Salt-resistant growth-promoting chlorella strain Chlorella sorokiniana K2 and application thereof

Abstract

The invention discloses a strain of chlorella sorokiniana K2, which can be used for improving soil nutrients, promoting plant growth and enhancing the stress resistance and insect resistance of plants. The algal strain can increase the content of soil organic matters, nitrogen, phosphorus, potassium and other nutrients, increase microbial biomass nutrients and optimize the soil environment. Meanwhile, metabolites generated by the strain can be used as a plant growth regulator, so that plant growth is promoted, cell membrane damage is reduced, and the salt resistance of plants is improved. In addition, the algal strain can also generate metabolites with insecticidal activity, and provides additional insect-resistant protection for plants. Due to the characteristics, the Chlorella sorokiniana K2 has a wide application prospect in the fields of agriculture and ecology.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and specifically discloses a salt-resistant growth-promoting chlorella Chlorella sorokiniana K2 and application thereof. Background Art

[0002] Microalgae is a group of tiny algae that can only be identified under a microscope, with fast photosynthesis, fast reproduction, strong environmental adaptability, and cell metabolism that produces fats, proteins, pigments, and polysaccharides. Due to its efficient photosynthesis and rich nutritional value, it is widely used in many industries such as food, nutrition, biomedicine, aquatic products, feed, environmental protection, and bioenergy. It is believed to have great potential to solve major practical challenges such as the lack of healthy food, the intensification of the greenhouse effect, ecological environmental pollution, and energy crisis. In contrast, the research and application of microalgae in the agricultural field is relatively lagging behind.

[0003] At present, the research on the sorokiniana species of Chlorella mainly includes the application of its metabolites such as oils, polysaccharides, proteins and lutein in the fields of food, feed and biomass energy, as well as its application in the purification of livestock and poultry wastewater. In the agricultural field, there is still a lack of research and application on the effects of sorokiniana species and their metabolites on plant growth and stress resistance, as well as soil nutrients. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a strain of Chlorella sorokiniana K2, which can increase soil organic matter, alkaline nitrogen, available phosphorus and available potassium, as well as total nitrogen, total phosphorus and total potassium, improve soil microbial biomass carbon and microbial biomass nitrogen, and thus promote the effectiveness of soil nutrients. At the same time, the algae strain can produce metabolites that can be used as plant growth regulators, as well as metabolites that have the effect of promoting plant growth or improving plant stress resistance, thereby promoting plant growth, reducing cell membrane lipid peroxidation and cell damage, and improving plant salt resistance. In addition, the algae strain can produce metabolites that can be used as insecticides, thereby having the potential to improve plant insect resistance.

[0005] The present invention is achieved through the following technical solutions:

[0006] The present invention discloses the following relevant information about Chlorella sorokiniana K2 isolated from grassland soil in Shijiazhuang City, Hebei Province, China:

[0007] The Chlorella has been preserved in the China Center for Type Culture Collection (CCTCC). The preservation address is Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The specific preservation date is January 8, 2025, and the preservation number is CCTCC NO:M 2025065.

[0008] The characteristics of salt-resistant growth-promoting Chlorella sorokiniana K2 are described as follows:

[0009] The colony is dark green and protruding with smooth edges. The tufA gene sequence of the Chlorella vulgaris has been determined, as shown in SEQ ID NO.1, and it belongs to the species Chlorella sorokiniana.

[0010] The specific data on soil nutrient conditioning and promoting plant growth are as follows:

[0011] Salt-resistant and growth-promoting Chlorella sorokiniana K2 can significantly regulate soil nutrients and promote the effectiveness of soil nutrients. Specifically, the soil organic matter content can increase by 0.70% to 5.48%, the alkaline nitrogen content increases by about 9.81%, the effective phosphorus content increases by 37.78% to 140.03%, the quick-acting potassium content increases by 10.99% to 14.56%, the total nitrogen content increases by 0.11% to 0.66%, the total phosphorus content increases by 3.52% to 7.59%, and the total potassium content increases by 1.18% to 10.94%.

[0012] Under the salt stress condition of 8.72g / kg (NaCl / dry soil), the chlorella can promote plant growth and improve plant salt resistance. Taking wheat plants as an example, the aboveground fresh weight can increase by 6.82% to 40.54%, the plant height increases by 5.56% to 7.16%, the malondialdehyde (MDA) content in the leaves decreases by 8.01% to 23.11%, and the peroxidase (POD) content in the stems and / or leaves increases by 15.30% to 68.00%.

[0013] Detailed information on metabolites is as follows:

[0014] The chlorella can produce a variety of metabolites that can be used as plant growth regulators, including but not limited to diethylene glycol, isophorone, erucamide, hexadecylamide, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide.

[0015] At the same time, it can also produce metabolites that promote plant growth or improve plant stress resistance, such as palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamate, L-glutamate, phenylalanine-tyrosine, phenylalanine-glutamate, L-threonine, leucine, proline, L-isoleucine-L-threonine, etc.

[0016] In addition, the chlorella can produce capsaicin, a metabolite that can be used as an insecticide.

[0017] The application and preparation method based on the above-mentioned Chlorella are described as follows:

[0018] The present invention provides a microalgae preparation comprising the salt-resistant growth-promoting chlorella Chlorella sorokiniana K2.

[0019] Meanwhile, a microbial fertilizer is also proposed, which comprises the above-mentioned Chlorella, a culture thereof or a processed product thereof, or the above-mentioned microalgae preparation.

[0020] In addition, a soil conditioner, a plant growth regulator and a biostimulant are also proposed, and these products all contain the above-mentioned Chlorella, its culture or processed product, or the above-mentioned microalgae preparation.

[0021] The present invention also provides a biological pesticide, which comprises a carrier and an active ingredient, wherein the active ingredient comprises the above-mentioned Chlorella, a culture thereof or a processed product thereof.

[0022] In terms of application, the present invention proposes the use of the above-mentioned Chlorella, microalgae preparations or microbial fertilizers in improving crop stress resistance (especially salt resistance), promoting crop growth and improving soil.

[0023] The present invention also proposes a method for improving crop stress resistance, promoting crop growth and improving soil, which comprises adding the above-mentioned Chlorella, microalgae preparation or microbial fertilizer to the soil where crops are planted.

[0024] Finally, the present invention also provides a method for preparing a biological pesticide, which is prepared by using the above-mentioned salt-resistant growth-promoting chlorella Chlorella sorokiniana K2, its culture or its processed product.

[0025] The salt-resistant growth-promoting Chlorella sorokiniana K2 of the present invention has the following core advantages and beneficial effects:

[0026] 1. Significantly improve soil nutrients:

[0027] This chlorella can significantly increase the content of organic matter, alkaline nitrogen, available phosphorus and quick-acting potassium in the soil, while increasing the levels of total nitrogen, total phosphorus and total potassium. In addition, it can also increase soil microbial biomass carbon and microbial biomass nitrogen, effectively promoting the effectiveness of soil nutrients. This characteristic allows Chlorella sorokiniana K2 to be used as a highly efficient soil conditioner, significantly improving the ability of the soil to provide nutrients to plants, and providing valuable resources and technical support for the development of soil improvement technology based on chlorella organisms.

[0028] 2. Enhance plant salt resistance and growth:

[0029] Under salt stress conditions of 8.72g / kg (NaCl / dry soil), Chlorella sorokiniana K2 showed an excellent ability to promote plant growth and improve plant salt resistance. Specifically, the aboveground fresh weight and plant height of wheat increased significantly, the malondialdehyde (MDA) content in the leaves decreased, and the peroxidase (POD) content in the stems and / or leaves increased. These effects make the Chlorella very suitable for the preparation of microbial agents and biofertilizers, providing strong resources and technical support for the development of crop salt resistance and yield increase technology based on Chlorella organisms.

[0030] 3. Produce a variety of beneficial metabolites:

[0031] Chlorella sorokiniana K2 can produce a variety of metabolites with different functions. These include diethylene glycol, isophorone, erucamide, hexadecanoic acid, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide, which can be used as plant growth regulators; and palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, L-isoleucine-L-threonine, etc., which have the effect of promoting plant growth or improving plant stress resistance. These metabolites not only help promote plant growth, but also improve the salt resistance of plants under salt stress conditions, reduce the degree of peroxidation of leaf cell membrane lipids in plants such as wheat under salt stress, and effectively alleviate the damage of salt stress to plants.

[0032] 4. Potential insect resistance:

[0033] In addition, Chlorella sorokiniana K2 can also produce a metabolite called capsaicin, which can be used as an insecticide, giving the algae strain the potential to improve plant resistance to insects. This discovery provides new resource support for the preparation of biological pesticides, further broadening their application prospects in the agricultural field.

[0034] Collection Information

[0035] Chlorella sorokiniana K2, the strain has been deposited, the depository unit: China Center for Type Culture Collection, the deposit address: Wuhan University, Wuhan, China, the deposit date: January 8, 2025, the deposit number: CCTCCNO: M 2025065. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 It is a colony observation diagram of Chlorella sorokiniana K2 of the present invention, (a) front side, (b) back side;

[0037] Figure 2 is a phylogenetic tree of the tufA gene sequence of Chlorella sorokiniana K2 of the present invention;

[0038] Figure 3 This is an observation diagram of the algae cells of Chlorella sorokiniana K2 of the present invention promoting wheat growth under salt stress conditions;

[0039] Figure 4 This is an observation diagram showing that the culture supernatant of Chlorella sorokiniana K2 of the present invention promotes wheat growth under salt stress conditions;

[0040] Figure 5 The invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on plant height and aboveground fresh weight of wheat under salt stress conditions;

[0041] Figure 6 The invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on the content of malondialdehyde (MDA) in wheat leaves under salt stress conditions;

[0042] Figure 7 The invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 of the present invention on the content of peroxidase (POD) in wheat stems and leaves under salt stress conditions;

[0043] Figure 8 The effect of algal cells and culture supernatant of Chlorella sorokiniana K2 of the present invention on soil organic matter content;

[0044] Fig. 9The effect of the algae cells and culture supernatant of Chlorella sorokiniana K2 of the present invention on the content of soil nutrients (alkaline nitrogen, available phosphorus and available potassium);

[0045] Fig.10 The effect of algal cells and culture supernatant of Chlorella sorokiniana K2 of the present invention on the content of soil nutrients (total nitrogen, total phosphorus and total potassium);

[0046] Fig.11 The present invention relates to the effects of algal cells and culture supernatant of Chlorella sorokiniana K2 on soil microbial biomass carbon and microbial biomass nitrogen.

[0047] For ordinary technicians in this field, other relevant drawings can be obtained based on the above drawings without any creative work. DETAILED DESCRIPTION

[0048] In order to enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention is further described below in conjunction with specific embodiments.

[0049] As used herein, the terms “salt-resistant growth-promoting Chlorella sorokiniana K2”, “Chlorella sorokiniana K2”, “Chlorella sorokiniana K2” and “K2” are interchangeable.

[0050] Example 1: Isolation, purification and cultivation of salt-resistant growth-promoting Chlorella sorokiniana K2

[0051] Sample source: saline-alkali soil in Haixing County, Cangzhou City, Hebei Province, China.

[0052] Preparation of A&A culture medium: refer to the patent "A growth-promoting Chlamydomonas strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0053] Preparation of BG11 medium: Prepare according to the requirements of BG11 medium (Haibo Biotechnology, catalog number HB8793), sterilize with high-pressure steam, and cool to room temperature.

[0054] Separation and purification steps: refer to the patent "A growth-promoting Chlamydomonas strain m9v and its application", China, patent number: ZL201811554750.8; authorization date: 2022.4.19.

[0055] Example 2: Identification of salt-resistant growth-promoting Chlorella sorokiniana K2

[0056] 1) Identification of biological characteristics

[0057] The colonies of salt-resistant growth-promoting Chlorella sorokiniana K2 on BG11 medium are dark green and protruding, and the edges of the colonies are smooth ( Figure 1 ).

[0058] 2) Systematic classification and identification

[0059] Take an appropriate amount of Chlorella K2 culture medium into a sterile 2mL centrifuge tube, centrifuge repeatedly, and remove the supernatant until a certain amount of Chlorella K2 algae cells are obtained. Transfer Chlorella K2 algae cells to FastDNA ○R The genomic DNA of Chlorella K2 was extracted in the Lysing Matrix E tube provided by the SPIN kit (MP Biomedicals, USA) according to its operation steps. The tufA gene sequence was amplified using primers tufAF (5'-GGNGCNGCNCAAATGGAYGG-3') and tufAR (5'-CCTTCNCGAATMGCRAAWCGC-3') (Ao Yuan, 2020). The PCR reaction system was 50 μL, which contained 10 μL EasyTaq buffer, 5 μL dNTPs, 0.5 μL primer 18F, 0.5 μL primer 18R, 1.5 μL DNA template, 2 μL Easy Taq DNA polymerase, and finally sterile ultrapure water was added to 50 μL. The PCR reaction procedure was: (i) 95°C for 3 min pre-denaturation; (ii) 35 cycles of 94°C for 30 s denaturation, 56°C for 30 s annealing, and 72°C for 1 min extension; (iii) the final extension condition was 72°C for 7 min. The PCR amplification product was submitted to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and the sequence of the tufA gene of microalgae K2 obtained by sequencing is shown in the sequence table SEQ ID NO.1.

[0060] The tufA gene sequences obtained by sequencing were compared with each other through the NCBI (National Center for Biotechnology Information) database website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed. The results showed that the tufA gene of microalgae K2 and the tufA gene sequence from Chlorella sorokiniana SLA-04 were 98.79% similar, and formed a stable evolutionary branch (bootstrap value of 90) ( Figure 2). Therefore, the microalgae K2 obtained in the present invention was determined to be the sorokiniana species of the genus Chlorella of the phylum Chlorella, and was named Chlorella sorokiniana K2.

[0061] Example 3: Effects of Chlorella sorokiniana K2 on wheat growth and salt resistance under 8.72 g / kg (NaCl / dry soil) salt stress

[0062] Wheat pot experiment:

[0063] Negative control (expressed as Control) and positive control (expressed as BG11) were set up, among which the positive control was mainly used to compare with the culture supernatant to exclude the effect of the culture medium, thereby proving the effect of K2 metabolites. The experimental groups were respectively applied with Chlorella sorokiniana K2 algae cell suspension (expressed as K2 (algae cells)) and Chlorella sorokiniana K2 culture supernatant (expressed as K2 (supernatant)). The Chlorella sorokiniana K2 culture solution was divided into 50mL sterile centrifuge tubes and centrifuged at 8500rpm for 40min. The supernatant was slowly poured into a new sterile triangular flask, which was used as the Chlorella sorokiniana K2 culture supernatant. After the supernatant was completely removed, the algae cells were resuspended and washed twice with sterile water (centrifuged at 8500rpm for 40min, the supernatant was removed, and this operation was repeated twice), and the algae cells were resuspended with sterile water, which was used as the Chlorella sorokiniana K2 algae cell suspension. There were 4 treatment groups in total, and each treatment group was repeated 3 times. Figure 3 and Figure 4 (Show wheat growth observation chart).

[0064] The experiment used saline-alkali farmland soil that was sieved through a 2mm sieve and fully mixed. The soil salt content was 0.9g / kg (NaCl / dry soil). Each pot was filled with 330g of dry soil and planted with "Malan No. 1" wheat. 16 seeds were sown in each pot. After the seedlings emerged neatly, thinning was carried out, and 6 wheat seedlings were finally retained in each pot.

[0065] The culture conditions were set at a constant temperature of 25°C, and the photoperiod was 16h light / 8h dark. In the early stage of the experiment, sterile water was used for irrigation. After the wheat seedlings grew vigorously, 4g / LNaCl solution was used for salt stress treatment. Watering was performed every 1 to 3 days, and watering was continued until the soil NaCl content reached about 8.72g / kg (NaCl / dry soil), and then the use of NaCl solution for watering was stopped. During this period, 20mL of Chlorella sorokiniana K2 algal cells and Chlorella sorokiniana K2 culture supernatant were respectively irrigated into the soil. At the same time, the negative control treatment continued to be irrigated with sterile water, and the positive control treatment continued to be irrigated with BG11 culture medium. This watering process was carried out a total of 5 times.

[0066] The experimental results are as follows Figure 3 , Figure 4 , Figure 5 , Figure 6 and Figure 7 As shown:

[0067] Under severe salt stress (8.72 g / kg NaCl / dry soil), both K2 (algae cells) and K2 (supernatant) treatments significantly promoted wheat growth. They can reduce cell membrane lipid peroxidation and cell damage, protect cells from salt stress, and thus improve wheat's salt resistance.

[0068] The specific data are as follows: the aboveground fresh weight of wheat treated with K2 (algae cells) increased by 27.03% compared with the Control treatment and by 6.82% compared with the BG11 treatment; the plant height of K2 (algae cells) treatment increased by 5.56% compared with the Control treatment and by 5.92% compared with the BG11 treatment. The aboveground fresh weight of wheat treated with K2 (supernatant) increased by 40.54% compared with the Control treatment and by 18.18% compared with the BG11 treatment; the plant height of wheat treated with K2 (supernatant) increased by 6.80% compared with the Control treatment and by 7.16% compared with the BG11 treatment.

[0069] In addition, the malondialdehyde (MDA) content in wheat leaves treated with K2 (algae cells) decreased by 10.21% compared with the Control treatment; and decreased by 8.01% compared with the BG11 treatment. The malondialdehyde (MDA) content in wheat leaves treated with K2 (supernatant) decreased by 23.11% compared with the Control treatment; and decreased by 21.24% compared with the BG11 treatment. At the same time, the peroxidase (POD) content in wheat stems treated with K2 (supernatant) increased by 68.00% compared with the Control treatment; at the same time, the peroxidase (POD) content in leaves increased by 15.30% compared with the Control treatment and increased by 52.11% compared with the BG11 treatment.

[0070] In summary, the Chlorella sorokiniana K2 algae cells and supernatant of the present invention have a significant promoting effect on the growth of wheat under severe salt stress (8.72g / kgNaCl / dry soil). These promoting effects are specifically manifested in the increase of aboveground fresh weight and plant height of wheat plants, the decrease of malondialdehyde (MDA) content in leaves ( Figure 6 ), and an increase in the peroxidase (POD) content in the stems and / or leaves ( Figure 7 ). The reduction of malondialdehyde (MDA) content ( Figure 6 ) indicates that the degree of lipid peroxidation in wheat cell membranes is reduced, and cell membrane damage is reduced, which is beneficial to maintaining the integrity and fluidity of cell membranes and ensuring that cell membranes participate normally in material transport, signal transmission and other functions. The increase in peroxidase (POD) content ( Figure 7 ), which helps to reduce the level of reactive oxygen in cells, avoid oxidative damage to cells caused by reactive oxygen accumulation, and enhance the function of wheat's own antioxidant defense system. These changes together protect the integrity and biological activity of wheat stem and / or leaf cells under salt stress conditions, effectively alleviating the damage of salt stress to wheat.

[0071] Example 4: Effect of Chlorella sorokiniana K2 on soil nutrients under severe salt stress

[0072] Soil samples were collected after the wheat pot experiment in Example 3 was completed, and 9 indicators including soil organic matter, alkaline nitrogen, available phosphorus, available potassium, total nitrogen, total phosphorus, total potassium, microbial biomass carbon and microbial biomass nitrogen were determined. The results confirmed the positive effects of K2 (algae cells) and K2 (supernatant) on soil nutrients.

[0073] Under severe salt stress (8.72 g / kg NaCl / dry soil), a comprehensive nutrient analysis was performed on the soil samples collected. Figure 8 , Fig. 9 , Fig.10 and Fig.11 The specific findings are as follows:

[0074] Effects of K2 (algae cells) and K2 (supernatant) on soil nutrients:

[0075] Both significantly increased the content of organic matter, alkaline nitrogen, available phosphorus and available potassium in the soil, while also increasing the levels of total nitrogen, total phosphorus and total potassium. In addition, they also increased the soil's microbial biomass carbon and microbial biomass nitrogen, further improving the soil's effectiveness in providing nutrients for plant growth.

[0076] Comparison with Control processing:

[0077] K2 (algae cells) treatment increased soil organic matter, available phosphorus, available potassium, total nitrogen, total phosphorus and total potassium by 2.99%, 140.03%, 11.02%, 0.66%, 7.59% and 1.18% respectively; meanwhile, K2 (algae cells) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 47.35% and 55.63% respectively.

[0078] The K2 (supernatant) treatment increased soil organic matter, alkaline nitrogen, available phosphorus, available potassium, total nitrogen and total phosphorus by 5.48%, 9.81%, 121.03%, 14.56%, 0.11% and 3.52%, respectively; at the same time, the K2 (supernatant) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 23.43% and 38.78%, respectively.

[0079] Comparison with BG11 treatment:

[0080] Compared with the BG11 treatment, the soil treated with K2 (algae cells) increased available phosphorus, available potassium and total potassium by 49.63%, 10.99% and 10.94%, respectively. At the same time, the K2 (algae cells) treatment increased soil microbial biomass carbon and microbial biomass nitrogen by 41.98% and 7.62%, respectively.

[0081] K2 (supernatant) treatment increased soil organic matter, available phosphorus and available potassium by 0.70%, 37.78% and 14.53% respectively; at the same time, K2 (supernatant) treatment increased soil microbial biomass carbon by 18.93%.

[0082] These measurement results clearly demonstrated the positive effects of K2 (algae cells) and K2 (supernatant) on soil nutrients under severe salt stress conditions, providing a more favorable soil environment for the growth of crops such as wheat.

[0083] Example 5: Determination of metabolites of Chlorella sorokiniana K2

[0084] First, a single colony of Chlorella sorokiniana K2 was picked from the solid BG11 medium and inoculated into 50 mL of liquid BG11 medium. The culture was shaken at 160 r / min at a constant temperature of 25°C and provided with a photoperiod of 12 h light and 12 h dark for 14 days.

[0085] Subsequently, an appropriate amount of the above-cultured Chlorella sorokiniana K2 algae solution was taken and inoculated again into 50 mL of BG11 liquid culture medium, and 6 repeated experiments were set up to ensure the accuracy of the results. Under the same culture conditions (25°C, 160r / min, 12h light / 12h dark), the culture was continued for the required time. Afterwards, the supernatant was collected by centrifugation (8000rpm, 5min), and this supernatant was marked as K2.

[0086] At the same time, for comparative analysis, 50 mL of BG11 liquid culture medium without Chlorella sorokiniana K2 algae liquid was used as a control group, and the experiment was repeated 6 times. The supernatant of the control group was marked as Control.

[0087] The collected K2 and Control supernatant samples were stored in a -80°C refrigerator for subsequent metabolomics testing. Subsequently, these samples were submitted to Shanghai Paisono Biotechnology Co., Ltd. for professional metabolomics testing.

[0088] The test results show that the Chlorella sorokiniana K2 described in the present invention can produce a variety of metabolites with biological activity. Among them, metabolites that can be used as plant growth regulators are included, such as diethylene glycol, isophorone, erucamide, hexadecanoic acid, allantoic acid, L-serine, ethephon, glutamine-arginine and lauramide. In addition, the algae strain can also produce metabolites that promote plant growth or improve plant stress resistance, such as palmitic acid, valeramide, betaine, linoleic acid, methionine, N-acetyl-L-glutamic acid, L-glutamic acid, phenylalanine-tyrosine, phenylalanine-glutamic acid, L-threonine, leucine, proline, L-isoleucine-L-threonine, etc. These metabolites show obvious effects in promoting plant growth, especially under salt stress conditions, they can significantly improve the salt resistance of plants, reduce the degree of leaf cell membrane lipid peroxidation of plants such as wheat under salt stress conditions, thereby effectively alleviating the damage of salt stress to plants.

[0089] It is worth mentioning that this algae strain can also produce capsaicin, a metabolite with insecticidal activity, which further indicates that it has the potential to enhance the insect resistance of plants.

[0090] SEQ ID NO:1

[0091] >K2_tufA

[0092] >K2_824bp

[0093] AGGTTTGATTAATTCTACAATCATTTTAATACGGTCACCAGGCATAACCATTTGTGTAGCA

[0094] CTATCATCATCTGCACGGAATGATTCAATCTTTTCCTGTTACGTCTGTTGTACGAACATAAA

[0095] ATTCGGTCGGTATCCAGGAAAGAATGGAGTATGACGACCACCTTCTTCTTTTGTTAAGA

[0096] CATAAACTTGTGCTTCGAATTTAGTGTGAGGCGTAATACTGCCCGGTTTTGCAAGAACCA

[0097] TACCACGTTCAATATCTATTTTTTGAACACCACGAAGTAAAATTCCAACATTATCTCCAGC

[0098] TACACTTTCATCTAATGTTTTTTGGAACATTTCTAAACCAGTAACAGTTGTTGTTTTTGTA

[0099] TCACGTAAACCAACAAGTTCAACTGTATCACCAATTTTTACACACCCACGTTCGACACG

[0100] ACCTGTCGCTACAGTTCCACGACCTGTAATTGAAAAAACGTCCTCAACAGCCATTAAAA

[0101] ATGGTTTCTCTGTTTCACGTTCTGGAGTTGGAATATAAGAATCAACTTGATCCATAAGGTT

[0102] ATAAAATTTTATCAACCCATTTACTATCACCAGGTTGAATTTGTGGATTCTCTGTTAATGCTT

[0103] CTAAAGCAAGAAGTGCTGAACCAGCAATGATTGGGATTTCATCGCCAGGGAATTCATATT

[0104] TATCTAATGTTTCACGAATTTCTAATTCAACAAGTTCTAATAATTCTGCATCATCAACTTGA

[0105] TCTTCTTTATTTAAAAAGACAACAATATTTGGAACACCTACTTGTTTTGCTAAAAGTAAAT

[0106] GTTCTTTTGTTTTGTGGCATAGGACCGTCAGCACCAG

[0107] The present invention is described above by way of example. It should be noted that, without departing from the core of the present invention, any simple deformation, modification or other equivalent replacement that can be made by those skilled in the art without inventive effort falls within the protection scope of the present invention.

Claims

1. A salt-resistant growth-promoting Chlorella, characterized in that: The chlorella is Chlorella sorokiniana K2, which was deposited in the China Center for Type Culture Collection on January 8, 2025, with the deposit number CCTCC NO:M 2025065.

2. A chlorella preparation, characterized in that: The preparation comprises the salt-resistant growth-promoting chlorella Chlorella sorokiniana K2 as claimed in claim 1.

3. A microbial fertilizer, characterized in that: The fertilizer comprises at least one of the following ingredients: the salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, its culture, its processed product, or the Chlorella preparation described in claim 2.

4. A soil conditioner, characterized in that: The conditioning agent comprises at least one of the following ingredients: the salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, its culture, its processed product, or the Chlorella preparation described in claim 2.

5. A plant growth regulator, characterized in that: The regulator comprises at least one of the following ingredients: the salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, its culture, its processed product, or the Chlorella preparation described in claim 2.

6. A biostimulant, characterized in that: The stimulant comprises at least one of the following ingredients: the salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, its culture, its processed product, or the Chlorella preparation described in claim 2.

7. A biological pesticide, characterized in that: The pesticide comprises a carrier and an active ingredient, wherein the active ingredient comprises the salt-resistant growth-promoting chlorella Chlorella sorokiniana K2 as claimed in claim 1, a culture thereof or a processed product thereof.

8. Use of salt-resistant growth-promoting Chlorella sorokiniana K2, Chlorella preparations or microbial fertilizers, characterized in that: The salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, the Chlorella preparation described in claim 2 or the microbial fertilizer described in claim 3 is used for at least one of the following purposes: improving crop stress resistance (especially salt resistance), promoting crop growth, and improving soil.

9. A specific implementation of the application according to claim 8, characterized in that: The salt-resistant growth-promoting Chlorella sorokiniana K2 described in claim 1, the Chlorella preparation described in claim 2 or the microbial fertilizer described in claim 3 is added to the soil for growing crops.

10. A method for preparing a biological pesticide, characterized in that: The method is prepared by using the salt-resistant growth-promoting chlorella Chlorella sorokiniana K2, a culture thereof or a processed product thereof as described in claim 1.

Images