Preparation method and application of potato in-vivo molecular chaperonin GST-HPF

Abstract

The invention discloses a preparation method and application of molecular chaperonin GST-HPF in a potato body, and belongs to the technical field of biology. The invention provides an application of a GST-HPF protein in promoting malate dehydrogenase (MDH) folding, a preparation method of the GST-HPF protein comprises the following steps: constructing a pGEX4T-3-GST-HPF carrier by using an HPF sequence, transforming an escherichia coli BL21 strain, and inducing through IPTG to obtain the GST-HPF protein, and the nucleotide sequence of the HPF is shown as SEQ ID NO.2. The invention further provides a preparation method of the GST-HPF protein. The HPF gene is derived from potatoes. The amino acid sequence of the HPF is as shown in SEQ ID NO. 1. The protein provided by the invention is expected to be applied to research in the aspect of molecular chaperones, shows relatively high application potential in the aspect of helping protein folding, and also greatly improves liquid turbidity caused by protein denaturation after heating.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a preparation method and application of a molecular chaperone protein GST-HPF in potato. Background Art

[0002] Molecular chaperones have important physiological functions in cells. Proteins are prone to misfolding in the process of forming functional spatial structures. Intermediates will expose hydrophobic groups, resulting in protein misfolding and failure to perform their functions. Molecular chaperones can ensure the normal folding of proteins through a series of reactions. In addition, molecular chaperones participate in the stress response in organisms, can renature proteins, maintain protein homeostasis, and improve plant resistance to the environment. Although there are a large number of molecular chaperone proteins in plants, there are still many molecular chaperone genes that have not been cloned and identified. In addition, many proteins have not been expressed and purified into products.

[0003] The present invention uses molecular biology methods to clone a gene HPF encoding a molecular chaperone protein from a potato, constructs a pGEX4T-3-GST-HPF vector, transforms the Escherichia coli BL21 strain, and obtains a large amount of GST-HPF protein in the supernatant by IPTG induction. After protein purification, a pure GST-HPF protein is obtained, which proves that it can help malate dehydrogenase MDH process and fold under a high temperature of 45°C, and delay the denaturation of the protein under high temperature conditions. And the folding efficiency of the protein is comparable to the GroEl protein used in the market. Therefore, the protein provided by the present invention is expected to be applied to the research of molecular chaperones, showing a high application potential in helping protein folding, and greatly improving the turbidity of the liquid caused by protein denaturation after heating. Summary of the invention

[0004] The purpose of the present invention is to provide a preparation method and application of potato in vivo molecular chaperone protein GST-HPF to solve the problems existing in the above-mentioned prior art.

[0005] Technical solution 1: Application of GST-HPF protein in promoting the folding of malate dehydrogenase MDH. The preparation method of the GST-HPF protein includes: using HPF to construct a pGEX4T-3-GST-HPF vector, transforming the Escherichia coli BL21 strain, and inducing with IPTG to obtain the GST-HPF protein. The nucleotide sequence of the HPF is shown in SEQ ID NO.2.

[0006] Furthermore, the HPF gene is derived from potato.

[0007] Furthermore, the amino acid sequence of the HPF is shown in SEQ ID NO.1.

[0008] Technical solution 2: A molecular chaperone plasmid that promotes the folding of malate dehydrogenase MDH, containing the molecular chaperone protein GST-HPF, wherein the nucleic acid sequence of the HPF gene is shown in SEQ ID NO.2.

[0009] Furthermore, the plasmid vector is pGEX4T-3.

[0010] Technical solution three: Application of the molecular chaperone plasmid in promoting the correct folding of malate dehydrogenase MDH.

[0011] The present invention discloses the following technical effects:

[0012] The present invention discloses a preparation method and application of a molecular chaperone protein GST-HPF in potato. A gene HPF encoding a molecular chaperone protein was cloned from potato, and a pGEX4T-3-GST-HPF vector was constructed. After the Escherichia coli BL21 strain was transformed, a large amount of GST-HPF protein was obtained in the supernatant by IPTG induction. After protein purification, a pure GST-HPF protein was obtained, and it was verified that it could help malate dehydrogenase MDH to process and fold under a high temperature of 45°C, and delay the denaturation of the protein under high temperature conditions. And the folding efficiency of the protein is comparable to that of the GroEl protein used in the market. The protein provided by the present invention is expected to be applied to the research on molecular chaperones, and shows a high application potential in helping protein folding, and also greatly improves the turbidity of the liquid caused by protein denaturation after heating. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0014] Figure 1 This is the result diagram of the prediction of the non-transmembrane region of HPF protein;

[0015] Figure 2 The pGEX4T-3-GST-HPF vector was constructed, where A: pGEX4T-3-GST vector map; B: the successfully constructed pGEX4T-3-GST-HPF vector was double digested with EcoR I and Xhol restriction enzymes;

[0016] Figure 3The results of prokaryotic induction expression and purification of GST-HPF protein; A: Western blot detection of GST-HPF fusion protein content in supernatant and precipitate at 16℃ and 37℃; B: GST-HPF purification effect;

[0017] Figure 4 The changes in absorbance at 340 nm after GST-HPF and MDH were incubated at 45°C for different time periods. DETAILED DESCRIPTION

[0018] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0019] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0020] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0021] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0022] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0023] HPF protein sequence:

[0024] MGKFDKIAlllSlIVITIWFPIVVECAKKAVGVARKEDIPYIRCQVCEKlAYQlYHHVQNKHAEISPKKISEYQIIEISENVCNlKKQEADWIlKIDIVEQGDRlElIEQDSEGQCNSECKTIERACQDVMDYSDTDVAEYlYKTKPDlDSlKSFlCKDlTKVCSKAPPPVPKNRVPGEPFVAKSSKEAEMEKlMRSMQGMPGAPGMQMYSREDlMNQKFGDEDADDDDDDDEGGFPSKlGKVIKEKESKKNDWKQRITKGIQDTSETlKNHANRVSHRMRKWWGTKKAQWKKSSKTGKGEl(SEQ ID NO.1);

[0025] HPF CDS sequence:

[0026] ATGGGGAAATTTGATAAGATTGCATTGTTGTTGTCTTTGATAGTGATAACAATATGGTTTCCAATTGTTGTTGAATGCGCAAAGAAAGCAGTAGGAGTGGCAAGAAAAGAAGACATTCCGTATATAAGATGTCAGGTGTGTGAAAAGCTGGCGTATCAGCTATACCATCATGTTCAGAACAAACATGCTGAGATTTCTCCAAAGAAGATCTCAGAGTATCAGATAATAGAGATTTCAGAGAATGTATGCAATTTAAAGAAGCAGGAAGCTGATTGGATTCTTAAAATTGACATAGTTGAACAAGGTGATAGGTTGGAGCTGATTGAACAAGACTCTGAAGGACAATGTAATTCAGAATGCAAAACAATAGAGCGTGCTTGTCAAGATGTGATGGACTATTCTGATACAGATGTGGCAGAATATTTATATAAAACCAAACCAGATCTTGATTCCTTGAAAAGTTTCCTTTGCAAGGATTTGACCAAAGTTTGTAGCAAGGCACCACCTCCAGTTCCTAAGAATAGAGTCCCAGGAGAACCTTTTGTTGCTAAGTCCTCAAAAGAGGCTGAAATGGAAAAGCTAATGCGATCCATGCAGGGTATGCCTGGAGCCCCAGGTATGCAAATGTATTCTAGGGAAGATTTAATGAACCAAAAGTTTGGTGATGAAGATGCTGATGATGACGACGATGATGATGAAGGAGGCTTCCCGTCAAAACTGGGGAAGGTTATTAAAGAAAAAGAAAGTAAGAAGAATGATTGGAAGCAACGGATCACAAAAGGAATTCAGGATACAAGTGAAACTCTGAAGAATCACGCTAACAGAGTATCCCACAGGATGAGAAAGTGGTGGGGAACGAAGAAAGCACAATGGAAGAAGAGTTCCAAAACCGGTAAGGGAGAGCTATAA(SEQ ID NO.2);

[0027] HPF cDNA sequence:

[0028]

[0029] HPF non-transmembrane region sequence after codon optimization:

[0030] CATGGAATGCGCTAAAAAAGCTGTTGGTGTTGCTCGTAAAGAAGACATCCCGTACATCCGTTGCCAGGTTTGCGAAAAACTGGCTTACCAGCTGTACCACCACGTTCAGAACAAACACGCTGAAATCTCTCCGAAAAAAATCTCTGAATACCAGATCATCGAAATCTCTGAAAACGTTTGCAACCTGAAAAAACAGGAAGCTGACTGGATCCTGAAAATCGACATCGTTGAACAGGGTGACCGTCTGGAACTGATCGAACAGGACTCTGAAGGTCAGTGCAACTCTGAATGCAAAACCATCGAACGTGCTTGCCAGGACGTTATGGACTACTCTGACACCGACGTTGCTGAATACCTGTACAAAACCAAACCGGACCTGGACTCTCTGAAATCTTTCCTGTGCAAAGACCTGACCAAAGTTTGCTCTAAAGCTCCGCCGCCGGTTCCGAAAAACCGTGTTCCGGGTGAACCGTTCGTTGCTAAATCTTCTAAAGAAGCTGAAATGGAAAAACTGATGCGTTCTATGCAGGGTATGCCGGGTGCTCCGGGTATGCAGATGTACTCTCGTGAAGACCTGATGAACCAGAAATTCGGTGACGAAGACGCTGACGACGACGACGACGACGACGAAGGTGGTTTCCCGTCTAAACTGGGTAAAGTTATCAAAGAAAAAGAATCTAAAAAAAACGACTGGAAACAGCGTATCACCAAAGGTATCCAGGACACCTCTGAAACCCTGAAAAACCACGCTAACCGTGTTTCTCACCGTATGCGTAAATGGTGGGGTACCAAAAAAGCTCAGTGGAAAAAATCTTCTAAAACCGGTAAAGGTGAACTG(SEQ ID NO.4).

[0031] Example 1

[0032] 1. Use the potato genome website SpudDB to search for the protein sequence of HPF (SEQ ID NO.1), and use the TMHMM website to predict the non-transmembrane domain of HPF protein (25-302aa). The results of predicting the non-transmembrane region of HPF protein are shown in Figure 1 , and obtain the nucleotide sequence of the non-transmembrane domain, wherein the HPF CDS sequence is shown in SEQ ID NO.2, and the HPF cDNA sequence is shown in SEQ ID NO.3.

[0033] 2. Using the website http: / / www.jcat.de / for codon optimization, the organism was selected as E. coli, and the nucleotide sequence of the protein encoding was optimized. The HPF non-transmembrane region sequence after codon optimization is shown in SEQ ID NO. 4. The whole genome was synthesized to add the sequence containing the target gene with base C added at 5', and restriction sites EcoR I and Xhol were added at both ends, and then connected to the pUC57-simple vector.

[0034] 3. After the pUC57-simple vector containing the target fragment was digested, the target gene fragment was connected to the pGEX4T-3 expression vector to construct the pGEX4T-3-GST-HPF expression vector. The construction of the pGEX4T-3-GST-HPF vector is shown in Figure 2 , where A: pGEX4T-3-GST vector map; B: successfully constructed pGEX4T-3-GST-HPF vector EcoR I and Xhol double enzyme digestion.

[0035] 4. The expression vector was transformed into BL21 strain, and PCR amplification was performed using gene-specific primers 5' and 3':

[0036] 5':CATGGAATGCGCTAAAAAAGCTGTTGGTGTTG (SEQ ID NO. 5);

[0037] 3': CAGTTCACCTTTACCGGTTTTAGAAGA (SEQ ID NO. 6);

[0038] The PCR reaction system is as follows: 2×PCR mix 10μL, ddH2O 8μL, primer 5' and 3' 0.5μL each, template 1μL. PCR reaction program: pre-denaturation 94℃ 10min denaturation 94℃ 30s annealing 55℃ 30s extension 72℃ 1min 35 cycles, post-extension 72℃ 5min storage 16℃. PCR screening of bacteria, after obtaining positive bacteria -80℃ storage strains.

[0039] 5. Protein expression test. Take -80℃ strains, inoculate 50μL into a flask containing about 10mL LB liquid medium containing ampicillin in a clean bench, and culture overnight at 37℃, 200rpm. At the same time, culture empty vector strains as negative protein control. Take 200μL (stationary phase) of bacteria and transfer to a flask containing 10mL LB liquid medium containing ampicillin antibiotics, and culture at 37℃, 200rmp for about 4h (OD 600 The value is between 0.8-1.0). Add 10μL of 0.5mmol / mL IPTG to 10mL bacterial solution, induce expression at 16℃ / 37℃ for 16h, collect the bacteria by centrifugation, add 1mL lysis buffer respectively, and break by ultrasonic. Set the power to 300w, working time 5s, interval time 5s, collect the supernatant and precipitate, and resuspend the precipitate with 1mL lysis buffer. Take 20μL sample, add an equal volume of 2× Loading Buffer, boil in water bath for 5min, quickly cool on ice, centrifuge and perform SDS-PAGE and WB detection.

[0040] 6. Mass expression and purification of target protein. The target protein GST-HPF was highly expressed in the supernatant at 16°C. The above-preserved bacterial solution was activated and then inoculated into 400 mL of LB medium for culture until OD 600 At about 0.8-1.0, add 0.5mM IPTG, induce expression at 16℃ for 16h, and collect the cells by centrifugation. Add an appropriate amount of lysis buffer to resuspend the cells and then perform ultrasonic disruption, and collect the supernatant by centrifugation. Incubate the supernatant with the corresponding beads at 4℃ for 3h, collect the beads, add washbuffer to the beads for washing, and use Bradford to detect each washing solution. If the Bradford detection solution changes color and turns blue, the number of washings should be appropriately increased until the Bradford detection solution has no color change. Finally, use Elution buffer (20mM reduced glutathione) for gradient elution, collect the eluate, take 20μL and add an equal volume of 2×Loading Buffer, boil in a boiling water bath for 5min, quickly cool on ice, and perform SDS-PAGE detection after centrifugation.

[0041] 7. Determination of GST-HPF, GST, malate dehydrogenase MDH, GroE1 protein concentrations. Using TaKaRa Bradford Protein Assay Kit (200 μL reaction system), a BSA standard curve was drawn and the sample protein concentration was detected.

[0042] 8. Effects of GST-HPF, GST, and GroEl on the absorbance at 340nm of malate dehydrogenase MDH at 45°C. Prepare 2μM MDH solution, and add GST-HPF, GST, and GroEl solutions of different protein concentrations to 2μM MDH, and detect the changes in absorbance at 340nm within 0-15min at 45°C.

[0043] 9. The results show:

[0044] (1) The GST-HPF fusion protein was successfully expressed in Escherichia coli. After separation and purification, the GST-HPF protein concentration was 310 μg / mL and the purity reached 70%. The prokaryotic expression and purification effects of the GST-HPF protein were shown in Figure 3 ; Among them, A: Western blot detection of GST-HPF fusion protein content in 16℃ and 37℃ supernatant and precipitate; B: GST-HPF purification effect.

[0045] (2) 2 μM MDH solution and 2 μM MDH were added with GST-HPF, GST, GroEL protein solutions of different concentrations, and the changes of absorbance at 340 nm within 0-15 min under 45°C were detected. It was found that GST-HPF fusion protein effectively alleviated the denaturation of 2 μM malate dehydrogenase MDH under 45°C high temperature conditions. GST-HPF could alleviate the change of absorbance at 340 nm of MDH under 45°C high temperature conditions. Figure 4 GST-HPF fusion protein can reduce the denaturation rate of MDH at 2μM, 0.2μM and 0.02μM in a concentration-dependent manner; the effect at 0.2μM is comparable to that of 0.1μM positive GroEl protein.

[0046] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The application of GST-HPF protein in promoting the folding of malate dehydrogenase MDH, characterized in that: The preparation method of the GST-HPF protein comprises: constructing a pGEX4T-3-GST-HPF vector using HPF, transforming the Escherichia coli BL21 strain, and inducing with IPTG to obtain the GST-HPF protein. The nucleotide sequence of the HPF is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The HPF gene is derived from potato.

3. The use according to claim 1, characterized in that: The amino acid sequence of the HPF is shown in SEQ ID NO.

1.

4. A molecular chaperone plasmid that promotes the folding of malate dehydrogenase MDH, characterized in that: It contains molecular chaperone protein GST-HPF, wherein the nucleic acid sequence of HPF gene is shown as SEQ ID NO.

2.

5. The molecular chaperone plasmid according to claim 4, characterized in that The plasmid vector is pGEX4T-3.

6. Use of the molecular chaperone plasmid according to claim 4 or 5 in promoting the correct folding of malate dehydrogenase (MDH).

Images