Bacillus subtilis and microbial agent for preventing and treating pasture root rot and application of bacillus subtilis and microbial agent

Abstract

The invention relates to bacillus subtilis and a microbial agent for preventing and treating pasture root rot and application of the bacillus subtilis and the microbial agent. The classification of the bacillus subtilis is named as bacillus subtilis, and the bacillus subtilis is named as bacillus subtilis. The preservation number of the bacillus subtilis is CGMCC (China General Microbiological Culture Collection Center) No.33061. The bacillus subtilis has a good effect of preventing and treating pasture root rot. Meanwhile, the bacillus subtilis is safe and non-toxic to people and livestock, has strong specificity to root rot, and meets the requirement of agricultural sustainable development.

Description

Technical Field

[0001] The present disclosure relates to the field of microbial technology, in particular to the field of biocontrol microbial technology, and specifically to a Bacillus subtilis and a microbial agent for preventing and controlling forage root rot and applications thereof. Background Art

[0002] The acceleration of urbanization and economic development has led to the occupation and destruction of a large number of grasslands, affecting forage production. At the same time, forage production technology is relatively backward and lacks modern management methods and technical support, so it is difficult to meet the demand for efficient and high-quality forage. Natural grasslands mainly provide forage sources for livestock such as cattle, sheep, horses, camels, yaks, etc. in animal husbandry, so the reduction of harmful substances in natural grasslands is an important indicator for the development of forage production technology.

[0003] Pasture grass has serious diseases and insect pests, among which root rot has a high incidence in summer, reaching 30-50% in some pastures, seriously affecting the growth and quality of pasture grass. In order to improve the management technology of natural pastures and to follow the green, environmental protection and sustainable development of agriculture, the use of biological control bacteria to control pasture root rot in natural pastures is extremely important for the prevention and control of pasture root rot now and in the future. Summary of the invention

[0004] The purpose of the present disclosure is to provide a Bacillus subtilis and a microbial agent for preventing and controlling forage root rot.

[0005] In order to achieve the above-mentioned object, the present invention provides a Bacillus subtilis for preventing and treating forage root rot. The classification of the Bacillus subtilis is named Bacillus subtilis. Bacillus subtilis ; The deposit number of the Bacillus subtilis is CGMCC No.33061.

[0006] Optionally, the 16S rRNA sequence of Bacillus subtilis is shown as SEQ ID NO.1.

[0007] A second aspect of the present disclosure provides a microbial agent, which contains Bacillus subtilis with a deposit number of CGMCC No. 33061 and a culture medium.

[0008] Optionally, the culture medium is selected from one or more of beef extract peptone medium, nutrient broth medium and LB medium.

[0009] Optionally, per gram of the microbial agent, the number of viable bacteria of Bacillus subtilis with a deposit number of CGMCC No.33061 is 10 8 -10 11 CFU.

[0010] The third aspect of the present disclosure provides the use of the Bacillus subtilis described in the first aspect or the microbial agent described in the second aspect in preventing and controlling forage root rot.

[0011] Optionally, the forage grass is selected from one or more of Dactylis grass, Festuca australis, Festuca sinensis and Agropyron ovata.

[0012] A fourth aspect of the present disclosure provides a method for preventing and controlling forage root rot, the method comprising: applying the Bacillus subtilis described in the first aspect or the microbial agent described in the second aspect to the soil at the root of the forage.

[0013] Optionally, the applying comprises spraying, root irrigation or soil mixing.

[0014] Optionally, the amount of Bacillus subtilis is 10 8 -10 11 CFU / m 2 .

[0015] Through the above technical scheme, the present disclosure provides a Bacillus subtilis and a microbial agent for preventing and treating forage root rot. The Bacillus subtilis has a good effect of preventing and treating forage root rot. At the same time, the Bacillus subtilis is safe and non-toxic to humans and animals, has strong specificity for root rot, and meets the needs of sustainable agricultural development.

[0016] Other features and advantages of the present disclosure will be described in detail in the following detailed description.

[0017] Biomaterial Deposit The Bacillus subtilis disclosed in the present invention is a pure culture isolated by the inventor of the present invention from alfalfa plants in Huanghua, Cangzhou, Hebei Province. Its deposit number is CGMCC No. 33061, and the deposit date is December 13, 2024. The depository is the General Microbiological Center of the China Microbiological Culture Collection Administration, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. It is classified and named Bacillus subtilis. Bacillus subtilis . BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 is a colony morphology diagram of Bacillus subtilis disclosed in the present invention.

[0019] Figure 2 is an evolutionary analysis between the Bacillus subtilis of the present disclosure and other Paenibacillus members (based on 16S rDNA sequence analysis). DETAILED DESCRIPTION

[0020] The specific implementation of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific implementation described herein is only used to illustrate and explain the present disclosure, and is not used to limit the present disclosure.

[0021] The inventors of the present disclosure isolated a pure culture from alfalfa plants in Huanghua, Cangzhou, Hebei Province, and identified the bacteria as belonging to the genus Bacillus ( Bacillus ), named Bacillus subtilis Bacillus subtilis The strain has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, a depository designated by the State Intellectual Property Office, on December 13, 2024, with a deposit number of CGMCC No.33061.

[0022] The present invention discloses a Bacillus subtilis for preventing and treating forage root rot. The classification name of the Bacillus subtilis is Bacillus subtilis Bacillus subtilis ; The deposit number of the Bacillus subtilis is CGMCC No.33061.

[0023] The Bacillus subtilis disclosed in the present invention can survive and grow in a conventional bacterial culture medium. The Bacillus subtilis disclosed in the present invention as described above is a strain with biological control effects, especially capable of preventing and controlling root rot of forage grass.

[0024] According to the present disclosure, the 16S rRNA sequence of Bacillus subtilis is shown as SEQ ID NO.1.

[0025] In one embodiment of the present disclosure, Figure 1 As shown, the front side of the Bacillus subtilis colony appears original white.

[0026] A second aspect of the present disclosure provides a microbial agent, which contains Bacillus subtilis with a deposit number of CGMCC No. 33061 and a culture medium.

[0027] The number of viable bacteria of Bacillus subtilis in the microbial agent can vary within a wide range. In one embodiment of the present disclosure, the number of viable bacteria of Bacillus subtilis with a deposit number of CGMCC No. 33061 per gram of the microbial agent is 10 8 -10 11 Preferably, the number of viable bacteria of Bacillus subtilis with the deposit number of CGMCC No.16828 per gram of microbial agent can be 10 9 -10 10 CFU.

[0028] According to the present disclosure, the type of the culture medium can be various culture media that can be used to culture Bacillus subtilis. In one embodiment of the present disclosure, the culture medium can be selected from one or more of beef extract peptone culture medium, nutrient broth culture medium and LB culture medium. For example, beef extract peptone culture medium, broth culture medium, LB culture medium and other commonly used culture media can be used as seed culture medium for the preservation of strains; and fermentation culture medium is generally used for production, and the types of these culture media are also well known to those skilled in the art. The above culture medium can be commercially available or prepared according to the records of the "Microbiology Culture Media Manual". For example, the seed culture medium can be a beef extract peptone culture medium containing 1-3g / L beef extract, 5-15g / L peptone, 3-8g / L sodium chloride and 15-20g / L agar. For example, the fermentation medium may contain: 40-150 g / L starch, 0.5-8 g / L sodium chloride, 0.5-5 g / L calcium carbonate, 2-10 g / L potassium dihydrogen phosphate and 1-10 g / L ferrous chloride.

[0029] The above-mentioned various culture media can be sterilized according to conventional sterilization methods and then used for later use, for example, sterilized at 115-125° C. and 1.5-2 standard atmospheric pressures for 10-30 minutes.

[0030] There is no particular limitation on the method for culturing Bacillus subtilis. For example, Bacillus subtilis can be first cultured in a seed culture medium (LB culture medium) to a bacterial density OD 600 The value is 0.6-0.8, and a bacterial solution is obtained. Then, 2-5 parts by weight of the bacterial solution of Bacillus subtilis are inoculated into 100 parts by weight of a culture medium (15 g of glucose, 1 g of starch, 25 g of bean cake powder, 1 g of manganese sulfate, 1.5 g of potassium dihydrogen phosphate, 0.5 g of magnesium sulfate, 0.2 g of yeast extract, 0.1 g of ferric chloride, 0.1 g of calcium carbonate, pH 7.0-7.2), and cultured at 37°C until the number of viable bacteria of Bacillus subtilis reaches 10 8 -10 11 CFU / g of culture medium.

[0031] Preferably, the number of viable bacteria of Bacillus subtilis with a deposit number of CGMCC No. 16828 per gram of the microbial agent obtained by culturing can be 10 8 -10 11 CFU, preferably 10 9 -10 10 CFU. During the culture process, the concentration of live bacteria can be obtained by conventional methods, such as blood cell plate counting or OD value observation.

[0032] The cultured bacterial liquid can be used directly as a microbial agent. Preferably, the bacterial liquid is further processed into a microbial agent in a more convenient storage form through steps including sterile filtration and freeze drying. There are no special restrictions on the culture conditions of the strains, and they can be the conditions commonly used in the culture process of Bacillus subtilis, such as using a shaking table for shaking culture, the culture temperature can be 28-37°C, and the culture time can be 1-3 days.

[0033] The third aspect of the present disclosure provides the use of the Bacillus subtilis described in the first aspect or the microbial agent described in the second aspect in preventing and controlling forage root rot.

[0034] In one embodiment of the present disclosure, the forage grass is natural forage grass, for example, one or more of Dactylis grass, Festuca australis, Festuca sinensis and Agropyron ovata.

[0035] A fourth aspect of the present disclosure provides a method for preventing and controlling forage root rot, the method comprising: applying the Bacillus subtilis described in the first aspect or the microbial agent described in the second aspect to the soil at the root of the forage.

[0036] The application may be carried out in a manner commonly used by those skilled in the art, such as spraying, root irrigation or soil mixing. Preferably, the amount of Bacillus subtilis used is 10 8 -10 11 CFU / m 2 .

[0037] The present invention is further described in detail below in conjunction with examples, but the scope of the present invention is not limited to the following examples.

[0038] Unless otherwise specified, all culture media used were commercially available products.

[0039] Example 1 This example is used to illustrate the separation and purification of Bacillus subtilis disclosed in the present invention.

[0040] 1. Sample collection and processing.

[0041] Collected from alfalfa plants in Huanghua, Cangzhou, Hebei.

[0042] The collection method is as follows: find alfalfa with good growth in the alfalfa fields in Huanghua, Cangzhou, Hebei, bring it back to the laboratory, and then separate it.

[0043] 2. Isolation and purification of strain OBMCGF-1.

[0044] 1. Plant sample processing: The roots, stems and leaves of alfalfa plants collected from Huanghua, Cangzhou, Hebei were disinfected on the surface with 75% ethanol, cut into small pieces, and cultured in LB culture medium. After 2 days, the bacteria distributed in the small pieces of alfalfa roots, stems and leaves were isolated.

[0045] 2. Cultivation and purification of strains: The obtained bacteria were diluted again, added to 90 mL of sterile water, shaken evenly to obtain a mixed solution, 1 mL of the mixed solution was added to a test tube containing 9 mL of sterile water, and mixed evenly to obtain a dilution of 10 -1 The dilution was prepared by 10-fold dilution method to obtain 10 -2 , 10 -3 Dilutions of different dilutions. -3 100 μL of the soil sample dilution was spread on the separation LB medium plate, and then the dilution was spread evenly with a sterile spreader, and repeated 3 times on the LB medium. Cultured in an incubator at 37°C, bacterial colonies were observed after 2 days, and the next step of purification was carried out.

[0046] The fungal samples were temporarily stored in a LB slant at 4°C, and three portions were collected in 30% glycerol tubes and stored in an ultra-low temperature refrigerator.

[0047] 2. Identification of strain OBMCGF-1.

[0048] 1. Morphological identification: The strain OBMCGF-1 was placed in the center of the LB culture medium, and the growth rate of the strain, growth status during the culture process, colony color, hyphae morphology and other characteristics were observed.

[0049] like Figure 1 As shown, after the isolated and purified strain OBMCGF-1 was cultured at 37°C for 2 days, Bacillus subtilis showed original white color.

[0050] 2. Molecular biology identification: DNA extraction: scrape an appropriate amount of strain OBMCGF-1 and put it into a sterile centrifuge tube, place it at 0℃ for more than 30 minutes, and put a steel bead in each centrifuge tube before starting DNA extraction. Oscillate it at a frequency of 50 Hz for 3 minutes using a freeze-thaw cell disruptor. After taking it out, follow the operating steps of the fungal genome extraction kit (Adlai Fungal DNA Rapid Extraction Kit) in sequence. Collect the DNA in a new centrifuge tube and use an ultra-micro spectrophotometer to measure the concentration. Qualified DNA can be amplified by PCR.

[0051] PCR amplification: The 16S rRNA segment was identified, and the primer sequences are as follows: 16S[F]: AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 2); 16S[R]: ACGGCTACCTTGTTACGACT (SEQ ID NO. 3).

[0052] PCR reaction system: 2 μL of upstream and downstream primers, 25 μL of Taq PCR StarMix (with Loading Dye), 1 μL of strain DNA template, 20 μL of ddH2O, and a total system of 50 μL.

[0053] 16SrRNA sequence PCR amplification program: 95°C for 3 min, 95°C for 30 s, 52°C for 30 s, 72°C for 1 min (35 cycles), and 72°C for 5 min.

[0054] PCR product detection and sequencing: prepare a 1% agarose gel, add 6 μL of DNA marker to the first or last gel well, add 6 μL of PCR product to other gel wells, run electrophoresis at 125 V for 30 min, observe the bands under a gel imaging system, and collect images.

[0055] After the sample was successfully amplified, it was sent to the company (Qingke Biotechnology Company) for sequencing, and the 16S rRNA sequence of the strain OBMCGF-1 was measured as shown in SEQ ID NO.1.

[0056] The 16S rRNA sequences were aligned in NCBI Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cg), and the relevant sequences of the model strains were downloaded. The sequence evolution analysis was performed using MEGA software, and the maximum likelihood (ML) method was used to construct a phylogenetic tree to determine the taxonomic status of the strains.

[0057] The results showed that the 16S rRNA of OBMCGF-1 was clustered with Bacillus from the tree, so it can be seen that OBMCGF-1 belongs to the genus Bacillus (see Figure 2 ).

[0058] Through the above morphological and molecular biological identification, strain OBMCGF-1 was identified as Bacillus subtilis ( Bacillus subtilis ), the strain was deposited on December 13, 2024 in the General Microbiology Center of China Microorganism Culture Collection Administration, referred to as CGMCC, with the address at: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with the deposit number CGMCC No.33061.

[0059] Example 2 This example is used to illustrate the preparation of microbial inoculants.

[0060] The Bacillus subtilis with the preservation number of CGMCC No.33061 was inoculated from the preservation slant into the beef extract peptone culture medium, and cultured at 37°C and 180rpm on a shaker for 12 hours to prepare a seed solution. The composition of the beef extract peptone culture medium is: 5.0g / L beef extract, 10.0g / L peptone, 5.0g / L NaCl, pH=7.2-7.4. 100mL of the above seed culture solution was added to 100L fermentation medium (the fermentation medium contained 80g / L starch, 3g / L sodium chloride, 3g / L calcium carbonate, 5g / L potassium dihydrogen phosphate and 5g / L ferrous chloride), and cultured at 30°C. During the culture process, samples were taken and observed by direct counting under a microscope until the number of viable Bacillus subtilis per gram of culture medium reached 10 10 CFU, and the obtained culture solution is the microbial agent of this embodiment.

[0061] Comparative Example 1 The Bacillus subtilis strain with the collection number of CGMCC No.8995 purchased from the China Center for Type Culture Collection was inoculated into beef extract peptone culture medium, and cultured at 37°C and 180rpm on a shaker for 12 hours to prepare a seed solution for standby use. 100mL of the above seed solution was added to 100L of fermentation medium (the fermentation medium contained 80g / L starch, 3g / L sodium chloride, 3g / L calcium carbonate, 5g / L potassium dihydrogen phosphate and 5g / L ferrous chloride), and cultured at 30°C. During the culture process, samples were taken and observed by direct counting under a microscope until the number of viable Bacillus subtilis bacteria per gram of culture medium reached 10 10 CFU, and the obtained culture solution is the microbial agent of this comparative example.

[0062] Comparative Examples 2-5 Four strains of Bacillus subtilis isolated together with the Bacillus subtilis with the deposit number of CGMCC No. 33061 of the present application were inoculated into beef extract peptone culture medium, and cultured at 37°C and 180 rpm on a shaker for 12 hours. The obtained bacterial liquids were recorded as seed liquids of Comparative Examples 2-5. 100 mL of the above seed bacterial liquid was added to 100 L of fermentation medium (the fermentation medium contained 80 g / L of starch, 3 g / L of sodium chloride, 3 g / L of calcium carbonate, 5 g / L of potassium dihydrogen phosphate and 5 g / L of ferrous chloride), and cultured at 30°C. During the culture process, samples were taken and observed by direct counting under a microscope until the number of viable Bacillus subtilis per gram of culture medium was 10 10 CFU, and the obtained culture solution is the microbial agent of Comparative Examples 2-5.

[0063] Test Example 1 This test example is used to illustrate that the strain OBMCGF-1 disclosed in the present invention can prevent and control forage root rot.

[0064] The wettable powders of Example 2 and Comparative Examples 1-5 were respectively used for the tests.

[0065] The specific method is: Preparation of root rot pathogen solution: Isolate the root rot pathogen from alfalfa plants with root rot, and culture the root rot pathogen in LB medium to a bacterial density of OD 600 The value is 2, and the obtained bacterial solution is diluted 2000 times to obtain the pathogenic bacteria solution.

[0066] The wettable powders of Example 2 and Comparative Examples 1-5 were used to conduct tests, and three natural grasslands of the same species and uniform growth were selected, each with an area of ​​2 m 2 The experimental group was treated with wettable powder at a rate of 2 g / m 2 (i.e. 2×10 9 CFU / m 2 ); the control group was not treated with wettable powder; 25 days after the wettable powder was applied, the experimental group and the control group were treated with 2L / m 2 The pathogen solution was applied and other conditions such as field management were the same. After 30 days, the control and prevention effects of forage root rot in the experimental group and the control group were statistically analyzed.

[0067] Among them, the effect of Bacillus in controlling root rot of forage grass is characterized by relative control effect and disease index.

[0068] The control of forage root rot is characterized by relative control effect and disease index.

[0069] Relative control effect (%) = (control disease index - treatment disease index) / control disease index.

[0070] The disease index is a comprehensive indicator that takes into account the incidence and severity. When the severity is expressed by graded representative values, the disease index = 100×∑ (number of disease roots at each level × representative values ​​at each level) / (total number of roots surveyed × highest representative value).

[0071] Among them, level 0 is healthy plants; Level 1: lesions appear locally on the main root or rhizome, and the lesion area is less than 10%; Level 2: 10%-30% of the taproots or rhizomes have continuous lesions; Level 3: 30%-50% of the taproots and rhizomes have lesions; Level 4: 50%-70% of the taproots and rhizomes have lesions; Level 5: 70%-90% of the taproots and rhizomes have lesions; Level 6 means that more than 90% of the taproots and rhizomes have lesions.

[0072] The results are shown in Table 1.

[0073] Table 1

[0074] As shown in Table 1, the disease index of the root rot of the grass in Example 2 and Comparative Examples 1-5 is the lowest, and the relative prevention effect of Example 2 is the highest, which is 65%. It can be seen that the Bacillus subtilis with the deposit number of CGMCC No. 33061 disclosed in the present invention can prevent and control the occurrence of grass root rot, indicating that the Bacillus subtilis disclosed in the present invention has a prevention and control effect on grass root rot.

[0075] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0076] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0077] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. A Bacillus subtilis for preventing and treating forage root rot, characterized in that: Bacillus subtilis Bacillus subtilis ; The deposit number of the Bacillus subtilis is CGMCC No.33061.

2. The Bacillus subtilis according to claim 1, wherein The 16S rRNA sequence of the Bacillus subtilis is shown as SEQ ID NO.

1.

3. A microbial agent, characterized in that: The microbial agent contains Bacillus subtilis with a preservation number of CGMCC No. 33061 and a culture medium.

4. The microbial agent according to claim 3, wherein The culture medium is selected from one or more of beef extract peptone culture medium, nutrient broth culture medium and LB culture medium.

5. The microbial agent according to claim 3, wherein In each gram of the microbial agent, the number of viable bacteria of Bacillus subtilis with the deposit number of CGMCC No. 33061 is 10 8 -10 11 CFU.

6. Use of the Bacillus subtilis according to any one of claims 1 to 2 or the microbial agent according to any one of claims 3 to 5 in preventing and controlling forage root rot.

7. The use according to claim 6, wherein: The forage grass is selected from one or more of Dactylis grass, Festuca australis, Festuca sinensis and Agropyron ovata.

8. A method for preventing and controlling forage root rot, characterized in that: The method comprises: applying the Bacillus subtilis described in any one of claims 1-2 or the microbial agent described in any one of claims 3-5 to the soil at the root of the forage grass.

9. The method according to claim 8, wherein: The application includes spraying, root irrigation or soil mixing.

10. The method according to claim 8, wherein: The dosage of Bacillus subtilis is 10 8 -10 11 CFU / m 2 .

Images