Eriocheir sinensis lysozyme EsLys-i as well as preparation method and application thereof
By extracting and purifying lysozyme EsLys-i from Chinese mitten crabs, the problem of difficulty in providing lysozyme with broad-spectrum antibacterial activity in the prior art is solved, and the effective preparation and application of the lysozyme to antibacterial agents or biomedical antibacterial materials are achieved.
Patent Information
- Application Number
- CN202411949738.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2025-04-25
AI Technical Summary
The prior art is difficult to provide a Chinese mitten lysozyme with broad-spectrum antibacterial activity for the preparation of antibacterial agents or biomedical antibacterial materials.
The total RNA was extracted from Chinese mitten crab, reverse transcription was performed to obtain cDNA, and a recombinant expression vector was constructed, and the expression vector cells were introduced, and the recombinant protein, namely Chinese mitten crab lysozyme EsLys-i.
The lysozyme EsLys-i exhibits a broad spectrum of antibacterial activity, can effectively inhibit a variety of pathogens, and has good application prospects for the preparation of antibacterial agents or biomedical antibacterial materials.
Smart Images
Figure CN119876198A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of lysozyme, and particularly relates to Chinese mitten crab lysozyme EsLys-i and a preparation method and application thereof. Background Art
[0002] Chinese mitten crab (Eriocheir sinensis), commonly known as hairy crab, is widely distributed in the Yangtze River Basin of China. Chinese mitten crab mainly relies on the innate immune system to resist infection by pathogenic microorganisms. Antimicrobial peptides are important effector factors of the invertebrate immune system and play a key role in clearing pathogenic microorganisms from the host.
[0003] In the field of biotechnology, lysozyme from Chinese mitten crab has attracted much attention due to its unique biological activity and application potential. Lysozyme is a naturally occurring enzyme that is widely found in humans, animals, birds, amphibians, and some plants. It can destroy the cell walls of bacteria, especially Gram-positive bacteria. Lysozyme can cleave the β-1,4-glycosidic bonds in peptidoglycan, causing the rupture of bacterial cell walls and ultimately the death of bacteria. Summary of the invention
[0004] The technical problem to be solved by the present invention is to provide a Chinese mitten crab lysozyme EsLys-i and a preparation method and application thereof. The lysozyme EsLys-i exhibits a broad-spectrum antibacterial activity, can be used to prepare antibacterial agents or biomedical antibacterial materials, and has good application prospects.
[0005] The invention provides a Chinese mitten crab lysozyme EsLys-i. The cDNA sequence of the lysozyme EsLys-i is shown in SEQ ID NO: 1, has a full length of 1312 bp, and has an open reading frame of 477 bp.
[0006] Furthermore, the amino acid sequence of the lysozyme EsLys-i is shown in SEQ ID NO:2.
[0007] The present invention also provides a method for preparing Chinese mitten crab lysozyme EsLys-i, comprising the following steps:
[0008] (1) Using the extracted total RNA of Chinese mitten crab as a template, reverse transcription was performed to obtain cDNA, and the cDNA was used as a template to amplify the target gene of EsLys-i;
[0009] (2) Construction of a recombinant expression vector of Chinese mitten crab lysozyme EsLys-i;
[0010] (3) introducing the recombinant expression vector obtained in step (2) into an expression vector cell, and inducing the expression cell to express, thereby obtaining an expression product containing EsLys-i;
[0011] (4) Separating and purifying the expression product obtained in step (3) to obtain the recombinant protein, namely EsLys-i.
[0012] Furthermore, the primers in step (1) are:
[0013] EsLys-i F: CGCATCTATTGCCATCACTTG;
[0014] EsLys-i R:TTGCAGTCACCTTTCTTGGG;
[0015] The primers in step (2) are:
[0016] EsLys-iPF:CTGATATCGGATCCGAATTCGCCGCCGAGGTGGACCCC;
[0017] EsLys-iPR: GCGGCCGCAAGCTTGTCGACCTAGAACACGTTGAGGCGGG.
[0018] Furthermore, the expression vector in step (2) adopts pET-32a.
[0019] The present invention also provides an application of Chinese mitten crab lysozyme EsLys-i in the preparation of antibacterial drugs.
[0020] Furthermore, the antimicrobial drug includes an anti-pathogenic fungus drug or an anti-pathogenic bacterial drug.
[0021] Furthermore, the pathogenic fungus is Candida albicans.
[0022] Furthermore, the pathogenic bacteria are one or more of Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahemolyticus, Vibrio alginolyticus, Escherichia coli, and Aeromonas hydrophila.
[0023] Beneficial Effects
[0024] The present invention conducts an in vitro antibacterial experiment on lysozyme, and the results show that the lysozyme EsLys-i of the present invention exhibits a broad-spectrum antibacterial activity. The lysozyme can be used to prepare antibacterial agents or biomedical antibacterial materials, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 The cDNA of EsLys-i and its encoded amino acid sequence. The underscore indicates the signal peptide sequence, the asterisk (*) indicates the stop codon, the gray shadow indicates the lysozyme domain, and the conserved cysteine residues are marked in red. Figure 2 The SDS-PAGE electrophoresis diagram of the recombinant protein EsLys-i. Lane 1: total protein before IPTG induction; Lane 2: total protein after IPTG induction; Lane 3: protein after EsLys-i was purified by Ni column; Lane M: protein marker. DETAILED DESCRIPTION
[0026] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.
[0027] Example 1
[0028] The full-length gene of Chinese mitten crab lysozyme EsLys-i was obtained:
[0029] (1) Place the Chinese mitten crab in ice to anesthetize it, dissect the Chinese mitten crab, collect the stomach tissue, add cell lysis buffer into a grinding tube, add the stomach tissue into the solution, and grind it thoroughly; perform tissue homogenization, and extract total RNA after centrifugation.
[0030] (2) The quality of the extracted total RNA was tested by agarose gel electrophoresis. DNA was added to the total RNA to remove DNA from the sample. The RNA concentration and purity were tested by ultra-micro spectrophotometer. Then, the reverse transcription kit (PrimeScript TM cDNA was synthesized using the instructions for RT Master Mix.
[0031] EsLys-i F: CGCATCTATTGCCATCACTTG;
[0032] EsLys-i R:TTGCAGTCACCTTTCTTGGG.
[0033] (3) The cDNA synthesized in step (2) was used as a template to amplify the target gene. The reaction system was: 25 μL of Premix Taq enzyme, 20 μL of sterile water, 2 μL of forward primer and reverse primer, and 1 μL of cDNA template. PCR reaction procedure: 95°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 55°C annealing for 30 s, 72°C extension for 4 min, 40 cycles; finally 72°C extension for 10 min. The target gene fragment was obtained by agarose gel electrophoresis to detect the quality, and then recovered and purified using a gel recovery kit. It was connected to the pMD-19T vector, and the pMD-19T vector containing the target gene fragment was transformed into competent cells and sent to Shanghai Biotech for sequencing.
[0034] Example 2
[0035] Construction of recombinant expression vector of Chinese mitten crab lysozyme EsLys-i:
[0036] (1) Design expression primers containing specific restriction sites:
[0037] EsLys-i PF: CTGATATCGGATCCGAATTCGCCGCCGAGGTGGACCCC;
[0038] EsLys-i PR: GCGGCCGCAAGCTTGTCGACCTAGAACACGTTGAGGCGGG.
[0039] (2) The amplified product was amplified with an expression primer containing a specific restriction endonuclease recognition point to obtain a DNA fragment containing a restriction endonuclease site, and the obtained DNA fragment was double-digested with the expression vector pET-32a. The purified DNA fragment after digestion was connected with the pET-32a vector, and the ligation product was transformed into Escherichia coli DH5α competent cells. The positive strains were selected and sent to Biotech for sequencing. The recombinant expression plasmid containing EsLys-i was extracted from the strains with correct sequencing.
[0040] Example 3
[0041] The recombinant protein of Chinese mitten crab lysozyme EsLys-i is obtained:
[0042] The plasmid extracted from the positive bacteria in Example 2 was transformed into competent E. coli cells, and the positive bacteria were selected again and cultured to the logarithmic period, and 0.5mmol / L IPTG was added to induce the expression of the recombinant protein, and the cells were induced at 28°C for 12h, and the cells were collected by centrifugation at 6000rpm for 5min, washed with PBS several times, resuspended in 35ml PBS, and ultrasonically broken in an ice water bath. The protein expression was detected by 12% polyacrylamide gel electrophoresis (SDS-PAGE).
[0043] The results are as follows Figure 2 As shown, after induced expression, the protein was purified by nickel column, and the position of EsLys-i protein in the SDS-PAGE electrophoresis diagram was about 38 kDa, indicating that the purified protein was the expected recombinant protein EsLys-i.
[0044] Example 4
[0045] In vitro antibacterial effect of Chinese mitten crab lysozyme EsLys-i:
[0046] The antibacterial activity of the recombinant protein was evaluated by liquid antibacterial experiment. First, the recombinant protein and the tag protein Trx (as the control group) were diluted twice with TBS to a solubility of 0-2 μM. 25 μL of protein at different concentrations were added to a 96-well plate, and 10 microorganisms including Staphylococcus aureus (S. aureus), Bacillus subtilis (B. subtilis), Micrococcus luteus (M. luteus), Vibrio parahemolyticus (V. parahemolyticus), Vibrio alginolyticus (V. alginolyticus), Escherichia coli (E. coli), Aeromonas hydrophila (A. hydrophila), Candida albicans (C. albicans), and Pichia pastoris (P. pastoris) were diluted to 1×10 5 CFU, take 25μL and add it to proteins of different solubility in turn, incubate at 28℃ for 2h; then add 50μL of liquid PB medium (1% tryptone, 0.5% sodium chloride; pH 7.5) respectively, incubate at 28℃ for 16h; measure the absorbance at a wavelength of 600nm to evaluate its antibacterial activity and determine the minimum inhibitory concentration of the target recombinant protein against various pathogens. The minimum growth inhibitory concentration defines the lowest protein concentration that obtains significant growth inhibition compared with the negative control.
[0047] Table 1 Minimum inhibitory concentration of recombinant Chinese mitten crab lysozyme EsLys-i against different pathogens
[0048]
Claims
1. A Chinese mitten crab lysozyme EsLys-i, characterized by: The cDNA sequence of the lysozyme EsLys-i is shown in SEQ ID NO:
1.
2. The Chinese mitten crab lysozyme EsLys-i according to claim 1, characterized in that: The amino acid sequence of the lysozyme EsLys-i is shown in SEQ ID NO:
2.
3. A method for preparing Chinese mitten crab lysozyme EsLys-i, comprising the following steps: (1) Using the extracted total RNA of Chinese mitten crab as a template, reverse transcription was performed to obtain cDNA, and the cDNA was used as a template to amplify the target gene of EsLys-i; (2) Construction of a recombinant expression vector of Chinese mitten crab lysozyme EsLys-i; (3) introducing the recombinant expression vector obtained in step (2) into an expression vector cell, and inducing the expression cell to express, thereby obtaining an expression product containing EsLys-i; (4) Separating and purifying the expression product obtained in step (3) to obtain the recombinant protein, namely EsLys-i.
4. The preparation method according to claim 3, characterized in that: The primers in step (1) are: EsLys-i F: CGCATCTATTGCCATCACTTG; EsLys-i R:TTGCAGTCACCTTTCTTGGG; The primers in step (2) are: EsLys-iPF:CTGATATCGGATCCGAATTCGCCGCCGAGGTGGACCCC; EsLys-iPR: GCGGCCGCAAGCTTGTCGACCTAGAACACGTTGAGGCGGG.
5. The preparation method according to claim 3, characterized in that: The expression vector in step (2) is pET-32a.
6. Use of the Chinese mitten crab lysozyme EsLys-i as claimed in claim 1 in the preparation of antibacterial drugs.
7. The use according to claim 6, characterized in that: The antibacterial drugs include anti-pathogenic fungal drugs or anti-pathogenic bacterial drugs.
8. The use according to claim 7, characterized in that: The pathogenic fungus is Candida albicans.
9. The use according to claim 7, characterized in that: The pathogenic bacteria are one or more of Staphylococcus aureus, Bacillus subtilis, Micrococcus luteus, Vibrio parahemolyticus, Vibrio alginolyticus, Escherichia coli, and Aeromonas hydrophila.