Method for regulating and controlling aging process of plant leaves

Abstract

The invention discloses a method for regulating and controlling the aging process of plant leaves. According to the method, the aging process of the plant leaves is regulated and controlled by regulating and controlling expression of RNA m6A demethylation gene ALKBH10B. Experimental results show that the overexpression RNA m6A demethylation gene ALKBH10B can effectively inhibit the aging of plant leaves; by inhibiting the expression of the RNA m6A demethylation gene ALKBH10B, the aging of plant leaves can be effectively inhibited. The method can break through the limitation of a traditional chemical regulation and control means, and the purposes of improving the crop yield and quality, enhancing the commodity value of ornamental plants and the like are achieved; and the gene involved in the method is highly conservative in different plants, and has strong applicability and great application potential.

Description

Technical Field

[0001] The invention relates to genetic engineering, and in particular to a method for regulating the senescence process of plant leaves. Background Art

[0002] The green color of plant leaves comes from the efficient enrichment of chlorophyll in chloroplasts. This pigment converts light energy into chemical energy through photosynthesis, providing the necessary energy and organic matter for plant growth. As the core site of photosynthesis, the functional stability of chloroplasts directly determines the physiological activity and life cycle of leaves. Under natural growth conditions, green leaves maintain the material accumulation and development process of the plant body through continuous photosynthesis, while the degradation and functional decline of chlorophyll caused by leaf aging marks the end of photosynthetic capacity and the start of nutrient redistribution.

[0003] The duration of healthy leaves has dual regulatory value for crop yield and quality: delaying senescence can extend the photosynthetic window period and promote the transport of assimilates to grains or fruits, thereby increasing crop yields; conversely, inducing senescence can accelerate the return of nutrients such as nitrogen and phosphorus to storage organs and optimize crop quality. This "double-edged sword effect" requires precise regulation according to the needs of different crops - for example, yellowing and shedding of cotton leaves before harvest can reduce impurity pollution during mechanical harvesting, thereby improving work efficiency; while leafy vegetables need to inhibit the aging process to extend the shelf life of commodities. At the same time, directional control of leaf color changes is also the core goal of improving the economic traits of ornamental plants. In the field of horticulture, by breeding varieties with alternating yellow and green or extended green periods, the ornamental value and market competitiveness can be significantly improved; and the early presentation of autumn colors of colorful leaf plants can create unique landscape economic effects. This type of regulation not only meets the diverse market needs, but also provides a "trait-value" transformation path for agricultural production and the horticultural industry.

[0004] At present, although traditional chemical regulation methods can partially intervene in the leaf senescence process, they have significant limitations: first, broad-spectrum regulation is prone to non-target effects, for example, delaying leaf senescence may inhibit the development of flowers and fruits; second, chemical residues may pose a potential risk to soil ecology and agricultural product safety; third, changes in environmental temperature and humidity often lead to insufficient stability of drug efficacy, making it difficult to achieve precise control in time and space. Therefore, new methods for regulating the senescence process of plant leaves are still needed. Summary of the invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a method based on RNA m 6 A method for regulating the plant leaf senescence process of the A demethylation gene ALKBH10B, which is conserved in regulating plant leaf senescence.

[0006] Technical solution: The method for regulating the senescence process of plant leaves of the present invention comprises:

[0007] (1) Homologous cloning and isolation of RNA mRNAs of target plants 6 A demethylated gene ALKBH10B;

[0008] (2) constructing a recombinant ALKBH10B gene regulatory vector based on the gene isolated in step 1;

[0009] (3) introducing the recombinant vector obtained in step 2 into target plant cells;

[0010] (4) Screen and regenerate transgenic plants with stably regulated ALKBH10B gene expression.

[0011] Preferably, the plant in step 1 is a dicotyledonous plant.

[0012] Preferably, the dicotyledonous plant is a plant of the Asteraceae, Cruciferae or Solanaceae family.

[0013] Preferably, the RNA m 6 The enzymes encoded by the A demethylation gene ALKBH10B include:

[0014] a. An enzyme having an amino acid sequence as shown in SEQ ID NO: 1;

[0015] b. an enzyme having an amino acid sequence as shown in SEQ ID NO: 2;

[0016] c. having at least 60% sequence identity with the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and having RNA m 6 A homologous enzyme with demethylation function.

[0017] Preferably, the recombinant ALKBH10B gene regulatory vector in step 2 is an overexpression vector or an inhibition vector.

[0018] The overexpression vector contains CaMV 35S promoter, Actin promoter, UBQ10 promoter, or any other constitutive high expression promoter; the inhibition vector contains any inhibition expression sequence of miRNA, siRNA, sgRNA or antisense chain.

[0019] Preferably, the introduction method in step 3 is any one of Agrobacterium-mediated method, protoplast transformation method, viral vector delivery, pollen tube channel method, and gene gun method.

[0020] Preferably, the screening method in step 4 is any one of resistance gene screening, reporter gene screening, and molecular biological detection; the regeneration method is any one of explant induction, protoplast regeneration, callus regeneration, and Agrobacterium-mediated in vivo transformation.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This method regulates RNAm 6 A. The expression of the demethylated gene ALKBH10B can effectively regulate the aging process of plant leaves, thereby increasing crop yield and quality, or enhancing the commercial value of ornamental plants; 2. The genes involved in this method are highly conserved in plants, have strong applicability, and great application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of regulating the senescence process of Arabidopsis leaves by regulating the expression of ALKBH10B gene, where A and B are the results of identifying homozygous mutants of alkbh10b-1 and alkbh10b-2 by PCR method; C and D are the differences in leaf senescence between homozygous alkbh10b-1, alkbh10b-2 mutants and wild-type Col-0 Arabidopsis after 50 days of cultivation; E is the statistical result of chlorophyll content in leaves at the same leaf position of homozygous alkbh10b-1, alkbh10b-2 mutants and wild-type Col-0 Arabidopsis after 30 and 50 days of cultivation;

[0023] Figure 2 The results of regulating the senescence process of chrysanthemum leaves by regulating the expression of ALKBH10B gene, A and B are the statistical results of the difference in leaf senescence and chlorophyll content at the same leaf position between ALKBH10Box (35S:ALKBH10B-GFP) transgenic plants and wild plants; C and D are the statistical results of the difference in leaf senescence and chlorophyll content at the same leaf position between ami-ALKBH10B transgenic plants and wild plants;

[0024] Figure 3 To regulate ALKBH10B gene expression, mRNA 6 A is a modified dot blot result diagram;

[0025] Figure 4 To regulate ALKBH10B gene expression, the m 6 A modification and expression, and then the leaf senescence regulation result diagram;

[0026] Figure 5 Overexpression of the ALKBH10B gene significantly inhibited the translation of the EIN2 gene and promoted leaf senescence, where A is the result of the tobacco transient transformation experiment; B and C are the results of the chrysanthemum protoplast transient transformation experiment. DETAILED DESCRIPTION

[0027] The technical solution of the present invention is further described below.

[0028] Example 1: m6 Effects of knockout of ALKBH10B, the gene encoding A demethylase, on leaf senescence in Arabidopsis

[0029] 1. Purchase Arabidopsis thaliana mutants alkbh10b-1 (SALK_004215C) and alkbh10b-2 (SALK_107289C) from the AraShare database (www.arashare.cn);

[0030] 2. After the mutant and wild-type Arabidopsis Col-0 seeds were disinfected with alcohol and dried, they were planted on sterile 1 / 2MS medium and placed in a 4°C environment for 4 days, and then transferred to a 22°C light incubator for germination;

[0031] 3. The Arabidopsis seedlings germinated on the 1 / 2MS medium were transferred to the plug culture soil and cultured at 22°C, 16h light / 8h dark environment. During this period, the homozygous mutants were identified by PCR method ( Figure 1 A and B).

[0032] The PCR identification primers are as follows:

[0033] atalkbh10b-1-LP,TCCCTCTCATCACCACAAAG;

[0034] atalkbh10b-1-RP,ATGCCATAGCCATGAAGATTG;

[0035] atalkbh10b-2-LP, AGTAGAAAACACATGCCTCGG;

[0036] atalkbh10b-2-RP, TTAACATCGAGCCAATTCCAC;

[0037] LBb1.3,ATTTTGCCGATTTCGGAAC;

[0038] 4. Homozygous alkbh10b-1, alkbh10b-2 mutants and wild-type Col-0 Arabidopsis were selected for further cultivation, and significant differences in leaf senescence were found between these plants at 50 days of cultivation ( Figure 1 C and D);

[0039] 5. Select leaves from different plants at the same leaf position for chlorophyll content determination. The determination method is: place the leaves in 80% acetone (v / v) for dark culture for 24 hours, take the extract to measure the absorbance at 645nm and 657nm, and calculate the chlorophyll content by the following formula:

[0040]

[0041] The results are as follows Figure 1 As shown in E, at 30 or 50 days of culture, the leaves of the homozygous alkbh10b-1 and alkbh10b-2 mutants had higher chlorophyll content at the same leaf position than those of the wild-type Col-0 Arabidopsis.

[0042] Example 2: Regulation of m 6 A demethylase encoding gene ALKBH10B regulates chrysanthemum leaf senescence

[0043] 1. Based on the Arabidopsis ALKBH10B gene, homologous sequences were compared in the Chrysanthemum morifolium genome, and the sequences with the highest consistency were selected to design primers. The gene was cloned using Thermo Scientific Phusion high-fidelity DNA polymerase (PCR reaction system see Table 1, reaction procedure see Table 2). The cDNA used in the PCR experiment was derived from the reverse transcription product of the mRNA of Chrysanthemum morifolium'Hua Ling';

[0044] Table 1 PCR reaction system

[0045]

[0046] Table 2 PCR reaction program

[0047]

[0048] 2. After the PCR product was purified, it was connected to pMD 19-T Vector (Takara), and the sequence that was close to the reference gene sequence and had a high consistency in multiple sequencing results was selected as the final cloning result. Its encoding amino acid sequence is SEQ ID NO: 2;

[0049] 3. The plant overexpression vector used in this experiment is pORE-R4-35AA, which is obtained by transforming the empty vector pORE-R4 (GenBank: AY562547.1) without a promoter;

[0050] 4. Design primers with recombination arms. The detailed sequences are as follows: ALKBH10B-R4-BamHI-F, tttttctagaaggccttggatccaATGGCGCCGGCGGCGATTAT; ALKBH10B-R4-EcoRI-R, ggccgcaaagtcgacgaattctAGCAACACTGATTCCAGAACCGGGGTTT; Use the ALKBH10B vector connected to pMD19-TVector in step 2 as a template to obtain the target fragment by PCR. The PCR reaction system and procedure are the same as step 1;

[0051] 5. Digest the pORE-R4-35AA vector with BamHI and EcoRI, and recover the linearized vector by gel electrophoresis;

[0052] 6. The product was recovered and the recombination reaction was carried out using the ClonExpressUltra OneStepCloning KitV2 (Vazmye) kit. The recombinant product was transformed into DH5α competent cells (Sangong), coated with a plate containing kanamycin resistance, cultured at 37°C overnight, and a single clone was picked, tested, and sequenced to obtain the 35S:ALKBH10B-GFP vector;

[0053] 7. Transform the 35S:ALKBH10B-GFP vector recombinant plasmid into EHA105 Agrobacterium competent cells, pick out single clones for bacterial liquid PCR identification, extract EHA105 plasmid and transform it back to DH5α, then extract the plasmid and send it for testing to confirm that the Agrobacterium transformation is successful;

[0054] 8. Based on the CmALKBH10B cloned in step 2, design artificial small interfering RNA primers:

[0055] I:gaTAATTAGATGGTCAATCGCGCtctctcttttgtattcc;

[0056] II: gaGCGCGATTGACCATCTAATTAtcaaagagaatcaatga;

[0057] III: gaGCACGATTGACCAACTAATTTtcacaggtcgtgatatg;

[0058] IV: gaAAATTAGTTGGTCAATCGTGCtctacatatatattcct.

[0059] 9. Using pRS300 (miR319a pBSK) as the backbone, design universal forward and backward primers at its 5' and 3' ends

[0060] A:gagtttttctagaaggccttggatccCTGCAAGGCGATTAAGTTGGGTAAC;

[0061] B: gatgcggccgcaaagtcgacgaattcGCGGATAACAATTTCACACAGGAAA;

[0062] Use primers A and IV, II and III, I and B to perform PCR amplification to obtain three fragments a, b, and c respectively. The PCR system is the same as step 1. Use fragments a, b, and c as templates to perform two rounds of PCR amplification to obtain fragment d. Recombination reaction is performed between fragment d and the linearized pORE-R4-2×35S vector using a recombinase.

[0063] 10. The recombinant product was transformed into DH5α competent cells (Shengong), coated with a plate containing kanamycin resistance, cultured overnight at 37°C, single clones were picked, tested, sequenced, and amiR-ALKBH10B vectors were obtained, transformed into EHA105 competent cells, and the identification method was the same as step 7;

[0064] 11. Select 2-month-old 'Hua Ling' tissue culture seedlings with good growth, prepare leaf discs, and place them on 1:0.5 MS plates containing 500 μL 1 mg / mL 6-BA and 250 μL 1 mg / mL NAA, and invert and culture for 3 days;

[0065] 12. OD of Agrobacterium culture solution 600 Adjust to 0.6-0.8, place the leaf disc in the bacterial solution for infection for 8 minutes, remove the leaf disc, absorb the liquid on the leaf disc with filter paper, and transfer the infected leaf disc to a 1 / 0.5 plate for dark culture for three days;

[0066] 13. Transfer the leaf disc to a cytokinin: auxin solution containing 2.5 mL of 100 mg / L cephalosporin.

[0067] =1:0.5 decarboxylation plate, inverted and cultured for seven days;

[0068] 14. Change the plates in order from option 1 to option 4, 14 days each period, choose one plate containing 1.75mL 100mg / L cephalosporin, 100μL 50mg / L kanamycin, cytokinin: auxin = 1:0.5 plate; choose two plates containing 1.5mL 100mg / L cephalosporin, 90μL 50mg / L kanamycin, cytokinin: auxin = 1:0.5 plate; choose three plates containing 1.25mL 100mg / L cephalosporin, 80μL 50mg / L kanamycin, cytokinin: auxin = 1:0.3 plate; choose four plates containing 1mL 100mg / L cephalosporin, 70μL 50mg / L kanamycin, cytokinin: auxin = 1:0.1 plate; transfer the unrooted seedlings to the rooting bottle for culture;

[0069] 15. Extract DNA from seedling leaves for PCR and sequencing identification; after the positive seedlings are planted, take leaves again for identification, and extract RNA from leaves for qPCR identification to confirm that the target gene is regulated.

[0070] We found that 35S:ALKBH10B-GFP transgenic plants showed early leaf senescence, while amiR-ALKBH10B transgenic plants showed delayed leaf senescence ( Figure 2 ), indicating that in chrysanthemum, by regulating m 6 The expression of A modification enzyme can significantly regulate the yellowing process of leaves. Combined with the results described in Example 1, it shows that the m 6 The A demethylase encoding gene ALKBH10B is conserved in regulating plant leaf senescence.

[0071] Example 3: ALKBH10B gene expression through m 6 Mechanisms of A modification affecting plant leaf senescence

[0072] 1. Select leaves of the same leaf position of different transgenic plants in Example 2, and extract total RNA from tissues using RNeasy Plus Mini kit (QIAGEN);

[0073] 2. Incubate the total RNA at 95°C for 3 minutes, then quickly transfer to ice water for precooling;

[0074] 3. Take an equal amount of RNA and spot it on Amersham Hybond-N+ membrane (GE Healthcare, RPN3050B), then perform UV crosslinking, BSA blocking, and label with mA antibody (202-003; Synaptic Systems) and goat anti-rabbit (Bio-Rad 170-6516) secondary antibodies;

[0075] 4. Incubate the membrane with reagent SuperSignal Kit (Pierce) and develop;

[0076] 5. The input control was stained with methylene blue (MB), that is, the Amersham Hybond-N+ membrane (GE Healthcare, RPN3050B) containing the sample was placed in a 0.2% methylene blue solution, and photographed after color development.

[0077] By detecting mRNA m 6 A modification level, it was found that ALKBH10B could significantly inhibit m6A modification ( Figure 3 ), so the ALKBH10B gene mainly regulates plant leaf senescence by affecting the m6A modification of mRNA in plants.

[0078] To further investigate the role of ALKBH10B in m 6 The mechanism of A modification regulating leaf senescence and the downstream senescence regulation-related genes affected by this process were explored.

[0079] 1. Select mature green leaves and leaves in the early stage of senescence from the same plant, and extract total RNA using the RNeasy Plus Minikit (QIAGEN).

[0080] 2. Send the total RNA samples to Beijing Novogene Technology Co., Ltd. for mRNA m 6 A methylation sequencing (MeRIP-seq), mRNA was purified using oligo-d(T)25 magnetic beads and then fragmented using a fragmentation buffer (10 mM Tris-HCl [pH 7.0], 10 mM ZnCl 2 ) The mRNA was broken into fragments of about 100 bp and the m 6 A antibody was used for incubation, followed by washing and purification of mRNA fragments. 6 The mRNA fragments incubated with antibody A were used as input controls to construct sequencing libraries, which were sequenced using the Illumina NovaSeq 6000 sequencing platform;

[0081] 3. The extracted total RNA was sent to Annoroad Gene Technology (Beijing) Co., Ltd. for transcriptome sequencing (RNA-seq) using the MGI DNBSEQ-T7 sequencing platform;

[0082] 4. Ribosome imprint sequencing (Ribo-seq): After the leaf samples were ground, DNase I was used to remove DNA contamination, and then the RNA not protected by the ribosome was purified and digested with RNase I. The reaction was terminated with SUPERase-In RNase inhibitor, and then the library was constructed and sequenced using the Illumina Novaseq 6000 platform.

[0083] Through transcriptome sequencing (RNA-seq), mRNA m 6 A methylation sequencing (MeRIP-seq) and ribosomal imprinting sequencing (Ribo-seq) found that during leaf senescence, the expression level of EIN2, a key gene in the ethylene signaling pathway, remained unchanged, but the mRNA near its 3' untranslated region (3'UTR) increased. 6 A modification level decreased, and the translation efficiency of the gene was significantly improved ( Figure 4 ).

[0084] Further verification of downstream aging regulation-related genes in tobacco:

[0085] 1. 35S:LUC was transformed into pCAMBIA1300-cLuc vector, and cLuc was replaced with the complete fireflyluciferase sequence; 35S:LUC-EIN2 is a fusion vector of LUC sequence and CDS sequence of EIN2, and LUC is fused to the 5' end of EIN2 to simulate the m 6 A modified EIN2 gene; 35S:LUC-EIN2-3'UTR is a vector in which the LUC sequence is fused with EIN2 and its 3'UTR. LUC is fused to the 5' end of EIN2-3'UTR to simulate the m 6 A modified EIN2 gene; the construction of 35S:LUC-EIN2 and 35S:LUC-EIN2-3'UTR vectors and other methods refer to steps 1-7 of Example 2;

[0086] 2. Transform the recombinant plasmid into GV3101 competent cells;

[0087] 3. Prepare the infected Agrobacterium suspension and adjust the OD 600 When the value is 1, tobacco grown for 30 days is selected for Agrobacterium injection infection;

[0088] 4. Cultivate in the dark at 28℃ for one day, then incubate in the light for two days, coat the leaves with substrate and place them in a chemiluminescent developer for exposure and photography, and use ImageJ to calculate the fluorescence intensity;

[0089] The results of the tobacco transient transformation experiment showed that overexpression of the ALKBH10B gene could significantly inhibit the expression of the EIN2 gene ( Figure 5 A);

[0090] Further verification of downstream aging regulation-related genes in chrysanthemum protoplasts:

[0091] 1. Use the plasmid extraction kit (Huayueyang) to extract 35S:LUC, 35S:LUC-EIN2, 35S:LUC-EIN2-3'UTR and other plasmids for protoplast transformation;

[0092] 2. Select healthy leaves of chrysanthemum seedlings grown in tissue culture bottles for protoplast preparation, cut into leaf strips and put into the pre-prepared enzymatic solution, use tweezers to completely immerse the leaves in the enzymatic solution, and use a vacuum pump to evacuate for 5 minutes in the dark (wrap the conical bottle with tin foil). Shake the enzymatic solution at 50 rpm at 28°C in the dark;

[0093] 3. Wet a 75 μm cell sieve with W5 solution and filter the enzymatic solution containing protoplasts into a 50 mL round-bottom centrifuge tube. Centrifuge at 600 rpm, 25 °C, centrifugal acceleration a = 1, and centrifuge for 10 min to precipitate the protoplasts;

[0094] 4. Discard the supernatant, add 1 mL of W5, shake gently and slowly, then add 2 mL of W5, mix well, centrifuge at 600 rpm, 25 °C, centrifugal acceleration a=1, and centrifuge for 5 min;

[0095] 5. Discard the supernatant, add 1 mL MMg, shake gently and slowly, then add 2 mL MMg, centrifuge at 600 rpm, 25 °C, centrifugal acceleration a=1, and centrifuge for 5 min;

[0096] 6. Discard the supernatant, add an appropriate amount of MMg solution to resuspend, count using a hemocytometer, and adjust the protoplast density to 1×10 6 / mL, and place the protoplasts on ice for 30 minutes for transformation. The counting method and formula are as follows:

[0097] Place a 24mm×24mm cover glass on a 25×16 blood cell counting plate, add 5μL of purified protoplasts, and count the number of protoplasts in the four corners of the counting area and the square in the center;

[0098] 7. Dispense the protoplasts into 2mL sterile centrifuge tubes, 100μL per tube. Add 15μg of plasmid and (100+plasmid volume)μL of PEG-Ca2+ solution, and gently tap the tube wall to mix the protoplast solution and react for 15min.

[0099] 8. Stop the reaction: add 1 ml of W5, gently invert the centrifuge tube to terminate the reaction, centrifuge at 600 rpm, 25 ° C, centrifugal acceleration a = 1, and centrifuge for 4 minutes;

[0100] 9. Add 1 mL of WI and incubate at 25°C in the dark (with tin foil) for 14 h. Use the Novezan Dual Luciferase Reporter Assay Kit to detect the fluorescence signal intensity.

[0101] The results are as follows Figure 5 As shown in B and C, ALKBH10B was also found to significantly attenuate the translational repression of the EIN2 gene, thereby promoting leaf senescence.

[0102] In summary, the present invention regulates the expression of ALKBH10B gene to change the mRNA 6 A modification is used to regulate, thereby achieving the regulation of the aging process of plant leaves, providing a new idea for regulating plant growth and development, crop yield or quality and other traits, which is of great significance to the development of agricultural production and horticultural industry.

Claims

1. A method for regulating the senescence process of plant leaves, characterized in that: include: (1) Homologous cloning and isolation of RNAm of target plants 6 A demethylated gene ALKBH10B; (2) constructing a recombinant ALKBH10B gene regulatory vector based on the gene isolated in step 1; (3) introducing the recombinant vector obtained in step 2 into target plant cells; (4) Screen and regenerate transgenic plants with stably regulated ALKBH10B gene expression.

2. The method according to claim 1, characterized in that The plant in step 1 is a dicotyledonous plant.

3. The method according to claim 2, characterized in that The dicotyledonous plant is a plant of the Asteraceae, Cruciferae or Solanaceae family.

4. The method according to claim 1, characterized in that: RNAm 6 The enzymes encoded by the A demethylation gene ALKBH10B include: a. An enzyme having an amino acid sequence as shown in SEQ ID NO: 1; b. an enzyme having an amino acid sequence as shown in SEQ ID NO: 2; c. having at least 60% sequence identity with the amino acid sequence of SEQ ID NO: 1 or the amino acid sequence of SEQ ID NO: 2 and having RNA m 6 A homologous enzyme with demethylation function.

5. The method according to claim 1, characterized in that The recombinant ALKBH10B gene regulatory vector in step 2 is an overexpression vector or an inhibition vector.

6. The method according to claim 5, characterized in that The overexpression vector contains CaMV 35S promoter, Actin promoter, UBQ10 promoter, or any other constitutive high expression promoter.

7. The method according to claim 5, characterized in that The inhibition vector contains any one of miRNA, siRNA, sgRNA or antisense chain expression inhibition sequences.

8. The method according to claim 1, characterized in that The introduction method in step 3 is any one of Agrobacterium-mediated method, protoplast transformation method, viral vector delivery, pollen tube channel method, and gene gun method.

9. The method according to claim 1, characterized in that: The screening method in step 4 is any one of resistance gene screening, reporter gene screening, and molecular biological detection.

10. The method according to claim 1, characterized in that The regeneration method in step 4 is any one of explant induction, protoplast regeneration, callus regeneration, and Agrobacterium-mediated in vivo transformation.

Images