A method for regulating the senescence process of plant leaves
By isolating and introducing a recombinant vector containing the RNA m6A demethylation gene ALKBH10B, plant leaf senescence was regulated, solving the non-targeting effects and pesticide residue risks of chemical regulation methods. This enabled precise regulation of the leaf senescence process, improving crop yield and ornamental value.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-14
- Publication Date
- 2026-04-03
AI Technical Summary
Existing chemical regulation methods for controlling plant leaf senescence suffer from problems such as broad-spectrum regulation leading to non-targeted effects, chemical residue risks, and insufficient efficacy stability due to changes in environmental temperature and humidity, making it difficult to achieve precise spatiotemporal control.
The RNA m6A demethylation gene ALKBH10B was isolated by homologous cloning, a recombinant ALKBH10B gene regulatory vector was constructed, introduced into target plant cells, and transgenic plants that stably regulate the expression of the ALKBH10B gene were screened and regenerated. The leaf senescence process was regulated by overexpression or repression vectors.
It enables precise regulation of the senescence process of plant leaves, improves crop yield and quality, enhances the commercial value of ornamental plants, has strong applicability, and its genes are highly conserved in plants.
Smart Images

Figure CN119876243B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to genetic engineering, and more particularly to a method for regulating the senescence process of plant leaves. Background Technology
[0002] The green color of plant leaves originates from the efficient accumulation of chlorophyll within chloroplasts. This pigment converts light energy into chemical energy through photosynthesis, providing the essential energy and organic matter for plant growth. As the core site of photosynthesis, the functional stability of chloroplasts directly determines the physiological activity and lifespan of leaves. Under natural growth conditions, green leaves maintain the accumulation of substances and the developmental process of the plant through continuous photosynthesis. However, chlorophyll degradation and functional decline caused by leaf senescence mark the end of photosynthetic energy production and the initiation of nutrient redistribution.
[0003] The duration of healthy leaves has a dual regulatory value on crop yield and quality: delaying senescence prolongs the photosynthetic window, promoting the translocation of assimilates to grains or fruits, thereby increasing crop yield; conversely, inducing senescence accelerates the return of nutrients such as nitrogen and phosphorus to storage organs, optimizing crop quality. This "double-edged sword effect" requires precise regulation tailored to the needs of different crops—for example, yellowing and shedding of cotton leaves before harvest can reduce impurities during mechanical harvesting, thus improving operational efficiency; while leafy vegetables need to have their senescence process inhibited to extend their shelf life. Simultaneously, the targeted control of leaf color changes is also a core objective of improving the economic traits of ornamental plants. In horticulture, selecting varieties with alternating yellow and green colors or extended green periods can significantly enhance ornamental value and market competitiveness; while the early appearance of autumn colors in colorful foliage plants can create unique landscape economic effects. Such regulation not only meets diverse market demands but also provides a "trait-value" transformation path for agricultural production and the horticultural industry.
[0004] Currently, while traditional chemical regulation methods can partially intervene in the leaf senescence process, they have significant limitations: First, broad-spectrum regulation can easily lead to non-targeted effects, such as delaying leaf senescence while potentially inhibiting flower and fruit development; second, chemical residues may pose potential risks to soil ecology and agricultural product safety; and third, changes in environmental temperature and humidity often lead to insufficient stability of efficacy, making it difficult to achieve precise spatiotemporal control. Therefore, new methods for regulating the senescence process of plant leaves are still needed. Summary of the Invention
[0005] Purpose of the invention: The purpose of this invention is to provide a method based on RNA m 6 A method for regulating plant leaf senescence using the demethylation gene ALKBH10B, which is conserved in regulating plant leaf senescence.
[0006] Technical solution: The method for regulating the senescence process of plant leaves according to the present invention includes:
[0007] (1) Homologous cloning to isolate RNA m from the target plant 6 A demethylation gene ALKBH10B;
[0008] (2) Construct a recombinant ALKBH10B gene regulatory vector based on the gene isolated in step 1;
[0009] (3) Introduce the recombinant vector obtained in step 2 into the target plant cells;
[0010] (4) Screening and regeneration were carried out to obtain transgenic plants that stably regulate the expression of the ALKBH10B gene.
[0011] Preferably, the plant mentioned in step 1 is a dicotyledonous plant.
[0012] Preferably, the dicotyledonous plant is a plant of the Asteraceae, Brassicaceae, or Solanaceae families.
[0013] Preferably, the RNA m described in step 1 6 The enzyme encoded by the demethylation gene ALKBH10B includes:
[0014] a. An enzyme having the amino acid sequence shown in SEQ ID NO: 1;
[0015] b. An enzyme having the amino acid sequence shown in SEQ ID NO: 2;
[0016] c. Has at least 60% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 and possesses RNA m 6 A homologous enzyme with demethylation function.
[0017] Preferably, the recombinant ALKBH10B gene regulatory vector in step 2 is an overexpression vector or a repressor vector.
[0018] The overexpression vector contains a CaMV 35S promoter, an Actin promoter, a UBQ10 promoter, or any other constitutive overexpression promoter; the repression vector contains any one of a miRNA, siRNA, sgRNA, or antisense strand repression sequence.
[0019] Preferably, the import method in step 3 is any one of Agrobacterium-mediated transformation, protoplast transformation, viral vector delivery, pollen tube pathway, or gene gun method.
[0020] Preferably, the screening method in step 4 is any one of resistance gene screening, reporter gene screening, or molecular biological detection; the regeneration method is any one of explant induction, protoplast regeneration, callus regeneration, or Agrobacterium-mediated in vivo transformation.
[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. This method regulates RNAm 6 1. Expression of the demethylation gene ALKBH10B can effectively regulate the senescence process of plant leaves, thereby improving crop yield and quality, or enhancing the commercial value of ornamental plants; 2. The genes involved in this method are highly conserved in plants, have strong applicability, and great application potential. Attached Figure Description
[0022] Figure 1 The graph shows the regulatory effect of ALKBH10B gene expression on the leaf senescence process in Arabidopsis thaliana. Figures A and B show the results of PCR identification of homozygous mutants alkbh10b-1 and alkbh10b-2; Figures C and D show the differences in leaf senescence between homozygous alkbh10b-1, alkbh10b-2 mutants and wild-type Col-0 Arabidopsis thaliana after 50 days of culture; Figure E shows the statistical results of chlorophyll content in leaves at the same leaf position in homozygous alkbh10b-1, alkbh10b-2 mutants and wild-type Col-0 Arabidopsis thaliana after 30 and 50 days of culture.
[0023] Figure 2 The diagram shows the regulatory effect of ALKBH10B gene expression on the senescence process of chrysanthemum leaves. Figures A and B show the differences in leaf senescence and chlorophyll content at the same leaf position between ALKBH10Box(35S:ALKBH10B-GFP) transgenic plants and wild plants; Figures C and D show the differences in leaf senescence and chlorophyll content at the same leaf position between ami-ALKBH10B transgenic plants and wild plants.
[0024] Figure 3 To regulate ALKBH10B gene expression and regulate mRNA m 6 A-modified dot hybridization results;
[0025] Figure 4 To regulate ALKBH10B gene expression, the expression of the m gene on the CmEIN2 gene is affected. 6 A modification and expression, and the resulting regulation of leaf senescence;
[0026] Figure 5 The results of the experiment show that overexpression of the ALKBH10B gene significantly inhibited the translation of the EIN2 gene and promoted leaf senescence. Figure A shows the results of the transient transformation experiment in tobacco; Figures B and C show the results of the transient transformation experiment in chrysanthemum protoplasts. Detailed Implementation
[0027] The technical solution of the present invention will be further described below.
[0028] Example 1: m6 Effects of knockout of the A demethylase-encoding gene ALKBH10B on the senescence process of Arabidopsis leaves
[0029] 1. Purchase Arabidopsis thaliana mutants alkbh10b-1 (SALK_004215C) and alkbh10b-2 (SALK_107289C) from the AraShare database (www.arashare.cn);
[0030] 2. After disinfecting and drying the mutant and wild-type Arabidopsis thaliana Col-0 seeds with alcohol, they were planted on sterile 1 / 2 MS medium and placed in a 4°C environment for 4 days, and then transferred to a 22°C light incubator for germination.
[0031] 3. Arabidopsis seedlings germinating on 1 / 2 MS medium were transferred to plug culture trays and cultured at 22℃ under 16h light / 8h dark conditions. During this period, homozygous mutants were identified by PCR. Figure 1 (A and B).
[0032] The PCR identification primers are as follows:
[0033] atalkbh10b-1-LP,TCCCTCTCATCACCACAAAG;
[0034] atalkbh10b-1-RP,ATGCCATAGCCATGAAGATTG;
[0035] atalkbh10b-2-LP, AGTAGAAAACACATGCCTCGG;
[0036] atalkbh10b-2-RP, TTAACATCGAGCCAATTCCAC;
[0037] LBb1.3,ATTTTGCCGATTTCGGAAC;
[0038] 4. Homozygous alkbh10b-1 and alkbh10b-2 mutants and wild-type Col-0 Arabidopsis thaliana were selected for further culture, and significant differences in leaf senescence were observed among these plants after 50 days of culture. Figure 1 C and D);
[0039] 5. Chlorophyll content was measured on leaves from different plants at the same leaf position. The method was as follows: the leaves were placed in 80% acetone (v / v) and incubated in the dark for 24 hours. The absorbance values at 645 nm and 657 nm of the extract were measured, and the chlorophyll content was calculated using the following formula:
[0040]
[0041] The results are as follows Figure 1 As shown in E, after 30 or 50 days of culture, the homozygous alkbh10b-1 and alkbh10b-2 mutants had higher chlorophyll content in leaves at the same leaf position compared to wild-type Col-0 Arabidopsis.
[0042] Example 2: Regulation of m 6 A demethylase encoding gene ALKBH10B regulates the senescence process of chrysanthemum leaves.
[0043] 1. Based on the Arabidopsis ALKBH10B gene, homologous sequences were compared with those in the Chrysanthemum morifolium genome. Primers were designed using the sequence with the highest consistency, and gene cloning was performed using Thermo Scientific Phusion high-fidelity DNA polymerase (PCR reaction system is shown in Table 1, reaction procedure is shown in Table 2). The cDNA used in the PCR experiment was derived from the reverse transcription product of Chrysanthemum 'Hua Ling' mRNA.
[0044] Table 1 PCR reaction system
[0045]
[0046] Table 2 PCR reaction procedures
[0047]
[0048] 2. After purification, the PCR product was ligated into pMD 19-T Vector (Takara). The sequence that was similar to the reference gene sequence and had high consistency with multiple sequencing results was selected as the final cloning result. Its encoded amino acid sequence is SEQ ID NO: 2.
[0049] 3. The plant overexpression vector used in this experiment was pORE-R4-35AA, which was modified from the empty vector pORE-R4 (GenBank: AY562547.1) without a promoter;
[0050] 4. Design primers with recombinant arms, with detailed sequences as follows: ALKBH10B-R4-BamHI-F, tttttctagaaggccttggatccaATGGCGCCGGCGGCGATTAT; ALKBH10B-R4-EcoRI-R, ggccgcaaagtcgacgaattctAGCAACACTGATTCCAGAACCGGGGTTT; Use the ALKBH10B vector ligated to pMD19-TVector in step 2 as a template to obtain the target fragment by PCR. The PCR reaction system and procedure are the same as in step 1.
[0051] 5. The pORE-R4-35AA vector was digested with BamHI and EcoRI, and the linearized vector was recovered by electrophoresis gel digestion.
[0052] 6. The recovered product was used for recombination reaction using ClonExpressUltraOneStepCloning KitV2 (Vazmye). The recombinant product was transformed into DH5α competent cells (biotech), plated on a plate containing kanamycin resistance, cultured overnight at 37°C, single clones were picked, bacterial tests were performed, and sequencing was performed to obtain the 35S:ALKBH10B-GFP vector.
[0053] 7. The 35S:ALKBH10B-GFP vector recombinant plasmid was transformed into EHA105 Agrobacterium competent cells. Single clones were picked for bacterial culture PCR identification. The EHA105 plasmid was extracted, transformed back into DH5α, and then the plasmid was sent for testing to confirm that the Agrobacterium transformation was successful.
[0054] 8. Based on the CmALKBH10B cloned in step 2, design artificial small interfering RNA primers:
[0055] I:gaTAATTAGATGGTCAATCGCGCtctctcttttgtattcc;
[0056] II: gaGCGCGATTGACCATCTAATTAtcaaagagaatcaatga;
[0057] III: gaGCACGATTGACCAACTAATTTtcacaggtcgtgatatg;
[0058] IV: gaAAATTAGTTGGTCAATCGTGCtctacatatatattcct.
[0059] 9. Using pRS300 (miR319a pBSK) as the backbone, design universal pre- and post-primers at its 5' and 3' ends.
[0060] A:gagtttttctagaaggccttggatccCTGCAAGGCGATTAAGTTGGGTAAC;
[0061] B: gatgcggccgcaaagtcgacgaattcGCGGATAACAATTTCACACAGGAAA;
[0062] PCR amplification was performed using primers A and IV, II and III, and I and B to obtain three fragments a, b, and c, with the PCR system being the same as in step 1. A second round of PCR amplification was performed using fragments a, b, and c as templates to obtain fragment d. Fragment d was then recombined with the linearized pORE-R4-2×35S vector using recombinase.
[0063] 10. Transform the recombinant product into DH5α competent cells (Sangon Biotech), plate it onto a plate containing kanamycin resistance, incubate overnight at 37°C, pick single colonies, perform bacterial testing, sequence the samples to obtain the amiR-ALKBH10B vector, transform it into EHA105 competent cells, and identify it using the same method as in step 7.
[0064] 11. Select healthy 'Hua Ling' tissue culture seedlings that are about 2 months old, prepare leaf discs, and place them in an MS plate containing 500 μL of 1 mg / mL 6-BA and 250 μL of 1 mg / mL NAA at a 1:0.5 ratio for 3 days of inverted culture.
[0065] 12. Agrobacterium tumefaciens bacterial solution OD 600 Adjust the pH to 0.6-0.8, place the leaf disc in the bacterial solution for 8 minutes, remove the leaf disc, blot the liquid on the leaf disc with filter paper, and transfer the infected leaf disc to a 1 / 0.5 plate for dark incubation for three days.
[0066] 13. Transfer the leaf disc to a solution containing 2.5 mL of cephalosporin at a concentration of 100 mg / L (cytokinin:auxin).
[0067] =1:0.5 decarboxylation plates, inverted and cultured for seven days;
[0068] 14. Following the sequence of selections one through four, change the plates sequentially, with each phase lasting 14 days. Plate one contains 1.75 mL of 100 mg / L cephalosporin and 100 μL of 50 mg / L kanamycin in a cytokinin:auxin ratio of 1:0.5. Plate two contains 1.5 mL of 100 mg / L cephalosporin and 90 μL of 50 mg / L kanamycin in a cytokinin:auxin ratio of 1:0.5. Plate three contains 1.25 mL of 100 mg / L cephalosporin and 80 μL of 50 mg / L kanamycin in a cytokinin:auxin ratio of 1:0.3. Plate four contains 1 mL of 100 mg / L cephalosporin and 70 μL of 50 mg / L kanamycin in a cytokinin:auxin ratio of 1:0.1. Transfer the unrooted seedlings to rooting bottles for further culture.
[0069] 15. Extract DNA from seedling leaves for PCR and sequencing identification; after positive seedlings are planted, take leaves again for identification, and extract RNA from the leaves for qPCR identification to confirm that the target gene is regulated and expressed.
[0070] We found that the 35S:ALKBH10B-GFP transgenic plants exhibited premature leaf senescence, while the amiR-ALKBH10B transgenic plants exhibited delayed leaf senescence. Figure 2 This indicates that in chrysanthemums, by regulating m 6 The expression of A-modified enzymes can significantly regulate the leaf yellowing process. Combined with the results described in Example 1, this illustrates the role of m in different plants. 6 The A demethylase encoding gene ALKBH10B is conserved in regulating plant leaf senescence.
[0071] Example 3: The ALKBH10B gene via m 6 Mechanism by which A modification affects the senescence process of plant leaves
[0072] 1. Leaves from the same leaf position of different transgenic plants in Example 2 were selected, and total RNA was extracted from the tissues using the RNeasy Plus Mini kit (QIAGEN).
[0073] 2. Incubate the total RNA at 95°C for 3 minutes, then quickly transfer it to ice water for pre-cooling;
[0074] 3. Take an equal amount of RNA and spot it onto an Amersham Hybond-N+ membrane (GE Healthcare, RPN3050B). Then, crosslink it with UV light, block it with BSA, and label it with m6A antibody (202-003; Synaptic Systems) and goat anti-rabbit (Bio-Rad 170-6516) secondary antibody.
[0075] 4. Incubate the membrane with the SuperSignal Kit (Pierce) reagent and develop it;
[0076] 5. The input control was stained with methylene blue (MB). The Amersham Hybond-N+ membrane (GE Healthcare, RPN3050B) containing the sample was placed in a 0.2% methylene blue solution, and the color was developed before taking a picture for recording.
[0077] By detecting mRNA in ALKBH10B transgenic material 6 At the A modification level, it was found that ALKBH10B could significantly inhibit m6A modification ( Figure 3 Therefore, the ALKBH10B gene mainly regulates leaf senescence in plants by influencing the m6A modification of mRNA in plants.
[0078] To further investigate how ALKBH10B affects m 6 The mechanism by which A-modification regulates leaf senescence was investigated, and the downstream senescence-related genes affected by this process were explored.
[0079] 1. Select mature green leaves and leaves in the early senescence stage from the same plant, and extract total RNA using the RNeasy Plus Minikit (QIAGEN) kit.
[0080] 2. Total RNA samples were sent to Beijing Novogene Technology Co., Ltd. for mRNA analysis. 6 A-methylation sequencing (MeRIP-seq) was performed, with mRNA purified using oligo-d(T)25 magnetic beads. The mRNA was then fragmented into approximately 100 bp fragments using fragmentation buffer (10 mM Tris-HCl [pH 7.0], 10 mM ZnCl2). 6 Antibody A was incubated, followed by washing and purification of mRNA fragments. The mRNA was then used without further treatment. 6 mRNA fragments incubated with antibody A were used as input controls to construct sequencing libraries, which were then sequenced using the Illumina NovaSeq 6000 sequencing platform.
[0081] 3. The extracted total RNA was sent to Annoroad Gene Technology (Beijing) Co., Ltd. for transcriptome sequencing (RNA-seq) using the BGI Genomics DNBSEQ-T7 sequencing platform;
[0082] 4. Ribo-seq: After tissue grinding, leaf samples were cleaned and DNA contamination was removed using DNase I. The unprotected RNA was then purified and digested with RNase I. The reaction was terminated using a SUPERase-In RNase inhibitor. After library construction, sequencing was performed using the Illumina Novaseq 6000 platform.
[0083] Transcriptome sequencing (RNA-seq) and mRNA analysis were performed on mature leaves (Green) and senescent leaves (Sen). 6 MeRIP-seq and Ribo-seq revealed that the expression level of EIN2, a key gene in the ethylene signaling pathway, remained unchanged during leaf senescence, but the expression level of m-molecules near its 3' untranslated region (3'UTR) remained unchanged. 6 A decrease in A modification level significantly improves the translation efficiency of this gene. Figure 4 ).
[0084] Further validation of downstream aging-regulating genes in tobacco:
[0085] 1. 35S:LUC is modified from the pCAMBIA1300-cLuc vector, replacing cLuc with the complete fireflyluciferase sequence; 35S:LUC-EIN2 is a fusion vector of the LUC sequence and the CDS sequence of EIN2, with LUC fused at the 5' end of EIN2, used to simulate the lack of m 6 A-modified EIN2 gene; 35S:LUC-EIN2-3'UTR is a vector fused with the LUC sequence to EIN2 and its 3'UTR, with the LUC fused at the 5' end of the EIN2-3'UTR, used to simulate the gene with m 6 The methods for constructing the A-modified EIN2 gene, 35S:LUC-EIN2, and 35S:LUC-EIN2-3'UTR vectors are as described in steps 1-7 of Example 2.
[0086] 2. Transform the recombinant plasmid into GV3101 competent cells;
[0087] 3. Prepare an Agrobacterium suspension and adjust the OD. 600 With a value of 1, tobacco plants that have grown for 30 days were selected for Agrobacterium injection infection;
[0088] 4. The leaves were cultured in the dark at 28℃ for one day, followed by two days of light culture. The substrate was then coated on the leaves and exposed and photographed in a chemiluminescence developer. The fluorescence intensity was then counted using ImageJ.
[0089] The transient transformation experiment of tobacco showed that overexpression of the ALKBH10B gene significantly inhibited the expression of the EIN2 gene. Figure 5 A);
[0090] Further validation of downstream aging-regulating genes in chrysanthemum protoplasts:
[0091] 1. Plasmids such as 35S:LUC, 35S:LUC-EIN2, and 35S:LUC-EIN2-3'UTR were extracted using a plasmid extraction kit (Huayueyang) for protoplast transformation;
[0092] 2. Select healthy chrysanthemum seedling leaves from tissue culture flasks for protoplast preparation. Cut the leaves into strips and place them into the pre-prepared enzymatic hydrolysate. Use tweezers to completely immerse the leaves in the hydrolysate. Use a vacuum pump to evacuate the solution in the dark (with the conical flask wrapped in aluminum foil) for 5 minutes. Perform enzymatic hydrolysis at 28℃ in the dark, shaking at 50 rpm.
[0093] 3. Wet a 75μm cell sieve with W5 solution, and filter the enzymatic hydrolysate containing protoplasts into a 50mL round-bottom centrifuge tube. Centrifuge at 600rpm, 25℃, with an acceleration a=1, for 10min to precipitate the protoplasts;
[0094] 4. Discard the supernatant, add 1 mL of W5, shake gently and slowly, then add 2 mL of W5, mix well, centrifuge at 600 rpm, 25℃, with an acceleration a = 1, for 5 min;
[0095] 5. Discard the supernatant, add 1 mL MMg, shake gently and slowly, then add 2 mL MMg, centrifuge at 600 rpm and 25°C with an acceleration a = 1 for 5 min;
[0096] 6. Discard the supernatant, resuspend the protoplasts in an appropriate amount of MMG solution, count them using a hemocytometer, and adjust the protoplast density to 1×10⁻⁶. 6 The protoplasts were counted at a density of 1 / mL and incubated on ice for 30 minutes for transformation. The counting method and formula are as follows:
[0097] Place a 24mm×24mm coverslip on a 25×16 hemocytometer, add 5μL of purified protoplasts, and count the number of protoplasts in the four corners and the center square of the counting area.
[0098] 7. Dispense protoplasts into 2 mL sterile centrifuge tubes, 100 μL per tube. Add 15 μg of plasmid and (100 + plasmid volume) μL of PEG-Ca2+ solution. While adding, gently tap the tube wall to mix the protoplast solution and react for 15 min.
[0099] 8. Termination of reaction: Add 1 ml of W5, gently invert the centrifuge tube to completely terminate the reaction, centrifuge at 600 rpm, 25°C, with centrifugation acceleration a = 1, for 4 min;
[0100] 9. Add 1 mL of WI and incubate at 25°C in the dark (using aluminum foil) for 14 hours. Detect the fluorescence signal intensity using the Novizan Dual Luciferase Reporter Assay Kit.
[0101] The results are as follows Figure 5 As shown in B and C, ALKBH10B was also found to significantly reduce translational repression of the EIN2 gene, thereby promoting leaf senescence.
[0102] In summary, this invention modulates the expression of the ALKBH10B gene, thereby altering the mRNA m... 6 Modification of A can be used to regulate the senescence process of plant leaves, providing a new approach to regulating traits such as plant growth and development, crop yield, or quality. This is of great significance to the development of agricultural production and the horticulture industry.
Claims
1. A method for regulating the senescence process of plant leaves, characterized in that, include: (1) Homologous cloning to isolate RNA m from the target plant 6 A demethylation gene ALKBH10B ; (2) Construct recombination based on the genes isolated in step 1. ALKBH10B Gene regulatory vectors; (3) Introduce the recombinant vector obtained in step 2 into the target plant cells; (4) Screening and regeneration to obtain stable regulation ALKBH10B Transgenic plants expressing genes; The target plant is Arabidopsis thaliana, tobacco, or chrysanthemum, and the recombinant... ALKBH10B The original vector for gene regulation was either pORE-R4-35AA or pORE-R4-2×35S; the RNA m described in step 1 6 A demethylation gene ALKBH10B The encoded enzyme is: a. An enzyme having the amino acid sequence shown in SEQ ID NO: 1; b. An enzyme having the amino acid sequence shown in SEQ ID NO:
2.
2. The method according to claim 1, characterized in that, The recombination described in step 2 ALKBH10B Gene regulation vectors are either overexpression vectors or repression vectors.
3. The method according to claim 2, characterized in that, The repressor vector contains any one of the repressor expression sequences of miRNA, siRNA, sgRNA, or antisense strand.
4. The method according to claim 1, characterized in that, The import method described in step 3 is any one of Agrobacterium-mediated transformation, protoplast transformation, viral vector delivery, pollen tube pathway, or gene gun method.
5. The method according to claim 1, characterized in that, The screening method described in step 4 can be any one of resistance gene screening, reporter gene screening, or molecular biological detection.
6. The method according to claim 1, characterized in that, The regeneration method described in step 4 is any one of explant induction, protoplast regeneration, callus regeneration, or Agrobacterium-mediated in vivo transformation.
Citation Information
Patent Citations
Protein ClALKBH2B, gene, expression vector, transformant and method capable of inhibiting accumulation of CGMMV
CN112920262A
Method for controlling flowering time by regulating of SVP-FLM-beta protein complex formation
US20150197761A1