solani are also higher than 65%.

[0019] The fermentation broth and supernatant of LRB-5 significantly inhibit the mycelial growth and spore germination of Fusarium, resulting in abnormal mycelial morphology, such as swelling, atrophy and branching. The LRB-5 strain can significantly reduce the ARD disease intensity caused by Fusarium, and the control effect exceeds 50%. In addition, the volatile organic compounds (VOCs) produced by LRB-5 have both antifungal and growth-promoting properties. LRB-5 can secrete a variety of cell wall-degrading enzymes such as pectinase, cellulase, β-1,3-glucanase, protease and chitosanase, and has the abilities of nitrogen fixation, phosphorus solubilization and potassium solubilization. At the same time, it can also produce indole-3-acetic acid (IAA), amylase, ammonia and siderophores.

[0020] The LRB-5 strain can stably colonize in the rhizosphere of Malus hupehensis seedlings, significantly reduce the contents of phenolic acids such as cinnamic acid, syringic acid, phloridzin, benzoic acid, ferulic acid and p-hydroxybenzoic acid in the soil, increase the numbers of soil bacteria and actinomycetes, improve the activities of soil urease, phosphatase, sucrase and catalase, reduce the abundance of Fusarium in the rhizosphere soil, promote the root growth of apple tree plants, and has excellent effects in alleviating apple replant disorder, thus enriching the strain resources for the biological control of apple replant disorder.

[0021] LRB-5 significantly increases the numbers of beneficial soil microorganisms (such as bacteria and actinomycetes), reduces the abundance of Fusarium, and at the same time improves the soil enzyme activities (such as urease, phosphatase, etc.), thereby improving the soil health status. LRB-5 effectively reduces the contents of phenolic acids (such as phloridzin, benzoic acid, etc.) in the rhizosphere soil and alleviates the toxic effects of phenolic acids on apple roots. LRB-5 significantly increases the biomass of apple seedlings, enhances the activities of antioxidant enzymes (such as SOD, CAT, POD), and promotes the healthy growth of plants. Through the multiple functions of the LRB-5 strain, the present invention effectively controls apple replant disorder, optimizes the soil microecology and plant growth environment at the same time, and provides an innovative solution for the sustainable development of the apple industry.

[0022] Description of the preservation information of biological materials

[0023] LRB-5, referred to as Bacillus vallismortis LRB-5 in the present application, was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on January 25, 2018, with the deposit number of CGMCC No. 15306. The address of the depositary institution is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Zip Code: 100101, and the taxonomic name is Bacillus vallismortis. Description of the drawings

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0025] Figure 1 FIG. 1 shows the colony and cell morphological characteristics of the strain LRB-5; in the figure, A shows the colony morphological characteristics of the strain LRB-5; B to I are the cell diagrams of the strain LRB-5 at 100 times, 100 times, 5000 times, 5000 times, 5000 times, 20000 times, 20000 times and 20000 times in sequence.

[0026] Figure 2It is a confrontation test plate of LRB-5 strain and different phytopathogenic fungi. In the figure, the phytopathogenic fungi are respectively A1: Fusarium proliferatum, A2: Fusarium proliferatum MR5 (Fpmd MR5), B1: Fusarium verticillioides, B2: Fusarium verticillioides 32-1-4, C1: Fusarium solani, C2: Fusarium solani Q61, D1: Fusarium oxysporum, D2: Fusarium oxysporum HC131, E: Alternaria alternata YR9, F: Rhizoctonia solani, G: Valsa mali sdau11-175, H: Phoma macrostoma HC139, I: Aspergillus flavus XW23, J: Myrothecium verrucaria XW39, K: Penicillium brasilianum Q9.

[0027] Figure 3 It shows the effects of LRB-5 strain treatment on the mycelial and spore morphology of Fusarium oxysporum. In the figure, A-C: Scanning electron micrographs of the mycelial and spore morphology of Fusarium oxysporum growing normally. D-H: Scanning electron micrographs of the mycelial and spore morphology of Fusarium oxysporum treated with the supernatant of LRB-5.

[0028] Figure 4 It shows the multiple plant growth-promoting activities of strain LRB-5. In the figure, A: Phosphorus solubilization; B: Potassium solubilization; C: Nitrogen fixation; D: Siderophore production; E: Ammonia production; F: Pectinase activity; G: Amylase production; H: Cellulase activity; I: β1,3-glucanase activity; J: Protease activity; K: Chitosanase activity.

[0029] Figure 5 It shows the antifungal volatile activity of strain LRB-5 in the I plate and the dual-chamber.

[0030] In the figure, the first to fifth rows of A are the antifungal volatile activities of strain LRB-5 in the I plate and the dual-chamber against Fusarium proliferatum MR5, Fusarium verticillioides, Fusarium oxysporum HC131, Fusarium solani Q61, and Rhizoctonia solani respectively.

[0031] The first to sixth rows of B are successively the antifungal activities of strain LRB-5 against Phoma macrostoma HC139, Penicillium brasilianum Q9, Aspergillus flavus XW23, Phytophthora, Albifimbria verrucaria XW39, and Alternaria alternata YR9 in the I plate and the double-plate chamber.

[0032] Figure 6 It is the effect of strain LRB-5 on the growth of Arabidopsis thaliana; in the figure, B is the external view of the effect of the fermentation broth of LRB-5 on the growth of Arabidopsis thaliana, C is the parallel experiment of B, and A is the control of B and C; E represents the external view of the effect of the volatile organic compounds produced by adding LRB-5 on the growth of Arabidopsis thaliana, F is the parallel experiment of E, and D is the control group of E and F; G-I respectively represent the effects on the fresh weight, main root length, and number of lateral roots of Arabidopsis thaliana under the treatments of A-F.

[0033] Figure 7 It is the severity of the symptoms of Malus hupehensis seedlings after inoculation with strain LRB-5;

[0034] In the figure, A is the disease intensity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium oxysporum and LRB-5; B is the disease intensity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium verticillioides and LRB-5; C is the disease intensity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium proliferatum MR5 and LRB-5; D is the disease intensity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium proliferatum and LRB-5; E is the disease intensity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium solani and LRB-5; F is the percentage of dead plants of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium and LRB-5; G is the relative control effect of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium and LRB-5; H is the final average symptom severity of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium and LRB-5; I is the incidence of Malus hupehensis seedlings from the 1st to 5th week after inoculation with Fusarium and LRB-5.

[0035] Figure 8Effect of LRB-5 bacterial fertilizer treatment on the root system structure of Malus hupehensis seedlings; in the figure, A shows the effects of soil from a 31-year-old orchard (CK1), soil from a 31-year-old orchard fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the root appearance of Malus hupehensis seedlings, respectively; B shows the effects of soil from a 31-year-old orchard (CK1), soil from a 31-year-old orchard fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the root length of Malus hupehensis seedlings, respectively; C shows the effects of soil from a 31-year-old orchard (CK1), soil from a 31-year-old orchard fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the number of root forks of Malus hupehensis seedlings, respectively; D shows the effects of soil from a 31-year-old orchard (CK1), soil from a 31-year-old orchard fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the root surface area of Malus hupehensis seedlings, respectively; E shows the effects of soil from a 31-year-old orchard (CK1), soil from a 31-year-old orchard fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the number of root tips of Malus hupehensis seedlings, respectively.

[0036] Figure 9Effects of LRB-5 bacterial fertilizer treatment on rhizosphere microorganisms of plants; in the figure, A shows the effects of treatments of 31-year-old orchard soil (CK1), 31-year-old orchard soil fumigated with methyl bromide (CK2), bacterial fertilizer carrier (T1), and LRB-5 bacterial fertilizer (T2) on the number of culturable fungi in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; B shows the effects of the above treatments on the number of culturable actinomycetes in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; C shows the effects of the above treatments on the ratio of bacteria to fungi in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; D shows the effects of the above treatments on the number of culturable bacteria in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; E shows the effects of the above treatments on the total bacterial abundance in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; F shows the effects of the above treatments on the abundance of LRB-5 in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; G shows the effects of the above treatments on the total fungal abundance in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; H shows the effects of the above treatments on the abundance of Fusarium proliferatum MR5 in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; I shows the effects of the above treatments on the abundance of Fusarium proliferatum in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; J shows the effects of the above treatments on the abundance of Fusarium verticillioides in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September;Effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the abundance of Fusarium solani in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; L is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the abundance of Fusarium oxysporum in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September.

[0037] Figure 10 Effect of LRB-5 microbial fertilizer treatment on the phenolic acid content in the rhizosphere soil of plants; in the figure, A is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the benzoic acid content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; B is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the cinnamic acid content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; C is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the ferulic acid content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; D is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the phloridzin content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; E is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the p-hydroxybenzoic acid content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September; F is the effect of treatments of orchard soil with 31-year-old trees (CK1), orchard soil with 31-year-old trees fumigated with methyl bromide (CK2), carrier of microbial fertilizer (T1), and LRB-5 microbial fertilizer (T2) on the syringic acid content in the rhizosphere soil of Malus hupehensis seedlings in July, August, and September. Specific implementation manners

[0038] The specific embodiments of the present invention will be described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0039] Example 1: Isolation and identification of a strain of Bacillus vallismortis LRB-5.

[0040] 1. Isolation and purification of the strain

[0041] The candidate bacteria were isolated by the modified dilution plating method. Rhizosphere soil and roots were collected from healthy apple trees in a continuous cropping orchard (longitude: 120.465274; latitude: 37.606707) in Lutou Town, Longkou City, Shandong Province. The root tissue grinding fluid and soil samples were serially diluted with sterile water, and 100 μL was spread on tryptic soy agar (TSA) plates and cultured at 30 °C for one day. According to the shape, size and color of the colonies, different morphological single colonies were selected and purified on Luria-Bertani (LB) agar by the streaking method. The purified strain was inoculated into a liquid LB medium containing 15% glycerol and stored at -80 °C.

[0042] 2. Screening of the strain

[0043] A co-culture detection system on potato dextrose agar (PDA) was used to evaluate the antifungal activity against fungal pathogens. The isolated strain was inoculated into a 250 mL conical flask containing 100 mL of LB broth and cultured at 30 °C on a shaker at 200 r·min -1 for 48 h. The bacterial culture was centrifuged at 10000 r·min -1 for 20 min to precipitate the bacterial cells. The cells were suspended in 10 mM phosphate buffer (PBS, containing 130 mM sodium chloride, 7 mM disodium hydrogen phosphate and 3 mM sodium dihydrogen phosphate in 1 L, pH 7.4), and the cell density was adjusted to 1×10 8 CFU·mL -1A mycelial block with a diameter of 1.0 cm was cut from the pure culture of each fungal pathogen and transferred to the center of a PDA plate. The bacterial isolates were streaked equidistantly around the PDA plate to form a square around the pathogen, or four sterilized filter papers (diameter 6 mm) were placed equidistantly on the PDA plate to form a square around the pathogen, and 5 μL of the bacterial cell suspension was added dropwise to each filter paper. As a control, a pure culture mycelial block with a diameter of 1.0 cm of each fungal pathogen was placed in the center of the PDA plate for cultivation, and the bacterial isolates or the filter papers with the bacterial cell suspension dropped were replaced with sterile distilled water. All plates were incubated at 28 °C until the mycelium covered the entire surface of the control plate. According to the size of the antibacterial rate, an antagonistic bacterium with the best antibacterial rate against 11 pathogens was obtained and named LRB-5.

[0044] By the method of dilution plating, 52 bacteria were detected from the rhizosphere soil of a continuous cropping orchard in Lutou Town, Longkou City, Shandong Province, and 24 bacteria were detected from the root tissue. After isolation and purification, a plate confrontation experiment was carried out. Among them, 31 bacteria had inhibitory effects on pathogenic fungi and formed inhibition zones around them. Finally, the bacterium LRB-5 with the highest antibacterial rate was determined as the test antagonistic strain ( Figure 1 ).

[0045] 3. Identification of the strain

[0046] (1) Morphological and physiological and biochemical identification: The isolated LRB-5 strain was cultured on LB agar medium at 37 °C for 24 h until single colonies appeared, and its morphological characteristics were observed. Ammonium oxalate crystal violet and malachite green were used to stain bacteria and spores, and a Nikon BX-51 microscope and a Hitachi SU-8010 scanning electron microscope were used to observe the shape and size of the bacteria. The methods described in Bergey's Manual of Systematic Bacteriology (Second Edition) and the Manual of Identification of Common Bacteria were used to evaluate its physiological and biochemical characteristics. Each index was detected 3 times, and the experiment was repeated 2 times.

[0047] As Figure 1 shown in A of, after the LRB-5 strain was cultured on LB agar medium for 24 h, the colonies were light yellow, round or oval in shape, with a dull, dry, rough and opaque surface. The edges of the colonies were neat at first and became irregular later. Figure 1 Shown in B~ Figure 1 I of, this strain is a Gram-positive, aerobic bacterium. The cells are straight rods, with a size of 1.0 μm × 2.5 μm, and the spores are oval, with a size of 0.7 μm × 2.3 μm, located in the middle or proximal part of the cell. Ten physiological and biochemical indexes of the LRB-5 strain were detected, and the results are shown in Table 1.

[0048] Table 1 Physiological and biochemical characteristics of the LRB-5 strain

[0049] Measurement Index Result Measurement Index Result Catalase Test + Gelatin Hydrolysis Test + Starch Hydrolysis Test + Glucose Fermentation Test + Nitrate Reduction Test + Methyl Red Test － Indole Test － V-P Test － Citrate Utilization Test + Malonate Utilization Test － Catalase Test + Sucrose Fermentation Test +

[0050] Note: "+" represents a positive reaction or availability; "-" represents a negative reaction.

[0051] The above results indicate that the strain LRB-5 conforms to the physiological and biochemical characteristics of Bacillus vallismortis.

[0052] (2) Amplification, sequence analysis and phylogenetic analysis of 16S rDNA, gyrA, gyrB and rpoB fragments:

[0053] Inoculate LRB-5 into LB liquid medium and shake culture at 30 °C and 200 rpm for 12 h. Extract genomic DNA using EasyPure Bacteria Genomic DNA Kit (TransGen Biotech Co., Ltd., Beijing, China). To confirm the species classification of LRB-5, the present invention obtained the DNA sequences of 16S ribosomal RNA gene (16S rDNA), DNA gyrase subunit A (gyrA), DNA gyrase subunit B (gyrB) and RNA polymerase subunit B (rpoB). PCR amplification was carried out on an Applied Biosystems 2720 type PCR instrument (Applied Biosystems Inc., USA). After the PCR reaction was completed, 3 μL of the PCR product was taken for 1% agarose gel electrophoresis to confirm the amplified fragment. The PCR product was purified using a DNA gel extraction kit and sequenced on an ABI 3730XL sequencing system (Applied Biosystems Inc., USA). Phylogenetic analysis was carried out according to the sequencing results. The analysis results showed that LRB-5 had the highest homology with Bacillus vallismortis. Therefore, it was identified as Bacillus vallismortis.

[0054] Example 2: Functional identification of Bacillus vallismortis LRB-5.

[0055] The microbial information used in this example is as follows:

[0056] Fusarium proliferatum A1, Fusarium verticillioides B1, Fusarium solani C1, and Fusarium oxysporum D1 are all preserved in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University. The above strains are publicly recorded in the following thesis: Wang Gongshuai. Analysis of the fungal community structure in continuous cropping soil in the Bohai Rim region and the study on the alleviation of apple continuous cropping obstacles by intercropping with scallions [D]. Shandong Agricultural University, 2018. Fusarium verticillioides 32-1-4 (B2) was provided by Teacher Yu Jinfeng from the College of Plant Protection, Shandong Agricultural University, and is now preserved in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University. This strain is publicly recorded in the following thesis: Liu Zhi. Isolation, identification of pathogenic fungi of apple replant disease in the Bohai Bay region and screening of biocontrol Trichoderma strains [D]. Shandong Agricultural University, 2013. Valsa mali sdau11-175 was provided by Teacher Liu Huixiang from the College of Plant Protection, Shandong Agricultural University. Referring to the graduation thesis, this strain is publicly recorded in the following thesis: Wang Yilin. Functional analysis of the genes VmSom1, VM1G06657, VM1G07354, and VM1G11970 of Valsa mali [D]. Shandong Agricultural University, 2019., and is now preserved in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University.

[0057] Fusarium proliferatum MR5 (Fpmd MR5) A2, Fusarium solani Q61 (C2), Fusarium oxysporum HC131 (D2), Alternaria alternata YR9, Aspergillus flavus XW23, Albifimbria verrucaria XW39, Penicillium brasilianum Q9, Phoma macrostoma HC139 are all preserved in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University. The above strains are publicly recorded in the following thesis: Duan Yanan. Identification, pathogenic mechanism and prevention and control of specialized pathogens of apple continuous cropping obstacles [D]. Shandong Agricultural University, 2022.

[0058] Rhizoctonia solani was purchased from the Agricultural Product Preservation Center for Cucumber Fusarium Wilt in China, with the preservation number ACCC 36076, and is now stored in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University. Phytophthora was purchased from the China Center for Type Culture Collection of Agricultural Microorganisms, with the preservation number: ACCC 36421, and is now stored in the Fruit Tree Biology Laboratory of the College of Horticultural Science and Engineering, Shandong Agricultural University.

[0059] I. Antibacterial Activity of Bacillus vallismortis LRB-5

[0060] 1. Preparation of LRB-5 Fermentation Broth and LRB-5 Supernatant

[0061] Inoculate LRB-5 into a 250 mL conical flask containing 100 mL of LB liquid medium, and culture it on a rotary shaker at 30 °C and 200 rpm for 48 h to obtain LRB-5 fermentation broth, with a bacterial concentration of 1×10 8 CFU·mL -1 , for later use.

[0062] Centrifuge the LRB-5 fermentation broth at 10,000 rpm for 15 min at 4 °C, and then filter it through a 0.22 μm Nylon66 membrane filter to collect the sterile supernatant, obtaining LRB-5 supernatant, for later use.

[0063] 2. Inhibitory Effect of LRB-5 on the Growth of Phytopathogens

[0064] A co-culture detection system on potato dextrose agar (PDA) was used to evaluate the antifungal activity against fungal pathogens. Centrifuge the LRB-5 fermentation broth at a speed of 10000 r·min -1 for 20 min to precipitate the bacterial cells. Suspend the bacterial cells in 10 mM phosphate buffer (containing 130 mM sodium chloride, 7 mM disodium hydrogen phosphate and 3 mM sodium dihydrogen phosphate in 1 L PBS, pH 7.4), and adjust the cell density to 1×10 8 CFU·mL -1 , obtaining a bacterial cell suspension, for later use.

[0065] A mycelial plug with a diameter of 1.0 cm was cut from a pure culture of each fungal pathogen and transferred to the center of a PDA plate. The bacterial isolates were streaked equidistantly around the PDA plate to form a square around the pathogen, or four sterilized filter papers (6 mm in diameter) were placed equidistantly on the PDA plate to form a square around the pathogen, and 5 μL of the bacterial cell suspension was added dropwise to each filter paper. As a control, a pure culture mycelial plug with a diameter of 1.0 cm of each fungal pathogen was placed in the center of a PDA plate for cultivation, and the bacterial isolates or filter papers with the bacterial cell suspension added were replaced with sterile distilled water. All plates were incubated at 28 °C until the mycelium covered the entire surface of the control plate. The diameter of the fungal colony was measured using the cross method with a vernier caliper, and the size of the inhibitory rate was expressed as the diameter. The above operations were repeated 3 times.

[0066] The LRB-5 supernatant was added to warm potato dextrose agar (PDA) medium (55 °C) to a final concentration between 0.1% and 1.5%. PDA plates without the culture filtrate were used as controls. Fungal mycelial plugs with a diameter of 10 mm were placed in the center of the medium supplemented with the filtrate and then incubated at 25 °C until the fungal growth in the negative control covered the entire surface of the plate. The diameter of the fungal colony was measured using the cross method with a vernier caliper, and the size of the inhibitory rate was expressed as the diameter. The above operations were repeated 3 times.

[0067] Inhibitory rate = [(control colony diameter - treated colony diameter) / control colony diameter] × 100%.

[0068] The results of the confrontation test are as Figure 2 shown in Table 2. The LRB-5 strain showed broad-spectrum antagonistic activity against a variety of fungal pathogens. Among them, the inhibitory rates against Fusarium oxysporum, Alternaria alternata YR9, and Valsa mali sdau11-175 were relatively high, reaching 76.00%, 83.26%, and 82.30% respectively, and the inhibitory rates against Rhizoctonia solani, Phoma macrostoma HC139, Penicillium brasilianum Q9, Fusarium verticillioides, Fusarium proliferatum, and Fusarium solani were also higher than 65%. With the increase in the concentration of the LRB-5 supernatant, the inhibitory effect on the growth of plant pathogens was more significant. At a concentration of 15 mL·L -1 , the inhibitory rates against a variety of fungal pathogens exceeded 60% (Table 3).

[0069] Table 2 Antifungal activity of the LRB-5 strain against plant pathogens

[0070] Fungi Colony Diameter (cm) Inhibition Zone (mm) Inhibition Rate (%) Fusarium proliferatum (A1) 1.47±0.02b +++ 67.33±0.38e Fusarium verticillioides (B1) 1.23±0.01d +++ 72.67±0.22c Fusarium solani (C1) 1.18±0.03d +++ 73.78±0.59c Fusarium oxysporum (D1) 1.08±0.06e +++ 76.00±1.24b Fusarium proliferatum MR5 (A2) 1.47±0.01b +++ 67.26±0.13e Fusarium verticillioides 32-1-4 (B2) 1.54±0.02b +++ 65.85±0.47e Fusarium solani Q61 (C2) 1.24±0.03d +++ 72.30±0.71c Fusarium oxysporum HC131 (D2) 1.24±0.03d ++ 72.37±0.71c Alternaria alternata YR9 0.75±0.07f +++ 83.26±1.48a Rhizoctonia solani 1.37±0.04c ++ 69.63±0.93d Valsa mali sdau11-175 0.80±0.02f +++ 82.30±0.46a Aspergillus flavus XW23 2.55±0.05a + 43.33±1.02f Myrothecium verrucaria XW39 0.50±0.10g +++ 33.33±2.22g Penicillium brasilianum Q9 1.34±0.05c ++ 70.07±1.12d Phoma macrostoma HC139 1.24±0.03d +++ 72.37±0.56c

[0071] Note: -, no inhibition zone; +, inhibition zone diameter < 5 mm, weak inhibition, fungi stop growing at the bacterial edge line; ++, inhibition zone diameter 5 mm - 10 mm, moderate inhibition; +++, inhibition zone > 10 mm, strong inhibition.

[0072] Table 3 Inhibitory effect of LRB-5 supernatant at different concentrations on the growth of fungal hyphae

[0073]

[0074]

[0075] Note: "-" indicates that the diameter of the fungus cannot be measured.

[0076] 3. Inhibitory effect of LRB-5 on the growth of Fusarium hyphae

[0077] Pour PDA into a sterile petri dish. After it solidifies, place a sterile glass slide in the center of the plate. Apply about 200 μL of PDA on the glass slide and place a 1.0 cm diameter Fusarium hyphal block on the PDA. Place one Oxford cup at each end of the glass slide. Add 200 μL of LRB-5 supernatant to one Oxford cup as the treatment group, and add an equal volume of sterile distilled water to the other Oxford cup as the control group. After culturing for 3 days, pick the hyphae at the edge of the inhibition zone with an inoculation needle and place them in a sterile centrifuge tube containing 2.5% glutaraldehyde fixative for 24 h. Sample the control group in the same way and send the samples to Keshang Biotechnology Co., Ltd. for scanning electron microscope observation.

[0078] The test results show that the LRB-5 fermentation broth can significantly inhibit the growth of Fusarium oxysporum hyphae. The hyphae in the control group are uniform in thickness, slender, with few branches, plump spores, complete structure and healthy appearance ( Figure 3 from A to Figure 3 C). However, the hyphae treated with LRB-5 supernatant show irregular reticulation, uneven thickness, atrophy, distortion, swelling, thinning, breakage and overflow of cell contents, and the spore cell wall also deforms ( Figure 3 from D to Figure 3 H).

[0079] 4. Inhibitory effect of LRB-5 fermentation broth and LRB-5 supernatant on the germination of Fusarium conidia

[0080] Fusarium is cultured in BVC medium (1 vitamin B tablet [containing 3 mg vitamin B 1 , 1.5 mg vitamin B 2 , 0.2 mg vitamin B 6 , 10 mg nicotinamide, 2 mg calcium pantothenate], 0.1 g vitamin C, KH 2 PO4 1 g of KNO 3 (1 g of KNO₃, 0.5 g of sucrose, 20 g of agar, 1.0 L of distilled water, pH 7.0) and cultured at 28 °C for 7 days. A spore suspension was prepared by adding 2.5 mL of sterile distilled water to the plate culture. The agar surface was gently scraped with a sterile inoculation loop to release conidia, and the liquid was transferred to a sterile 10 mL centrifuge tube and mixed well. The conidia concentration was adjusted to 10 6 conidia·mL -1 to obtain a conidial suspension.

[0081] The LRB-5 fermentation broth or LRB-5 supernatant was respectively mixed with the conidial suspension at a ratio of 1:1 (V / V) on a concave slide. A mixture of the conidial suspension and sterile water was used as a control group (Control 1), and a negative control was set, that is, the spore suspension was mixed with the fermentation broth of non-antagonistic Bacillus (Control 2). The slides were cultured under humid conditions at 28 °C for 24 h, and the spore germination rate was determined by observing with a Nikon BX-51 microscope. If the length of the germ tube was equal to or more than half of the spore diameter, it was determined that the spore germinated. More than 200 spores were observed for each sample, and three replicate samples were set for each treatment, and the experiment was repeated twice.

[0082] Table 4 Inhibitory effect of LRB-5 fermentation broth or LRB-5 supernatant on the germination of Fusarium conidia

[0083]

[0084] The test results are shown in Table 4. Microscopic observation of spore germination showed that after treatment with the LRB-5 fermentation broth or LRB-5 supernatant, the germination of conidia was inhibited, but its shape did not change compared with the control group. After 24 h of culture, up to 95% of the conidia in the control group (Control 1) and the fermentation broth control group inoculated with non-biological control Bacillus (Control 2) produced germ tubes, while after treatment with the LRB-5 fermentation broth or LRB-5 supernatant, about 60% of the conidia failed to germinate.

[0085] II. LRB-5 Produces Cell Wall Degrading Enzymes and Plant Growth Promoting Substances

[0086] The strain LRB-5 was spot-inoculated onto Pikovskaya (PVK) medium, and a clear halo was visible around the colony, indicating phosphate solubilization; the strain LRB-5 was spot-inoculated onto potassium feldspar (PF) solid medium, and a clear halo was visible around the colony, indicating potassium solubilization; the strain LRB-5 was spot-inoculated onto nitrogen-free Ashby medium, and a clear halo was visible around the colony, indicating nitrogen fixation; the strain LRB-5 was spot-inoculated onto CAS agar medium, and a yellow-to-orange halo formed around the bacterial growth, indicating siderophore production; the strain LRB-5 was inoculated into a liquid culture tube containing 10 mL of 4% peptone culture solution and cultured at 28 °C for 7 days. After adding Nessler's reagent, a yellow-to-brown color reaction of the solution indicated ammonia production; the strain LRB-5 was spot-inoculated onto Difco nutrient agar medium, and after the plate was stained with iodine solution, a yellow area appeared around the colony, while the other parts of the medium showed blue, indicating amylase production; the strain LRB-5 was spot-inoculated onto cellulase detection medium, and a clear halo was visible around the colony, indicating cellulase production; the strain LRB-5 was spot-inoculated onto pectinase detection medium, and after soaking with 1% iodine solution, a clear area around the colony was observed, indicating pectinase production; the strain LRB-5 was spot-inoculated onto skim milk powder medium, and a clear halo was visible around the colony, indicating protease activity; the strain LRB-5 was spot-inoculated onto β-1,3-glucanase detection medium, and a clear halo was visible around the colony, indicating β-1,3-glucanase production; the strain LRB-5 was spot-inoculated onto chitosanase detection medium, and a clear halo was visible around the colony, indicating chitosanase production. Each treatment was repeated 3 times.

[0087] Take 5.0 mL of the LRB-5 supernatant, add 8 μL of the internal standard stock solution (20 ng·mL -1 D-IAA), extract twice with dichloromethane solution, centrifuge at 10,000 g for 5 min, and collect the upper layer liquid. The upper layer liquid was dried under nitrogen, dissolved in 400 μL of methanol, filtered through a 0.22 μm organic phase filter membrane, and stored in a -20 °C refrigerator for analysis. HPLC-MS / MS detection was performed using an Agilent 1290 high-performance liquid chromatography system (Agilent Technologies, USA) and an AB SCIEX 6500 Qtrap (AB SCIEX, USA). Separation was carried out using a Poroshell 120 SB-C18 chromatographic column (150 mm × 2.1 mm, 2.7 μm), and the mobile phase consisted of water containing 0.02% formic acid (A) and acetonitrile containing 0.02% formic acid (B). The column flow rate was maintained at 0.3 mL·min -1, with a running time of 15 min, using biphasic gradient elution: initially 5% B for 1 min, rising to 50% B at 8 min, then linearly increasing to 95% B at 15 min, maintaining for 4 min and re-equilibrating to the initial chromatographic conditions within 2 min. The column temperature was maintained at 30 °C. The mass spectrometry parameters were set as follows: curtain gas 15 psi, spray voltage +5500 V (positive ion mode) and -5000 V (negative ion mode), nebulizer gas pressure 65 psi, auxiliary gas pressure 70 psi, nebulizer temperature 300 °C. Signals were automatically identified and integrated according to the standard retention time (RT) values and manually checked to ensure the accuracy of software integration. Subsequently, the peak areas of the compounds were normalized to the peak areas of their corresponding internal standards (IS).

[0088] The test results are as Figure 4 shown. LRB-5 has multiple plant growth-promoting (PGP) characteristics, including phosphorus solubilization and potassium release ability, nitrogen fixation ability, indole-3-acetic acid (IAA) production ability (21.60 μg·mL -1 ; standard curve: y = 1.62406x + 0.00712, R 2 = 0.99473), ACC deaminase production ability, ammonia and amylase production ability, siderophore production ability, cell wall degrading enzyme (cellulase, pectinase, β-1,3-glucanase and protease) production ability.

[0089] III. Volatile organic compounds produced by LRB-5 can significantly inhibit the growth of hyphae and promote the growth of plant roots

[0090] (1) Volatile organic compounds produced by LRB-5 can significantly inhibit the growth of plant pathogen hyphae

[0091] Prepare type I plates. One side is PDA, inoculated with pathogen blocks (5 mm in diameter), and the other side is LB, inoculated with LRB-5, then sealed with Parafilm. Alternatively, place the LB agar plate inoculated with LRB-5 and the PDA plate inoculated with pathogen blocks (5 mm in diameter) face to face. The average distance between the surface of LB agar and PDA is 1.5 cm. Incubate the double-dish system and type I plates at 28 °C until the fungus completely covers the surface of the control plate. Use the double-dish system and type I plates without inoculated strains as controls, and repeat the experiment three times.

[0092] The test results are as Figure 5 shown. Volatile organic compounds produced by strain LRB-5 significantly inhibited the growth of plant pathogen hyphae, and the hyphae in the control group grew normally.

[0093] (2) Volatile organic compounds produced by LRB-5 can significantly promote the growth of Arabidopsis roots

[0094] Surface-sterilize Arabidopsis thaliana Col-0 seeds in 70% (v / v) ethanol for 30 s, then soak them in sodium hypochlorite solution (1% available chlorine) for 5 min, and finally rinse them six times with sterile water. Place the seeds in a Petri dish containing 0.5×Murashige and Skoog (MS) medium, keep them at 4 °C for 3 days, and then germinate them for 2 days. Transfer the seedlings to a 90-mm-diameter Petri dish containing 0.5×MS, 0.8% sucrose, and 1% Bacto agar. Pre-culture the LRB-5 sample in a 60-mm-diameter Petri dish containing MS, 0.5% TSB, and 2% Bacto agar at 30 °C for 24 h. Then place the two Petri dishes containing the seedlings and the strain in a 150-mm-diameter Petri dish, seal it with Parafilm, and place it vertically in a growth chamber at 22 °C with a light cycle of 16 h light / 8 h dark. Centrifuge the LRB-5 fermentation broth at 4000 g for 10 min, then redissolve it in 10 mM magnesium sulfate solution and adjust the OD 600 to 0.5. Drop 10 μL of the solution onto the root tips of Arabidopsis thaliana, using sterile distilled water as a control. Repeat each treatment three times. After culturing for 7 days, measure the fresh weight of the plants, the length of the primary root, and the number of lateral roots.

[0095] The test results showed that the volatile organic compounds produced by strain LRB-5 and the LRB-5 fermentation broth significantly promoted the growth of Arabidopsis thaliana ( Figure 6 ). Compared with the control, the length of the primary root of the volatile organic compounds was 1.57 times higher. The fresh weight of the plants treated with the LRB-5 fermentation broth increased by 167.31%, and the number of lateral roots increased by 62.5 times.

[0096] Example 3: Effect of strain LRB-5 on Malus hupehensis Rehd.

[0097] I. Test method

[0098] 1. Greenhouse pot experiment design

[0099] Immerse the bare root systems of the plants in different Fusarium conidial suspensions (Fusarium proliferatum, Fusarium verticillioides, Fusarium solani, Fusarium oxysporum, Fusarium proliferatum MR5) (10 6 conidia·mL -1 ) for 30 min as the positive control. Then transplant the plants into AC140 pots filled with a soil mixture (vermiculite / soil, 2:3, v / v) and inoculate them with the LRB-5 fermentation broth (1×10 8 CFU·mL -1)As the experimental group. Plants not inoculated with Fusarium but treated with LRB-5 served as the negative control. The plants were grown under a photoperiod of 28 °C, 16 h light / 8 h dark and watered according to the needs of plant growth and disease development. One Malus hupehensis Rehd. seedling was planted in each pot, and all the pots were randomly arranged. Each treatment was replicated three times, with 30 pots in each replication. Starting from 1 week after inoculation, the disease severity was evaluated for 5 consecutive weeks. The wilting symptoms were scored from 0 to 4 according to the established criteria: 0: healthy plants or plants without symptoms; 1: 1% - 33% of the plant tissues were affected by chlorosis, leaf and shoot necrosis or defoliation; 2: 34% - 66% of the tissues were affected; 3: 67% - 100% of the tissues were affected; 4: plant death. The percentage of dead plants (PDP) was calculated to estimate the severity of wilting and the ability of plants in different treatment groups to recover from the disease. According to the formula AUDPC = [(t / 2×(S 2 +2×S 3 +···+2S i-1 +S i )) / 4×n]×100, the area under the disease progress curve (AUDPC) of each treatment was evaluated, where t was the number of days between observations, S 2 , S 3 , ···, 2S i-1 , S i : were the disease severities (disease intensities) at the 2nd, 3rd, …, (i - 1)th, and ith surveys respectively, 4 was the maximum disease grade, and n was the number of observations. The formula for the final mean symptom severity (FMS) was FMS = ∑(N i ×X i ) / n i , where N i was the number of symptomatic plants, X i was the symptom score value, and n i was the number of diseased plants. The formula for the disease intensity (DI) based on wilting symptoms was DI(%) = 100×∑(N i ×X i ) / (30×4), where N i was the number of symptomatic plants, X i was the symptom score value, 30 was the total number of plants, and 4 was the maximum disease grade. The relative control effect (%) = (DICK - DIT) / DICK×100. The incidence rate (%) = the number of diseased plants / the total number of plants×100. To verify Koch's postulates, the fungus was re-isolated from the discolored fibrous roots of the seedlings, and each isolate was identified to the genus level.

[0100] The test results showed that two weeks after inoculation with Fusarium, the positive control plants exhibited typical wilting symptoms. Similar symptoms were also observed in the plants treated with LRB-5, but the severity was significantly reduced (Figure 7 )。The disease severity index of the positive control reached 4.00 in the second week, while the disease progression of the plants treated with LRB-5 slowed down significantly. Analyses of the relative AUDPC, incidence, FMS, DI, and PDP showed that LRB-5 significantly alleviated the wilting symptoms. In the fifth week, the relative control efficacy of the plant seedlings inoculated with LRB-5 stabilized at approximately 50 - 60%. Throughout the test period, LRB-5 protected the plants from Fusarium. The disease phenotypes of the plants were consistent with the typical symptoms of Fusarium infection. At the end of the experiment, Fusarium was successfully re-isolated from the inoculated plants, completing the verification of Koch's postulates.

[0101] 2. Outdoor Pot Experiment Design

[0102] (1) Test materials: The soil was collected from an apple orchard with a 31-year-old tree in Manzhuang Town, Tai'an City, China (longitude: 117.081039, latitude: 36.06682). Using the five-point sampling method, soil samples were collected at a distance of 80 cm from the tree trunk and 20 - 40 cm from the ground surface. The physical and chemical properties of the tested soil were sandy loam, with an organic matter content of 1.35 g / kg, nitrate nitrogen of 6.18 mg / kg, ammonium nitrogen of 1.68 mg / kg, available potassium of 53.13 mg / kg, available phosphorus of 10.57 mg / kg, soil pH of 6.00, and soil moisture content of 15.49%.

[0103] The microbial fertilizer was produced by Chuangdi Microbial Resources Co., Ltd. (Dezhou, China). The carrier of the microbial fertilizer was composed of cow dung and straw in a mass ratio of 3:1.

[0104] The fermentation broth of LRB-5 strain was inoculated into the microbial fertilizer carrier matrix at an inoculation amount of 10% (i.e., 10 mL of LRB-5 fermentation broth was inoculated per 100 g of microbial fertilizer carrier), and fermented at 37°C for one week to obtain LRB-5 microbial fertilizer. The prepared LRB-5 microbial fertilizer was a black-gray powdery solid, with a bacterial density of 2.1×10 9 CFU·g -1 . The available nitrogen content was 0.37 mg·g -1 , the available phosphorus content was 1.46 mg·kg -1 , and the available potassium content was 1.01 mg·kg -1 .

[0105] The pot experiment was conducted from May to September 2017 at the National Apple Engineering Research Center and the Apple Replanting and Microorganism Laboratory on the South Campus of Shandong Agricultural University. The test plants for the pot experiment were seedlings of Malus hupeheusis Rehd. The seeds of Malus hupeheusis Rehd. were stratified at 4°C for about 30 days, and after the seeds showed white tips, they were sown in cultivation pots filled with seedling substrate for seedling cultivation. When the seedlings grew to 6 true leaves, plants with consistent growth and no pests and diseases were selected for transplantation. In May, the Malus hupeheusis Rehd. seedlings were transplanted into terracotta pots (38 cm × 28 cm × 26 cm) filled with 75.43 kg of soil. Two seedlings were planted in each pot, and there were 20 pots for each treatment. The potting soil was divided into the following four treatments: orchard soil with a 31-year-old tree age (CK1), orchard soil with a 31-year-old tree age fumigated with methyl bromide (CK2), microbial fertilizer carrier (T1), and LRB-5 microbial fertilizer (T2). The application rates of LRB-5 microbial fertilizer and the microbial fertilizer carrier accounted for about 1% of the soil weight. The plants were managed with normal watering and fertilization, and samples were taken from each treatment on July 15, August 15, and September 15, 2017. Three pots were randomly selected from each treatment, and the surface soil and the soil in contact with the flower pot were removed. The seedlings were gently taken out of the pots, and after shaking off the large pieces of soil, the rhizosphere soil was collected for the determination of experimental indicators. The soil impurities were removed using a 2 mm sieve, and the soil samples were stored in three sealed bags respectively. One bag was stored in a 4°C refrigerator for the determination of soil microorganisms; one bag was air-dried for the determination of phenolic acid content; one bag was stored in an -80°C refrigerator for DNA extraction and real-time quantitative PCR (qPCR) analysis.

[0106] (2) Determination indicators: The plant height, ground diameter, and dry and fresh weights of the seedlings were measured using a tape measure, vernier caliper, and electronic balance respectively.

[0107] The roots were scanned using an Epson Perfection V850 Pro scanner. The sample images were analyzed and processed using the professional version of WinRHIZO (2007 version) root analysis system, and the total root length, surface area, number of forks, and number of root tips were recorded.

[0108] The plate count dilution method was used to evaluate the soil microbial populations (bacteria, fungi, and actinomycetes). Bacteria, fungi, and actinomycetes were cultured in nutrient broth peptone medium, potato dextrose agar (PDA, Difco), and Gao's No. 1 medium respectively. Five dilutions of plates were measured for each parameter of each soil sample. The CFU per gram of dry soil was used as the measurement unit for the populations of bacteria, fungi, and actinomycetes.

[0109] Determination of soil phenolic acid content: Pass 100 g of dry soil sample through a 12-mesh sieve, mix it with diatomaceous earth, and put it into a 100 mL extraction tank. Use an ASE 350 accelerated solvent extractor (Dionex, USA) for extraction. First, use anhydrous ethanol as the extraction solvent, statically extract for 5 min at 120 °C and 10.3 MPa, cycle twice, the rinse volume is 60%, and the rinse time is 90 s. Then, use methanol as the extraction solvent and extract the same sample again under the same conditions. After extraction, mix the two solvents and concentrate them under reduced pressure to nearly dry at 34 °C, then redissolve with 1 mL of methanol and filter through a 0.22 μm organic phase filter membrane. Use an UltiMate 3000 HPLC system (Dionex, USA) for quantitative analysis, adopt an Acclaim 120 C18 chromatographic column (3 μm, 150 mm × 3 mm), and the column temperature is 30 °C. Mobile phase A is acetonitrile, and mobile phase B is water (adjust the pH to 2.6 with acetic acid). The flow rate is 0.5 mL·min -1 , the automatic injection volume is 5 μL, and the detection wavelength is 280 nm. All reagents are of chromatographic grade.

[0110] Determination of root activity, root enzyme and soil enzyme activities: Place the root tissues of all treatments in an incubator with ice for detection. Select the root tip or white root system from each treatment of each family to measure the antioxidant enzyme activity. Use a kit from Suzhou Keming Biotechnology Co., Ltd. (Suzhou, China) to measure the activities of superoxide dismutase (SOD), peroxidase (POD), catalase (CAT) and the content of malondialdehyde (MDA) in the roots, as well as the activities of solid urease (S-UE), acid phosphatase (S-ACP), solid sucrase (S-SC) and solid catalase (S-CAT) in the soil.

[0111] Real-time quantitative PCR (qPCR) analysis: 5 g of rhizosphere soil samples were taken, and DNA was extracted using the PowerMax Soil DNA Isolation Kit (Qiagen, Germany). The quality and quantity of DNA were determined using an Eppendorf BioPhotometer nucleic acid and protein analyzer (Eppendorf, Germany). Quantitative PCR (qPCR) was used to quantitatively analyze total bacteria, fungi, Fusarium, and biocontrol bacterium LRB-5 (Bacillus velezensis) in rhizosphere soil samples. The abundances of bacteria and fungi were measured using Eub338F / Eub518R (Eub338F: ACTCCTACGGGAGGCAGCAG; Eub518R: ATTACCGCGGCTGCTGG) and ITS1f / 5.8s (ITS1f: TCCGTAGGTGAACCTGCGG; 5.8s: CGCTGCGTTCTTCATCG) primers on a CFX96 Touch real-time fluorescence quantitative PCR detection system (Bio-Rad, USA). Standard curves were generated by 10-fold serial dilution of plasmids containing full-length copies of the Escherichia coli 16S rRNA gene and the Saccharomyces cerevisiae 18S rRNA gene. The abundance of Fusarium was detected using the SYBR Green method, with primers JR / JF (JF: GAACGCGAATTAACGCGAGTC, JR: CATACCACTTGTTGTCTCGGC), CHR / CHF (CHF: GGGGTTTAACGGCGTGGCC, CHR: GACTCGCGAGTCAAATCGCGT), CR / CF (CF: CGCCGCGTACCAGTTGCGAGGGT, CR: GATCGGCGAGCCCTTGCGGCAAG), FR / FF (FF: GGCCTGAGGGTTGTAATG, FR: CGAGTTATACAACTCATCAACC), and MR5R / MR5F (MR5-F: CCGCCAGAGGACCCCTAAACTC; MR5-R: CGATGCCAGAACCAAGAGATCCG; Y = -3.182x + 14.120, R 2 = 0.999), targeting the internal transcribed spacer (ITS) of rRNA. For the biocontrol bacterium LRB-5, group-specific primers BaF and BaR were designed based on comparison with other Bacillus genomes in GenBank (F: ACTTAAGAAACCGCCTGCGA; R: CACACTGGGACTGAGACAC; Y = -2.861x + 10.94, R2 = 0.998) was used for qPCR detection. The standard curve was generated by 10-fold serial dilution of plasmid DNA containing the genomic fragment of Bacillus vallismortis. The amplification specificity was confirmed by melting curve analysis and gel electrophoresis. The copy number of the target gene was calculated according to the standard curve. Each sample was analyzed in triplicate, and the results were expressed as log 10 value (target copy number g -1 soil).

[0112] II. Experimental Results

[0113] (1) Growth-promoting effect of LRB-5 biofertilizer treatment on Malus hupehensis seedlings

[0114] Table 5 Effects of LRB-5 biofertilizer on the biomass of Malus hupehensis seedlings

[0115]

[0116] Note: Different lowercase letters indicate significant differences at the p < 0.05 level. Values are mean ± standard deviation (n = 3).

[0117] As can be seen from Table 5, in July, August, and September, the biomass indexes of the LRB-5 biofertilizer treatment (T2) were significantly higher than those of the old orchard soil (CK1) and the biofertilizer carrier treatment (T1). In September, the plant height, ground diameter, fresh weight, and dry weight of T2 were 1.63 times, 1.39 times, 1.54 times, and 2.37 times higher than those of T1, and 1.87 times, 1.63 times, 2.85 times, and 5.64 times higher than those of CK1, respectively. The treatment effect of LRB-5 was better than that of the chemical fumigant.

[0118] (2) Effects of LRB-5 biofertilizer treatment on the root growth of Malus hupehensis seedlings

[0119] Table 6 Effects of LRB-5 biofertilizer on the activities of root protective enzymes and root vigor

[0120]

[0121]

[0122] Note: Different lowercase letters indicate significant differences at the p < 0.05 level. Values are mean ± standard deviation (n = 3).

[0123] From Figure 8As can be seen from Table 6, the application of LRB-5 bacterial fertilizer (T2) significantly promoted the growth of the roots of Malus hupehensis seedlings, and this difference became significant in September. Compared with the bacterial fertilizer carrier treatment (T1), the root length, surface area, number of root tips, number of forks and root activity of T2 increased by 27.11%, 80.48%, 93.22%, 90.60% and 28.50% respectively; compared with the old orchard soil (CK1), they increased by 72.78%, 142.948%, 425.09%, 165.67% and 48.08% respectively. From July to September, the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in all treatments increased (Table 6). In September, the activities of SOD, POD and CAT in T2 increased by 24.80%, 13.85% and 35.83% respectively compared with T1, and increased by 48.86%, 49.49% and 41.35% respectively compared with CK1. The content of malondialdehyde (MDA) showed the opposite trend: compared with T1, the MDA content in T2 decreased by 23.77%, 30.59% and 38.01% in July, August and September respectively.

[0124] (3) Effects of LRB-5 bacterial fertilizer treatment on microorganisms in soil

[0125] It can be seen from Figure 9 that after the treatment with LRB-5 bacterial fertilizer (T2), the numbers of soil bacteria and actinomycetes increased significantly in July, August and September, while the number of soil fungi decreased significantly. In September, the number of soil bacteria in T2 was 3.04 times higher than that in T1 and 9.22 times higher than that in the old orchard soil (CK1). Compared with CK1, the numbers of soil fungi in methyl bromide fumigation (CK2) and LRB-5 bacterial fertilizer (T2) decreased by 81.82% and 70.00% respectively. From July to September, the soil bacteria / fungi ratio in T2 was significantly higher than that in other treatments. The qPCR results showed that compared with the old orchard soil (CK1), methyl bromide fumigation (CK2) and LRB-5 bacterial fertilizer (T2) significantly reduced the abundance of Fusarium in July, August and September. In September, the abundances of Fusarium proliferatum, Fusarium verticillioides, Fusarium oxysporum, Fusarium solani and Fusarium proliferatum MR5 (Fpmd MR5) in T2 were 9.56%, 7.83%, 3.58%, 2.98% and 5.58% lower than those in CK1 respectively. The quantitative analysis of the total bacterial and fungal communities showed that the number of bacteria detected in T2 was significantly more than that in CK1, while the number of fungi was significantly less than that in CK1 in July, August and September. The abundance of Bacillus vallismortis LRB-5 remained relatively stable in the rhizosphere soil from July to September.

[0126] (4) Effect of LRB-5 Bacterial Fertilizer Treatment on Soil Phenolic Acid Content

[0127] As Figure 10 It can be seen that in July, August, and September, the soil phenolic acid contents (cinnamic acid, phloridzin, benzoic acid, ferulic acid, p-hydroxybenzoic acid, syringic acid) in the old orchard soil (CK1) and the soil of the bacterial fertilizer carrier treatment (T1) were the highest. In September, the contents of cinnamic acid, phloridzin, benzoic acid, ferulic acid, p-hydroxybenzoic acid, and syringic acid in the soil of LRB-5 bacterial fertilizer (T2) were 55.65%, 58.41%, 62.58%, 75.69%, 71.10%, and 63.62% lower than those of CK1, respectively.

[0128] (5) Effect of LRB-5 Bacterial Fertilizer Treatment on Soil Enzyme Activity

[0129] Table 7 Effect of LRB-5 Bacterial Fertilizer on Rhizosphere Soil Enzyme Activity

[0130]

[0131] Note: Different lowercase letters indicate significant differences at the p<0.05 level. The values are the mean ± standard deviation (n = 3).

[0132] It can be seen from Table 7 that from July to September, the activities of catalase, acid phosphatase, sucrase, and urease in T2, T1, and CK2 increased significantly. In July, August, and September, the urease activity of T2 was 1.37 times, 1.53 times, and 1.57 times higher than that of T1, respectively; the acid phosphatase activity was 1.03 times, 1.05 times, and 1.19 times higher, respectively; the sucrase activity was 1.06 times, 1.17 times, and 1.33 times higher, respectively; and the catalase activity was 1.10 times, 1.17 times, and 1.19 times higher, respectively. In September, the activities of catalase, acid phosphatase, sucrase, and urease in T2 increased by 32.89%, 33.84%, 62.06%, and 168.95% compared with those of CK1, respectively.

[0133] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they learn the basic creative concepts.

[0134] Obviously, those skilled in the art can make various changes and deformations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and deformations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these modifications and deformations.

Claims

1. A Bacillus vallismortis LRB-5, characterized in that The Bacillus vallismortis LRB-5 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on January 25, 2018, with a deposit number of CGMCC No.15306 and a classification name of Bacillus vallismortis.

2. A biocontrol agent containing the Bacillus subtilis LRB-5 according to claim 1.

3. The biocontrol agent containing Bacillus dysvalbardi LRB-5 according to claim 2, characterized in that: The bacterial concentration of Bacillus sp. LRB-5 in the biocontrol agent is 1×10 6 CFU·mL -1 ~10×10 9 CFU·mL -1 .

4. A bacterial fertilizer containing the Bacillus dysvalley LRB-5 according to claim 1, characterized in that: The bacterial density in the bacterial fertilizer is 2.1×10 9 CFU·g -1 ~3×10 9 CFU·g -1 .

5. Use of the Bacillus dysvalbarii LRB-5 according to claim 1 or the biocontrol agent according to any one of claims 2 to 3 in inhibiting plant pathogens, characterized in that: The plant pathogenic bacteria is any one or more of Fusarium proliferatum, Fusarium verticillioides, Fusarium solani, Fusarium oxysporum, Alternaria alternata, Rhizoctonia solani, Aspergillus flavus, Albifimbriaverrucaria, Penicillium brasilianum, Phoma macrostoma and Phytophthora.

6. The use according to claim 5, characterized in that: The Bacillus dysvalleyi LRB-5 or the biocontrol agent is used for inhibiting the mycelial growth and conidia germination of plant pathogens.

7. Use of the Bacillus dysvalbarii LRB-5 according to claim 1, the biocontrol agent according to any one of claims 2 to 3, or the bacterial fertilizer according to claim 4 in promoting plant growth and development.

8. The use according to claim 7, characterized in that: The plants are Arabidopsis thaliana and Camellia sinensis.

9. Use of the Bacillus dysvalbarii LRB-5 of claim 1, the biocontrol agent of any one of claims 2 to 3, or the bacterial fertilizer of claim 4 in alleviating the obstacle of continuous cropping of apples, characterized in that: The Bacillus dysvalbardi LRB-5 is used to reduce the content of phenolic acid substances in the soil, increase the number of beneficial microorganisms in the soil and improve the activity of soil enzymes.

10. The use according to claim 9, characterized in that: The phenolic acid substance is any one or a combination of cinnamic acid, syringic acid, phloridzin, benzoic acid, ferulic acid and p-hydroxybenzoic acid; Beneficial soil microorganisms are any one of bacteria and actinomycetes or a combination of the two; The soil enzyme is any one of urease, phosphatase, sucrase and catalase or a combination of several of them.

Images