Polymeric particles for proximity-based cellular DNA-encoded library screening and methods of use

Abstract

Provided herein are compositions comprising a particle comprising a library encoded bead (e.g., DEL bead) coated in a polymeric matrix forming a core-shell particle, wherein the core-shell particle is further inside a 3D tissue culture. Also provided herein are methods of making such particles, and methods of using such particles for drug discovery such as identification of bioactive compounds via high-throughput cellular activity-based phenotypic screens of DNA-encoded chemical library beads.

Description

Attorney Docket No.: 146392068340-P39714WO1POLYMERIC PARTICLES FOR PROXIMITY-BASED CELLULAR DNA- ENCODED LIBRARY SCREENING AND METHODS OF USE CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to U. S. Provisional Application Serial No.63 / 710,388, filed October 22, 2024, and U. S. Provisional Application Serial No. 63 / 755,741, filed February 7, 2025, each of which are hereby incorporated herein by reference in their entirety.STATEMENT REGARDING FEDERAL RIGHTS

[0002] This invention was made with Government support under Grant No. GM140890, awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] The contents of the electronic sequence listing (146392068340SEQLIST.xml; Size: 4,489 bytes; and Date of Creation: October 9, 2025) is herein incorporated by reference in its entirety.FIELD OF THE INVENTION

[0004] The present invention relates to compositions comprising a particle comprising a library encoded bead (e.g., DEL bead) coated in a polymeric matrix forming a core-shell particle, wherein the core-shell particle is further inside a 3D tissue culture. The present invention also relates to methods of making such particles, and methods of using such particles for drug discovery such as identification of bioactive compounds via high-throughput cellular activity -based phenotypic screens of DNA-encoded chemical library beads.BACKGROUND OF THE INVENTION

[0005] Phenotypic cellular screening can be critical in early drug discovery, particularly in the serendipitous discovery of bioactive small molecules that affect difficult-to-drug proteins and pathways (Moffat et al. Nature Reviews Drug Discovery, 2017, 16, 531-543, Brown et al. J. Med. Chem. 2020, 63, 5, 1823-1840). Example discoveries of small molecule 1MF-363428659Attorney Docket No.: 146392068340-P39714WO1function through phenotypic screens include a selective inhibitor of PCSK9 translation that lowers cholesterol by ablating PCSK9-mediated lysosomal LDL receptor degradation (Petersen et al. Cell Chemical Biology, 2016, 23, 1362-1371), an SMN2 mRNA splicing modulator that promotes exon inclusion and restores SMN2 function in spinal muscular atrophy (Naryshkin et al. Science, 2014, 345, 688-693), and a promoter of mesenchymal stem cell chondrogenesis that addresses osteoarthritis (Johnson et al. Science, 2012, 336, 717-721). Phenotypic drug discovery often seeds first-in-class therapies (Sadri J. Med.Chem. 2023, 66, 18, 12651-12677), though at the expense of high-throughput screening (HTS) experiments, which require demanding infrastructure, costly cellular assay reagent scale-up, and risk associated with limited HTS compound libraries.

[0006] Compound library scope and screening risks have been largely mitigated with the emergence of DNA-encoded library (DEL) technology. DELs are combinatorially synthesized compound collections comprising millions to billions of unique small molecules, each attached to a DNA barcode that describes the small molecule’s synthesis history.(Mannocci et al. PNAS, 2008, 105, 17670-17675, Clark et al. Nature Chemical Biology 2009, 5, 647-654, Satz et al. Nature Reviews Methods Primers, 2022, 2, 3). Affinity selection using a highly purified protein target, the predominant strategy for ligand identification from DELs, has successfully generated numerous bioactive small molecules across many target classes, with a handful of DEL-derived leads now entering clinical trials (Harris 2017, Cuozzo 2020, Ding 2021). DEL has also become a valuable tool for previewing target tractability before HTS (Evindar 2017). The scope of DNA-compatible chemical reactions has expanded (Fitzgerald 2021), making DEL platforms powerful engines for preparing and exploring new chemical spaces in the context of increasingly difficult-to-ligand targets (Kung 2020). Protein complexes and particularly cell signaling pathways remain high-priority areas of exploration for the afore-mentioned reasons. However, prosecuting such targets with DEL has been challenging as they are not amenable to purification and affinity selection (Goodnow 2017). In all cases, though, DEL affinity hits are not guaranteed to influence cellular physiology or even penetrate a cell membrane as they are only isolated on the basis of binding to a purified protein target.

[0007] Several strategies for screening cellular targets have emerged as DEL technology has evolved. Overexpression of cell surface receptors and subsequent selection on live cells has furnished ligands for tachykinin neurokinin III (NK3), carbonic anhydrase XII (CAXII),2MF-363428659Attorney Docket No.: 146392068340-P39714WO1folate receptor, and epidermal growth factor receptor (Wu 2015, Huang 2021). However, these selections do not warrant that the bound molecules are active; they frequently exhibit an interesting spread of potential activities. For example, GSK’s NK3 selections enriched solely antagonists. Krusemark devised a receptor signaling-dependent protein complementation step to bias selection output for functional opioid receptor ligands (Cai 2023).

[0008] The field has long-desired methods for directly isolating DEL members based on cellular activity. Intracellular DEL affinity selections, either via cell-penetrating peptide (Cai 2019) or Vipergen’s direct transfection into oocytes (Petersen 2019), enable interrogation of challenging targets that may not purify to homogeneity, addressing a key obstacle in selection target preparation. However, aside from low-throughput and manual antibacterial discovery using DEL bead diffusion lawn assays (Cochrane 2021), phenotypic DEL screening technology has remained almost undeveloped.

[0009] The chemical structure and nature of DELs fundamentally prohibits their use in phenotypic cell-based screens, but solid-phase chemical synthesis can sidestep this limitation. DELs are highly complex mixtures of DNA-tagged small molecules. There is insufficient concentration of any one library member to drive a cellular signaling event. Previously, DEL and one-bead-one-compound (OBOC) paradigms have been merged, furnishing libraries of beads that physically localize many copies of one member (100 firnol per 10-pm-dia bead) (Lam et al. Chemical Reviews 1997, 97, 411-448; MacConnell et al. ACS Combinatorial Science 2015, 17, 518-534). OBOC-DELs can be directly screened for activity by encapsulating the beads into microfluidic water-in-oil droplets of biochemical assay reagent (Cochrane et al. ACS Combinatorial Science 2019, 21, 425-435; Hackler et al. ACS Combinatorial Science 2020, 22, 25-34; Fitzgerald et al. ACS Medicinal Chemistry Letters 2023, 14, 1295-1303), fluorescence-activated cell sorting (FACS)-based binding screening (Mendes et al. ACS Chemical Biology 2017, 12, 234-243; Benhamou et al. PNAS 2022, 119: Meyer et al. JACS 2022, 144, 21096-21102), and bacterial cytotoxicity-based lawn screening (Cochrane et al. ACS Chemical Biology 2021, 16, 2752-2756). OBOC-DEL screens have addressed difficult targets, such as whole bacterial cells and dynamic RNA secondary structures, but there are no technologies that interface such libraries directly with complex tissue-scale structures for phenotypic screening.

[0010] Therefore, there is a need to develop high-throughput phenotypic DEL screening technologies that allow one to screen DELs directly for cell-active compounds, even when 3MF-363428659Attorney Docket No.: 146392068340-P39714WO1the cellular target is unknown. Such technologies can enable a user to find disease-correcting molecules based on phenotypic cellular screens, which are fundamental to the discovery of first-in-class therapies.BRIEF SUMMARY

[0011] In one aspect, provided herein is a composition comprising (i) a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell; and (ii) cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells. In some embodiments, the composition is a 3D tissue culture composition. In some embodiments, the polymeric matrix comprises a signal detection element and a cell adhesion promoter. In some embodiments, the cell adhesion promoter is immobilized in the polymeric matrix via covalent or non-covalent binding. In some embodiments, the signal detection element is immobilized in the polymeric matrix via covalent or non-covalent binding. In some embodiments, the signal detection element comprises a reporter ligand and / or a reporter probe. In some embodiments, a reporter binds to the reporter ligand. In some embodiments, the reporter is a cherry -HaloTag fusion protein. In some embodiments, a reporter transforms the reporter probe to a detectable product. In some embodiments, the reporter is an enzyme selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, luciferase, and enterokinase. In some embodiments, the cell synthesizes the reporter. In some embodiments, the cell synthesizes the reporter in response to a stimulus. In some embodiments, the cell secretes the reporter. In some embodiments, the cell displays the reporter on the cell surface.

[0012] In some embodiments, the engineered reporter cell line comprises varying degrees of gene expression levels via selection of different strength synthetic promoters or the use of endogenous promoters. In some embodiments, the high gene expression promoter or the low gene expression promoter is selected from the group consisting of PGK gene expression promoter and CAG gene expression promoter. In some embodiments, the reporter ligand is selected from the group consisting of chlorohexane HaloTag ligand, methacrylamide-modified chlorohexane HaloTag ligand, HaloTag diAcFAM ligand, HaloTag PEG-biotin ligand, HaloTag amine-PEG-biotin ligand, HA tag, Flag tag, S-tag, glutathione, NTA, and maltose. In some embodiments, the reporter probe comprises a detectable tag comprising an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity. In some embodiments, the oligonucleotide is a methacrylamide-modified oligonucleotide. In some 4MF-363428659Attorney Docket No.: 146392068340-P39714WO1embodiments, the probe of enzymatic activity is a methacrylamide-modified probe. In some embodiments, the cell adhesion promoter and the signal detection element are attached to the polymer matrix through copolymerization, hybridization, or click chemistry. In some embodiments, the reporter ligand or the reporter probe is conjugated to an oligonucleotide, wherein the oligonucleotide is hybridized to the polymer matrix comprising a complementary oligonucleotide.

[0013] In some embodiments, the cells are engineered HEK293T cells. In some embodiments, the composition is a 3D cellular culture. In some embodiments, the cells comprise seeded and viable cells. In some embodiments, the encoded library bead comprises an encoding tag and a library member, wherein the library member is a stimulus for a cell to synthesize a reporter. In some embodiments, the encoded library bead is a DNA-encoded library (DEL) bead. In some embodiments, the DEL bead of the core-shell particle comprises a DNA-encoding tag and a DEL member. In some embodiments, the DEL member is a stimulus for a cell to synthesize a reporter. In some embodiments, the DEL member’s structure is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled. In some embodiments, the DEL member is attached to the DEL bead of the core-shell particle via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker. In some embodiments, the photocleavable linker is configured to release the DEL member upon photo-induced cleavage.

[0014] In some embodiments, the photo-induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the DNA-encoding tag is configured to remain attached to the DEL bead of the core-shell particle when irradiated. In some embodiments, the reporter is inducible. In some embodiments, expression of the reporter in a cell is induced by activation or repression of the cell signaling pathway. In some embodiments, the expression of the cell signaling pathway is activated or repressed by a stimulus, wherein the stimulus is the DEL member. In some embodiments, the DEL member is a stimulator of interferon genes (STING) agonist or STING antagonist. In some embodiments, the STING agonist is 4-(5,6-dimethoxybenzo[b]thiophen-2-yl)-4-oxobutanoic acid. In some embodiments, the released DEL member is in a concentration gradient around the DEL bead of the core-shell particle. In some embodiments, the concentration of the DEL member is highest closer to the bead. In some embodiments, the particle has a diameter of5MF-363428659Attorney Docket No.: 146392068340-P39714WO1about 10 µm to about 40 µm. In some embodiments, the particle has a dry diameter of about 20 pm, or hydrated diameter about 37 pm. In some embodiments, the particle has a dry diameter of about 20 pm. In some embodiments, the particle has a hydrated diameter between about 34 pm and 38 pm. In some embodiments, the cell adhesion promoter is selected from the group consisting of gelatin, gelatin methacrylate, and methacrylated collagen.

[0015] In another aspect, provided herein is a method of screening an encoded library for activity in vivo in a cell culture comprising i)irradiating a composition, comprising a coreshell particle comprising an encoded library bead as the core and a polymeric matrix as the shell, and cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells, with violet light, wherein a photocleavable linker attaching a library member to the encoded library bead is cleaved and the library member is released; and ii) detecting binding of a reporter to a reporter ligand or a detectable product resulting from an interaction between a reporter and a reporter probe in the polymeric matrix, wherein the reporter is synthesized by the cell upon activation or repression of a cell signaling pathway caused by the library member. In some embodiments, the encoded library is a DNA-encoded library (DEL). In some embodiments, the reporter probe or the reporter ligand comprises a detectable tag, comprising an oligonucleotide, an antibody epitope, or a probe of enzymatic activity. In some embodiments, the detectable tag is attached to the polymeric matrix either covalently or non-covalently. In some embodiments, the oligonucleotide and / or the antibody epitope and / or the probe of enzymatic activity are covalently incorporated as a copolymer in the polymeric matrix. In some embodiments, the cells are optionally dissociated with the core-shell particle and the core-shell particles are further sorted by flow cytometry. In some embodiments, the composition is sorted by flow cytometry, wherein the composition comprises the core-shell particle and the cells. In some embodiments, the composition comprises a 3D tissue culture composition. In some embodiments, the violet light has a wavelength of about 400 nm. In some embodiments, the library member is a DEL member comprising STING agonist or STING antagonist. In some embodiments, the core-shell particle has a diameter of about 10 pm to about 50 pm. In some embodiments, the cells are engineered HEK293T cells. In some embodiments, the composition has a 3D cellular culture.

[0016] In yet another aspect, provided herein is a method of producing a composition comprising the core-shell particle, comprising emulsifying an aqueous solution comprising6MF-363428659Attorney Docket No.: 146392068340-P39714WO1acrylamide monomer, reporter ligand, reporter probe, ammonium persulfate polymerization catalyst, and encoded library beads with an oil phase containing tetramethylethylenediamine (TEMED) catalyst and thereby producing the composition comprising the encoded library bead core and the polymeric matrix shell; wherein the reporter ligand and / or the reporter probe, are covalently and / or non-covalently incorporated in the polymeric matrix. In some embodiments, the encoded library bead is DNA-encoded library bead. In some embodiments, the reporter ligand or the reporter probe comprises oligonucleotide, methacrylamide-modified oligonucleotide, antibody epitope, and probe of enzymatic activity. In some embodiments, the reporter ligand is methacrylamide-modified chlorohexane HaloTag ligand. In some embodiments, the enzymatic activity probe is methacrylamide-modified. In some embodiments, the polymeric matrix further comprises a cell adhesion promoter.

[0017] In another aspect, provided herein is a method further comprising seeding the polymeric matrix of the core-shell particle with cells and culturing the seeded core-shell particle in a media, thereby producing a composition comprising a 3D tissue culture comprising seeded cells and viable cells, wherein the polymeric matrix of the core-shell particle serves as a substrate for the 3D tissue culture. In some embodiments, the 3D tissue has a spheroid culture. In some embodiments, the 3D tissue culture comprises cells that synthesize reporters when stimulated. In some embodiments, the cells secrete reporters in response to a stimulus. In some embodiments, the reporter is a cherry-HaloTag fusion protein. In some embodiments, the cells synthesize enzymatic reporters when stimulated. In some embodiments, the enzymatic reporter is selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, beta lactamase, rhamnase, luciferase, and enterokinase. In some embodiments, the polymeric matrix comprises gelatin, gelatin methacrylate, and methacrylated collagen. In some embodiments, the encoded library bead of the core-shell particle comprises a DNA-encoding tag and a DEL library member. In some embodiments, the DEL library member’s structure is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled. In some embodiments, the DEL library member is attached to the DEL bead of the core-shell particle via a photocleavable linker. In some embodiments, the photocleavable linker cleaves after irradiation and releases the DEL library member. In some embodiments, the photocleavable linker is a nitrobenzene-derived moiety. In some embodiments, the DNA-encoding tag remains attached to the DEL bead of the core-shell particle despite the irradiation. In some embodiments, the DEL library member stimulates cells to synthesize a reporter. In some7MF-363428659Attorney Docket No.: 146392068340-P39714WO1embodiments, the DEL library member stimulates cells to secrete an affinity-tagged fluorescent protein reporter.

[0018] In some embodiments, the DEL library member is a STING agonist or a STING antagonist. In some embodiments, the irradiation is with violet light having a wavelength of about 400 nm. In some embodiments, the released DEL library member is in a concentration gradient around the DEL bead of the core-shell particle. In some embodiments, the cells directly attached to the polymeric matrix of the core-shell particle receive the highest concentration of the released DEL library member. In some embodiments, the cells are optionally dissociated with the core-shell particle and the core-shell particles are further sorted by flow cytometry. In some embodiments, the composition is sorted by flow cytometry, wherein the composition comprises the core-shell particle and the cells.

[0019] In another aspect, provided herein is a 3D tissue culture composition comprising the core-shell particle produced by the methods mentioned above. In some embodiments, provided herein is a library of the 3D tissue culture compositions comprising the core-shell particles produced by the methods. In some embodiments, provided herein is a high-throughput screening method comprising a phenotypic DEL screening of the library for a compound. In some embodiments, the phenotypic DEL screening does not require a known cellular target. In some embodiments, the phenotypic DEL screening is a phenotypic cellular screening. In some embodiments, the phenotypic cell screening comprises detection of a cellular activity. In some embodiments, the cellular activity is cell signaling. In come embodiments, the cell signaling comprises a fluorescence signal. In some embodiments, the compound is a molecule that penetrates the plasma membrane and modulates complex signaling pathways.

[0020] In another aspect, provided herein is a kit comprising the 3D tissue culture composition. In yet another aspect, provided herein is a kit comprising the library of the 3D tissue culture compositions. In some embodiments, the concentration of the reporter is about 100 nM to about 100 pM.

[0021] In another aspect, provided herein is a library comprising a plurality of DNA-encoding tags, wherein each DNA-encoding tag comprises a conserved sequence region and a different encoding region corresponding to a DEL member, wherein the DEL member is a chemical entity. In some embodiments, the encoding region encodes for individual bead8MF-363428659Attorney Docket No.: 146392068340-P39714WO1identities. In some embodiments, the library member observed on different beads during screening can be deduced based on the encoding region.

[0022] In another aspect, provided herein is a method of identifying library members in a library, comprising: providing a library comprising a plurality of DNA-encoding tags, each encoding tag comprising an encoding region that encodes for individual bead identities, screening the library to identify library members on different beads, and deducing the identity of the library members based on the encoding region.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figs. 1A-1E show an approach to activity-based DEL screening that enables the detection of cellular signaling events. The DEL bead contains a DNA-encoding tag and a corresponding DEL member (i.e., stimulus) whose structure is described by the DNA-encoding tag sequence (Fig. 1A). The DEL member is synthesized on a photocleavable linker, which cleaves at the indicated point upon irradiation (Fig. 1A). These beads are coated with polymeric signal detection / cell adhesion promoter matrix (i.e., polymeric matrix shell) to form core-shell particles and seeded with reporter cells (Fig. IB). The seeded core-shell particles are cultured in media to yield spheroids (Fig. IB). Upon UV irradiation, the DEL member is cleaved, stimulating the cells in the periphery of the particle to secrete an affinity-tagged fluorescent protein (Fig. 1C). This reporter is captured back on the particle by an affinity tag (i.e., reporter ligand) in the polymer matrix of the core-shell particle (Fig. ID), tagging the particle for sorting (Fig. IE).

[0024] Fig. 2 shows a theoretical distribution of DEL beads and cells into microfluidic droplets (i.e., aqueous droplets in oil phase). DEL beads and cells are discrete entities and, therefore, stochastic when distributed into droplets. The Poisson distribution governs the probability of observing a defined number of cells and beads per droplet. At mean occupancy of 1 cell per droplet and 1 bead per droplet, the Poisson distribution predicts a 31% probability of either event occurring, and therefore a 9% probability of both events occurring and a significant fraction of droplets containing no cells (i.e., the screening reagent).

[0025] Figs. 3A-3D show preparation of core-shell particles for signal detection and control labeling reaction analysis. DEL beads are suspended in signal detection hydrogel precursor solution, emulsified in oil containing polymerization catalysts (i), cured to form the 9MF-363428659Attorney Docket No.: 146392068340-P39714WO1hydrogel around the DEL bead to form the core-shell particle (ii), and isolated from the oil via filtration (iii) (Fig. 3A). The hydrogel signal detection matrix (i.e., the polymeric matrix of the core-shell particle containing signal detection elements) contains copolymerized functional groups, including acrydite-modified oligonucleotide QC1 (10 pM, 10-5relative to hydrogel monomer) and methacrylamide-modified chlorohexane HaloTag ligand (1 mM, 10-3relative to hydrogel monomer) (Fig. 3B). Ligand incorporation and bead coating are validated by either hybridization with Cy5-labeled complementary oligonucleotide Cy5-QCl' or covalent labeling by addition of Cherry-HaloTag fusion protein (Fig. 3B), followed by flow cytometry analysis monitoring Cy5 or cherry fluorescence (586 and 660 nm, respectively) (Fig. 3C). Cherry-HaloTag particle labeling kinetics are studied in a titration of sfcherry-HaloTag at constant incubation for 24 h, 37 °C (Fig. 3D). (Cyanine-5-TAAGCTGTCAAACATGAGAA (SEQ ID NO:2); TTCTCATGTTTGACAGCTTA (SEQ ID N0:3)).

[0026] Figs. 4A-4D show growing cells on the core-shell particles and proximity reporter capture for signal detection. Core-shell particles containing signal detection elements in the polymeric matrix are suspended in a gelatin solution (i), then rinsed and immediately treated with microbial transglutaminase (MTG) to crosslink the gelatin coating, and finally washed to furnish DEL microcarriers (i.e., core-shell particles containing cell adhesion promoters) (iii) with an almost undetectable coating thickness (Fig. 4A). DEL microcarriers are seeded 1:1000 with reporter cells. Free cells can be physically filtered out if desired, and cell-seeded DEL microcarriers are cultured (48 h), forming spheroids (Fig. 4B). A constitutively expressing HEK293T reporter line secretes cherry -HaloTag. During signal capture, cherry-HaloTag accumulates in the hydrogel layer of the DEL bead. Dissociation of the spheroid followed by flow cytometry analysis yields cell- and DEL bead-specific fluorescence populations (Fig. 4B). DEL microcarriers seeded and cultured with wild-type HEK293T (WT), non-secreting low-expression cherry -HaloTag (sec- PGK), and secreting low-expression and high-expression cherry -HaloTag (sec+ PGK, sec+ CAG, respectively) are analyzed by flow cytometry (Fig. 4C). Core-shell particle-containing spheroids from each of the four cell lines are imaged in phase contrast and epifluorescence ( ex / em = 550 / 580 nm) 20 and 40 h post seeding (Fig. 4D). Spheroids of constitutive secreting sfCherry-HaloTag reporter cells (CAG promoter) containing a sfCherry-HaloTag ligand-functionalized coreshell particles were analyzed using confocal fluorescence imaging (Fig. 4E). The accumulation of high cherry fluorescence on the core-shell particle surface indicates reporter10MF-363428659Attorney Docket No.: 146392068340-P39714WO1capture; core-shell particle autofluorescence (center of particle) is also readily detected (Fig.4E). Images of spheroid culture via inspection scope at 24 h post-seeding of cells onto beads show that the spheroids are relatively uniform in size, containing zero, one, or multiple beads per spheroid (Fig. 4F).

[0027] Figs. 5A-5H show photochemical induction and on-particle detection of STING signaling in 3D culture. Control particles display either photocleavable STING agonist MSA-2 (PC-MSA-2) or Cy-5 oligonucleotide with no ligand (NEG) (Fig. 5A). Either 100:1 or 10:1 NEG: PC-MSA-2 model libraries are seeded at 1000-fold excess of HEK293 STING reporter line (ISRE-Cherry-HaloTag), yielding empty, singleton, or multi-beaded spheroids (Fig. 5B).Seeded spheroids are dosed with violet light (400 nm, 15 min on, 45 min off, 8 cycles; Fig.5B shows UV-LED strip and foil-covered negative control) and cultured to track cellular signaling. Spheroids are imaged in epifluorescence / phase contrast overlay (cherry ex / em = 550 / 580 nm; Cy5 kex / kem = 600 / 660 nm) (Fig. 5C). Fig. 5D shows a magnified spheroid containing both a PC-MSA-2 (Cherry) bead and NEG (Cy5) beads, and Fig. 5E shows NEG (Cy5) bead exhibiting undetectable crosstalk in spectrally separated channels. Fig. 5F shows STING signaling is validated by MSA-2 treatment and detection of SEAP (fluorescein diphosphate substrate) and secreted cherry-HaloTag reporters. Fig. 5G shows spheroid cultures of the STING ISRE-cherry-HaloTag reporter cell line using 100% NEG, 100% PC-MSA-2, and the two model libraries (90:10, 99:1) are analyzed by flow cytometry, gating on the particle population. Fig. 5H shows two adjacent singleton spheroids containing PC-MSA-2 and NEG beads. Spheroids were imaged in epifluorescence / differential interference contrast overlay (Cherry kex / kem = 550 / 580 nm, Cherry; Cy5 kex / kem = 600 / 660 nm, Cy5) (Fig. 5H)

[0028] Figs. 6A-6D show structure and screening of a combinatorial DEL. DNA-encoded solid-phase synthesis yielded a 3,456-member bespoke DEL via two cycles of split-and-pool synthesis (Fig. 6A). In the first cycle, 48 Fmoc-protected amino acids (AA) were coupled and encoded by their corresponding DNA tag (Fig. 6A). Following Fmoc deprotection, 72 carboxylic acids (COOHs) are coupled and encoded (Fig. 6A). Library synthesis commences from a photocleavable linker (“Av” indicates the photocleavage junction) (Fig. 6A). PC-MSA-2 positive control beads were coated with a polyacrylamide shell containing oligonucleotide QC1 and hybridized with complementary Cy5-QCl' to label the controls with Cy5 (Fig. 6B). FACS analysis isolated high cherry fluorescence DEL beads; forward11MF-363428659Attorney Docket No.: 146392068340-P39714WO1and side scatter gates discriminated beads from cells. The DEL bead population was sorted according to cherry fluorescence (library screen) into 3 bins (highest 1%, next highest 5%, and the remaining lower 94%) (Fig. 6C). Cy5 fluorescence identified PC-MSA-2 beads (positive controls) post hoc (Fig. 6C). Of the recovered PC-MSA-2 beads, 28% sorted in the top 1% gate and 62% sorted in the next highest 5% gate by cherry fluorescence (Fig. 6C). Cy5-labeled positive control recovery during screening was quantitated for the screen (Av+) and a no UV negative control (Av-) (Fig. 6D).

[0029] Fig. 7 shows the false discovery rate determination information used to determine the false discovery statistical cutoff. Random samples of the library (1500 beads, 3 replicates) were sequenced, deconvoluted, and aggregated by k class; the Poisson distribution of k classes in a 1500-bead random sample is shown (theoretical) (Fig. 7). False discovery rate (FDR) was calculated as the average observed number of compounds at each k class in the random sample divided by the total number of compounds observed as hits in the screen at each k class (Fig. 7).

[0030] Figs. 8A-8B show STING agonist cellular DEL screening hit deconvolution and validation. Each heat map vertex indicates a unique combination of cycle 1 AA (x axis, purple) and 2 COOH (y axis) building blocks (BBs); vertex shade indicates replicate k class (Fig. 8A). AA 1 and 2 and COOH 3, 4, and 5 were overrepresented in the hit collection (Fig.8A). The site of coupling between cycle 1 (AA) and cycle 2 (COOH) BBs is indicated (Fig.8A). High-A-class screening hits 6 and 7 were synthesized, characterized, and assayed in 3D spheroid culture using the primary interferon stimulated response elements (ISRE) sfCherry-HaloTag HEK293T reporter cell line (Fig. 8B). On-bead signaling was analyzed after culture either with LED illumination (400 nm, Av+) or without illumination (Av-) by flow cytometry (Fig. 8B)

[0031] Fig. 9 shows a heat map of BBs that appeared in compounds with k > 5 in “Av-” screens by cycle 1 AAs and cycle 2 COOH (replicate k class indicated in grayscale). AA 8 and 9 and acids 3, 8, 9, 10 were overrepresented in the hit collection; arrows indicate the location of coupling between cycle 1 (AA) and cycle 2 (COOH) BBs (Fig. 9).12MF-363428659Attorney Docket No.: 146392068340-P39714WO1DETAILED DESCRIPTION OF THE INVENTION

[0032] In the search for new medicines, often one of the first steps is the screening of large compound libraries for bioactive molecules. These screens are conducted using assays, which reflect some aspect of the pathology that one would like to correct with the compound (e.g., inhibition of an enzyme). Assays can be very complex, sometimes comprising a whole cell in pursuit of molecules with complex activity, such as entering the cell and altering gene expression. Compound libraries for these screens have evolved dramatically over the years and now include vast collections of combinatorial DNA-encoded libraries (DELs). In the current state of the art, DELs can only be analyzed by binding them to a purified protein, washing away the unbound, and identifying the bound molecules by sequencing their DNA tags.

[0033] In some embodiments, provided herein is a technology that enables screening of DELs directly for cell-active compounds. In cases where one does not even know the cellular target, the present disclosure still allows the user to find disease-correcting molecules. This type of screening technology facilitates phenotypic cellular screens, which are promising for the identification of first-in-class therapeutic agents.

[0034] In some embodiments, disclosed herein is a method for activity-based DNA-encoded library (DEL) screening, which enables the detection of cellular signaling events through the integration of polymer engineering, three-dimensional tissue culture, and proximity-based sensing.

[0035] In some embodiments, the overview of this approach (Figs. 1 A-E) begins with DEL beads, which display a modularly assembled DNA-encoding tag. The DNA-encoding tag sequence describes the library member's structure (blue), wherein the library member is a stimulus that can stimulate certain cells to produce reporters. The library member is synthesized on a photocleavable linker. Upon irradiation, the linker cleaves, releasing the library member from the DEL bead surface but the DNA encoding tag remains attached to the DEL bead.

[0036] In some embodiments, DEL beads can be used as substrates for 3D tissue culture. The DEL beads are coated with a polymeric matrix containing signal detection elements and cell adhesion promoters to form core-shell particles, and the core-shell particles are seeded with cells. The cell adhesion promoters are selected from the group consisting of gelatin,13MF-363428659Attorney Docket No.: 146392068340-P39714WO1collagen, gelatin methacrylate, and methacrylated collagen. In some embodiments, cell adhesion to the particle (“seeding”) results in continued deposition of cells on the bead surface, resulting in a 3D cellular culture such as spheroid or organoid-like structure.

[0037] In some embodiments, irradiation of the 3D cellular culture such as spheroid with violet light (about 400 nm) or a different colored light with an appropriate range of wavelengths releases the DEL member in a gradient around the core-shell particle. The cells directly attached to the core-shell particle surface receive the highest dose of the compound (i.e., DEL member). If the DEL member is cell active (i.e., a stimulus to the cell), it stimulates the engineered reporter cell line to express a reporter, such as an affinity-tagged fluorescent protein reporter, and subsequently secrete the reporter, wherein the core-shell particle captures the reporter for example via affinity -tag ligands within the polymeric matrix shell of the particle. The captured reporter thus marks the core-shell particle for later sorting and deconvolution. The general concept provided herein is not limited to a specific composition of DEL or DEL beads. It can also be applied to libraries using different encoding strategies and to encoded library beads.

[0038] In some embodiments, provided herein is one aspect of a coating process to prepare core-shell particles containing encoded library beads for 3D tissue culture and cell signaling detection. In some embodiments, to prepare core-shell particles containing encoded library beads, the beads are emulsified in aqueous solution containing a monomer, monomer-modified reporter probe, and / or monomer-modified reporter ligand together with an aqueous polymerization catalyst; another polymerization catalyst is added to the oil. The emulsion creates a polymeric matrix shell around the beads after curing, with the reporter probe and / or reporter ligand either covalently or non-covalently incorporated in the polymeric matrix shell and creating a core-shell particle containing signal detection elements, wherein the signal detection elements are the reporter ligand and / or the reporter probe. In some embodiments, the reporter ligand would be used to capture an affinity -tagged reporter. In some embodiments, the reporter probe would be used to sense the presence of an enzymatic reporter. In some embodiments, the encoded library bead is DEL bead. In some embodiments, the reporter probe is a DNA oligonucleotide or enzyme activity-based probe (e.g., fluorescein diphosphate, fluorogenic peptide substrate). In some embodiments, the reporter ligand is a methacrylamide-modified HaloTag chlorohexane. In some embodiments, the monomer is acrylamide, methacrylamide, N-isopropylacrylamide, hydroxy ethyl14MF-363428659Attorney Docket No.: 146392068340-P39714WO1methacrylate (HEMA), N-vinyl pyrrolidone, polyethylene glycol diacrylate (PEGDA), ethylene glycol dimethacrylate (EGDMA), 2-hydroxyethyl acrylate, or glycidyl methacrylate. In some embodiments, the polymeric matrix shell or the polymeric matrix comprising polyacrylamide, polyethylene glycol (PEG), poly(2-hydroxyethyl methacrylate) (pHEMA), polyvinyl alcohol (PVA), alginate, agarose, gelatin, chitosan, hyaluronic acid, polylactic acid (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(N-isopropylacrylamide) (PNIPAM), polyvinylpyrrolidone) (PVP), or carrageenan.

[0039] In some embodiments, to prepare core-shell particles containing DEL beads, the DEL beads are emulsified in aqueous solution containing acrylamide monomer, methacrylamide-modified DNA oligonucleotide reporter probe, and / or methacrylamide-modified HaloTag chlorohexane reporter ligand together with ammonium persulfate polymerization catalyst; the other catalyst, TEMED, is added to the oil. The emulsion creates a polyacrylamide shell around the DEL beads after curing, with the DNA oligonucleotide reporter probe and / or HaloTag chlorohexane reporter ligand covalently incorporated in the polyacrylamide shell to create a core-shell particle containing signal detection elements, wherein the signal detection elements are selected from the group consisting of DNA oligonucleotide reporter probes, HaloTag chlorohexane reporter ligand and other functionally similar reporter probes (Fig. 3 A). In some embodiments, the reporter ligand is selected from the group consisting of chlorohexane HaloTag ligand, methacrylamide-modified chlorohexane HaloTag ligand, HaloTag diAcFAM ligand, HaloTag PEG-biotin ligand, HaloTag amine-PEG-biotin ligand, SNAP -tag, CLIP -tag, LgBiT / SmBiT, or any number of other affinity epitope tags (e.g., HA, Flag, S-tag) or small molecule ligand (e.g., glutathione, NTA, maltose).

[0040] In some embodiments, the core-shell particle comprising the encoded library bead core and the polymeric matrix shell are washed and probed with a dye-labeled complementary oligonucleotide, which binds the oligonucleotide reporter probe and / or an affinity tag-fluorescent protein fusion, which binds the affinity tag reporter ligand, respectively. The dye and the affinity tag-fluorescent protein fusion are examples reporters. Other examples of reporters include enzymatic reporters (embryonic alkaline phosphatase, betagalactosidase, betalactamase, rhamnase, or other substantially orthogonal enzymatic reporter). Enzymatic reporters need not be affinity tagged; they simply transform the cognate enzyme activity -based probe immobilized in the signal detection matrix. In some15MF-363428659Attorney Docket No.: 146392068340-P39714WO1embodiments, detection of the binding of the reporters such as the affinity tag-fluorescent protein fusion to the core-shell particles can be used as a quality control (QC) step monitored by flow cytometry to ensure that the affinity tag ligand is properly immobilized in the signal detection matrix. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the dye labeled oligonucleotide is a Cy5-labeled oligonucleotide complement of the oligonucleotide reporter probe immobilized in the signal detection matrix. In some embodiments, the affinity tag fluorescent protein fusion reporter is a cherry-HaloTag fusion protein.

[0041] In some embodiments, the core-shell particle comprising the DEL bead core and the polymeric matrix shell are washed and probed with Cy5-labeled complementary oligonucleotide and / or a cherry -Hal oTag fusion protein, which bind the oligonucleotide and HaloTag chlorohexane reporter ligand, respectively (Fig. 3B). This quality control (QC) step is monitored using flow cytometry, which can readily detect Cy5-oligonucleotide and cherry-HaloTag binding to the particles (Fig. 3C). Cherry-HaloTag bead labeling and binding kinetics are studied in a titration of [cherry-HaloTag] at constant incubation over 24 hours in control bead binding assays (Fig. 3D). These QC steps ensure that the signal detection matrix is appropriately functionalized.

[0042] In some embodiments, the coating of the polymeric matrix is introduced as a latestage functionalization of the encoded library bead to create the core-shell particle. In some embodiments, the encoded library bead is a DEL bead. For the highly complex split-and-pool DNA-encoded solid-phase synthesis, which includes library chemistry QC procedures, one can coat a polymeric matrix onto DEL beads that have already passed the complex DEL synthesis QC procedures, depositing the required polymeric matrix of the core-shell particles for cellular screening. This late-stage coating of a polymeric matrix is applicable to any beadbased DEL or other encoded and non-encoded library format where one would be concerned with the bead coating cross-reacting either with the encoding moiety or the library members themselves.

[0043] In some embodiments, labeling kinetics of the core-shell particles are dependent on the reporter’s concentration. In some embodiment, the core-shell particles comprise DEL bead and polymeric matrix shell. In some embodiments, the reporter is a cherry-HaloTag reporter. In some embodiments, the concentration of the reporter is about 50 pM, about 40 pM, about 30 pM, about 20 pM, about 19 pM, about 18 pM, about 17 pM, about 16 pM,16MF-363428659Attorney Docket No.: 146392068340-P39714WO1about 15 pM, about 14 pM, about 13 pM, about 12 pM, about 11 pM, about 10 pM, about 9 pM, about 8 pM, about 7 pM, about 6 pM, about 5 pM, about 4 pM, about 3 pM, about 2 pM, or about 1 pM, or a value within a range defined by any two of the aforementioned concentrations, such as between about 1 pM and about 2 pM, between about 2 pM and about 3 pM, between about 3 gM and about 4 gM, between about 4 gM and about 5 gM, between about 5 pM and about 6 gM, between about 6 gM and about 7 gM, between about 7 gM and about 8 pM, between about 8 gM and about 9 gM, between about 9 gM and about 10 gM, between about 10 gM and about 11 pM, between about 11 pM and about 12 gM, between about 12 pM and about 13 gM, between about 13 gM and about 14 gM, between about 14 pM and about 15 gM, between about 15 gM and about 16 gM, between about 16 gM and about 17 pM, between about 17 gM and about 18 gM, between about 18 gM and about 19 pM, between about 19 gM and about 20 gM, between about 20 gM and about 30 gM, between about 30 gM and about 40 gM, between about 40 gM and about 50 gM. In some embodiments, the concentration of the reporter is about 1000 nM, about 750 nM, about 500 nM, about 250 nM, about 100 nM, about 50 nM, about 25 nM, or about 10 nM or about 1 nM, or a value within a range defined by any two of the aforementioned concentrations, such as between about 1000 nM and about 750 nM, between about 750 nM and about 500 nM, between about 500 nM and about 250 nM, between about 250 nM and about 100 nM, between about 100 nM and about 50 nM, between about 50 nM and about 25 nM, between about 25 nM and about 10 nM, or between about 10 nM and about 1 nM.

[0044] In some embodiments, the concentration of the reporter is about 1 mM, about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 60 mM, about 70 mM, about 80 mM, about 90 mM, or about 100 mM, or a value within a range defined by any two of the aforementioned concentrations, such as between about 1 mM and about 10 mM, between about 10 mM and about 20 mM, between about 20 mM and about 30 mM, between about 30 mM and about 40 mM, between about 40 mM and about 50 mM, between about 50 mM and about 60 mM, between about 60 mM and about 70 mM, between about 70 mM and about 80 mM, between about 80 mM and about 90 mM, or between about 90 mM and about 100 mM. In some embodiments, the concentration of the reporter is about 1000 nM, about 750 nM, about 500 nM, about 250 nM, about 100 nM, about 50 nM, about 25 nM, or about 10 nM or about 1 nM, or a value within a range defined by any two of the aforementioned concentrations, such as between about 1000 nM and about 750 nM, between about 750 nM and about 500 nM, between about 500 nM and about 250 nM, between about 250 nM and17MF-363428659Attorney Docket No.: 146392068340-P39714WO1about 100 nM, between about 100 nM and about 50 nM, between about 50 nM and about 25 nM, between about 25 nM and about 10 nM, or between about 10 nM and about 1 nM.

[0045] In some embodiments, the core-shell particles are soaked in gelatin to promote cell adhesion to the shell of the core-shell particles. In some embodiments, the core-shell particles are suspended in gelatin solution and immediately treated with microbial transglutaminase (MTG) to crosslink the gelatin coating, and finally washed to furnish the core-shell particles. In some embodiments, the core-shell particles comprise DEL bead core and polymeric matrix shell comprising signal detection elements and cell adhesion promoters. In some embodiments, the cell adhesion promoter is gelatin, collagen, fibronectin, laminin, poly-L-lysine, poly-D-lysine, vitronectin, RGD peptides, Matrigel, hyaluronic acid, alginate, fibrin, elastisin, Poly-L-Ornithine, nanofiber scaffolds, synthetic polymer matrices (modified PEG, PLA, PGA), or chitosan, or methacrylated or acrylated derivatives of the above cell adhesion promoters. These cell adhesion promoters are either covalently grafted, non-covalently incorporated, or co-polymerized into the polymeric matrix.

[0046] In some embodiments, to promote cell adhesion to the core-shell particle’s surface, the core-shell particle with a polymeric matrix shell containing signal detection elements is soaked in a cell adhesion promoter solution. The cell adhesion promoter is then incorporated into the polymeric matrix shell of the core-shell particle. The core-shell particle is then washed, furnished, and sterilized. Afterwards, the core-shell particle is seeded with a reporter cell line to form spheroids comprising cells and the core-shell particle, wherein the cells are on the core-shell particle and reporters accumulate in the polymeric matrix shell by either covalently or non-covalently binding or linkage to the reporter ligand or reporter probe during culture. The cells and the core shell particles are dissociated and the entire sample, including dissociated cells and the core-shell particles, is analyzed by flow cytometry using forward and side scatter as gates to differentiate signals from the core-shell particles versus the cells. In some embodiments, the cells and the core shell particles are analyzed by fluorescence activated cell sorting (FACs) or visualization techniques such as imaging. In some embodiments, the core-shell particle comprises DEL bead as the core and polymeric matrix comprising signal detection elements comprising reporter ligand and reporter probe. In some embodiments, the core-shell particles comprise DEL bead core and polymeric matrix shell comprising signal detection elements and cell adhesion promoters. In some embodiments, the cell adhesion promoter is gelatin, collagen, fibronectin, laminin, poly-L-18MF-363428659Attorney Docket No.: 146392068340-P39714WO1lysine, poly-D-lysine, vitronectin, RGD peptides, Matrigel, hyaluronic acid, or chitosan, or methacrylated or acrylated derivatives of the above cell adhesion promoters. These cell adhesion promoters are either covalently grafted, non-covalently incorporated, or copolymerized into the polymeric matrix.

[0047] In some embodiments, to promote cell adhesion to the core-shell particle’s surface, the core-shell particles with a polymeric matrix shell containing signal detection elements are soaked in gelatin, crosslinked with microbial transglutaminase (MTG), and sterilized prior to use in cell culture (Fig. 4A). In some embodiments, the seeding, signal capture, and screening workflow (Fig. 4B) is as follows: (1) gelatinized core shell particles are seeded with a reporter cell line, (2) reporter cells form into 3D cellular cultures such as spheroids and reporters accumulate in the polymeric matrix shell by either covalently or non-covalently binding or linkage to the reporter ligand during culture, (3) cells and the core shell particles are dissociated and (4) the entire sample, including dissociated cells and the core shell particles, is analyzed by flow cytometry using forward and side scatter as gates to differentiate signals from core shell particles versus cells.

[0048] In some embodiments, different cell lines are cultured on the core-shell particles. In some embodiments, the cell lines are various HEK293T cell lines including wild type (WT), non-secreting cherry -HaloTag, and secreting cherry -Hal oTag. The wild type (WT) does not contain Cherry -HaloTag gene. The non-secreting cherry -HaloTag HEK293T cell line contains non-secreting (cytosolic expression) under the control of low expression PGK promoters. The secreting cherry -HaloTag HEK293T cell line contains secreting low expression PGK promoters. The PGK promoter is a DNA sequence derived from the phosphoglycerate kinase (PGK) gene, which is involved in glycolysis. Promoters are regions of DNA that initiate transcription of a particular gene, effectively controlling when and how much of the gene's product (typically a protein) is produced. The PGK promoter is widely used to drive low levels of constitutive gene expression in mammalian cells. A low expression promoter is designed or naturally tends to result in lower levels of transcription and, consequently, lower levels of protein production. For example, the low expression PGK promoter is a modified or weak version that ensures low levels of expression. The cherry-HaloTag fusion protein combines two functional domains: cherry fluorescent protein and HaloTag. Cherry refers to mCherry, a red fluorescent protein variant used as a fluorescent marker for visualizing proteins within cells using fluorescence microscopy. HaloTag is a19MF-363428659Attorney Docket No.: 146392068340-P39714WO1protein affinity tag, which binds covalently to synthetic ligands, facilitating versatile labeling and functionalization for biochemical, affinity purification, and imaging applications. For example, the cherry -HaloTag fusion protein can bind to the reporter ligand in the polymeric matrix of the core-shell particles. The reporter cell line containing the non-secreting Cherry-HaloTag fusion protein produces the Cherry -HaloTag fusion protein, but it remains restricted to the cytosol and never traffics to the extracellular space. The reporter cell line containing the secreted Cherry -HaloTag fusion protein produces the Cherry -HaloTag fusion protein, which then trafficks to the extracellular environment via standard secretory pathways. The wild type (WT), which does not contain the Cherry -HaloTag gene, cannot produce Cherry -HaloTag fusion protein. Due to its low expression nature, only low levels of Cherry-HaloTag fusion protein can be produced and released into the extracellular environment.

[0049] In some embodiments, different cell lines are cultured on the core-shell particles. In some embodiments, the cell lines are various HEK293T cell lines including secreting cherry -HaloTag that contains a high expression CAG promoter. The CAG promoter is used to drive high levels of constitutive gene expression in mammalian cells. The name "CAG" is derived from the key components that make up this promoter: the cytomegalovirus immediate-early enhancer, the chicken beta-actin promoter, and the rabbit beta-globin splice acceptor. In some embodiments, the secreting cherry -HaloTag HEK293T cell line, which contains a high expression CAG promoter, can produce higher level of Cherry-HaloTag fusion protein and release it into the extracellular environment.

[0050] In some embodiments, the core-shell particles are cultured with various cell lines and analyzed by phase contrast and mean fluorescence of the particles. In some embodiments, the core-shell particles cultured with WT and non-secreting cell lines do not have distinguishable fluorescence. The core-shell particles cultured with secreting cell lines containing high expression CAG promoters show a shifted mean fluorescence of the coreshell particles on which the fluorescence intensity is grown about 100-fold. In some embodiments, after 24 hours or 48 hours of cell seeding, phase contrast and epifluorescence micrographs feature cherry fluorescence distributed throughout spheroids comprising HEK293T cell lines containing the secreting cherry-HaloTag and the high expression CAG promoter and the core-shell particles. Cherry fluorescence visibly accumulates on the coreshell particles.20MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0051] In some embodiments, the reporter cell line is HEK293T, wherein the HEK293T cells constitutively produce and secrete cherry -HaloTag fusion proteins. In some embodiments, the cherry-HaloTag fusion protein is a reporter that binds to a reporter ligand in the polymeric matrix of the core-shell particle, wherein the cherry-HaloTag fusion protein accumulates in the polymeric matrix of the core-shell particle. In some embodiments, the polymeric matrix is polyacrylamide hydrogel. In some embodiments, the reporter ligand is a chlorohexane HaloTag ligand, wherein the sfCherry -HaloTag fusion protein binds to the chlorohexane HaloTag ligand. The chlorohexane HaloTag ligand is covalently incorporated into the polymeric matrix of the core-shell particle.

[0052] In some embodiments, a spheroid comprises cells and core-shell particles. In some embodiments, the cells of the spheroid can be dissociated with the core-shell particle. In some embodiments, the cells of the spheroid can be dissociated with the core-shell particles by using 0.1-50 mM EDTA treatment. In some embodiments, the cells of the spheroid can be dissociated with the core-shell particles by using 1-10 mM EDTA treatment. In some embodiments, the cells of the spheroid are dissociated with the core-shell particles by using 1 mM EDTA treatment. In some embodiments, other types of dissociation, such as enzymatic digestion (e.g., trypsin and collagenase) can also be used to dissociate the cells from the coreshell particle depending on the reporter type and compatibility with dissociation enzyme, which must not degrade the reporter protein.

[0053] In some embodiments, the core-shell particles are seeded with cells in culture media, creating a spheroid. The spheroid has more than one layer of cells growing around the core-shell particles. In some embodiments, the spheroids have relatively uniform sizes. In some embodiments, the cells are engineered reporter line cells. In some embodiments, the engineered reporter line cells are selected from the group consisting of various HEK293T cells that constitutively producing and secreting reporters including cherry-HaloTag reporters. In some embodiments, the engineered reporter line cells are selected from the group consisting of various HEK293T reporter cell lines producing and secreting reporters in response to activation of a pathway of interest via treatment with a chemical stimulus or several chemical stimuli. In some embodiments, the engineered reporter cells produce and secrete reporters such as affinity -tagged reporter in response to activation of a pathway of interest via treatment with a chemical stimulus or several chemical stimuli. In some embodiments, the affinity-tagged reporter is an affinity-tagged fluorescent protein reporter. In21MF-363428659Attorney Docket No.: 146392068340-P39714WO1some embodiments, the affinity-tagged fluorescent protein reporter is cherry -HaloTag fusion protein. In some embodiments, the pathway of interest involves activation of the stimulator of interferon genes (STING) target protein and subsequent signaling cascade resulting in expression of type 1 interferons, and the stimulus of interest is either a known endogenous (cyclic GAMP, cGAMP) or synthetic (MSA-2, SR-717, DMXAA) ligand of the STING target protein. In some embodiments, the STING ligand is used as a model DEL member attached to the core-shell particle via a photocleavable linker. In some embodiments, DEL members are selected based on their ability to stimulate the reporter cell and drive expression of the reporter gene via activation of the pathway of interest (e.g., STING pathway).

[0054] In some embodiments, the core-shell particles are seeded with cells in culture media for at least about 4, about 8, about 12, about 16, about 20, about 24, about 28, about 32, about 36, about 40, about 44, or about 48 hours, or for a time period within a range defined by any two of the aforementioned time periods. The cells seed on the core-shell particles, creating a spheroid. The spheroid has more than one layer of cells growing around the core-shell particles. In some embodiments, the spheroids have relatively uniform sizes. In some embodiments, the core-shell particles comprise reporter ligands that capture reporters produced and secreted by the reporter cells. In some embodiments, the core-shell particles comprise reporter probes that are transformed by the reporters into detectable products. In some embodiments, the reporter probes are antibody epitopes, and the reporters are antibodies. In some embodiments, the reporter probes are probes of enzymatic activities, and the reporters are enzymes.

[0055] In some embodiments, when the reporters interact with the reporter ligands or the reporter probes of the core-shell particles, detectable signals are generated. In some embodiments, the reporter, produced and secreted by a high-expressing CAG cell line, is a cherry -HaloTag fusion protein, which is captured by the reporter ligand comprising methacrylamide-modified chlorohexane HaloTag ligand. In some embodiments, the coreshell particles containing the captured cherry -HaloTag fusion protein having at least about 100-fold gain in fluorescence signal intensity over the background and are readily visualized in imaging microscopy (Fig. 4D). In some embodiments, the signal intensity is about 10-, about 25-, about 50-, about 100-, about 150-, about 200-, about 250-, about 300-, about 350-, about 400-, about 450-, about 500-, about 550-, about 600-, about 650-, about 700-, about 750-, about 800-, about 850-, about 900-, about 950-, about 1000-fold or for a value within a22MF-363428659Attorney Docket No.: 146392068340-P39714WO1range defined by any two of the aforementioned values over the background, such as between about 10- and about 25-, between about 25- and about 50-, between about 50- and about 75-, between about 75- and about 100-, between about 100- and about 150-, between about 150-and about 200-, between about 200- and about 250-, between about 250- and about 300-, between about 300- and about 350-, between about 350- and about 400-, between about 400-and about 450-, between about 450- and about 500-, between about 500- and about 550-, between about 550- and about 600-, between about 600- and about 650-, between about 650-and about 700-, between about 700- and about 750-, between about 750- and about 800-, between about 800- and about 850-, between about 850- and about 900-, between about 900-and about 950-, or between about 950- and about 1000-.

[0056] In some embodiments, the concentration of the captured reporters on the coreshell particle is about 100-, about 150-, about 200-, about 250-, about 300-, about 350-, about 400-, about 450-, about 500-, about 550-, about 600-, about 650-, about 700-, about 750-, about 800-, about 850-, about 900-, about 950-, about 1000-, about 1100-, about 1200-, about 1300-, about 1400-, about 1500-, about 1600-, about 1700-, about 1800-, about 1900-, about 2000-, about 2500-, about 3000-, about 4000-, about 5000-, about 6000-, about 7000-, about 8000-, about 9000-, or about 10,000-fold or for a value within a range defined by any two of the aforementioned values higher than the concentration of the reporters found in the bulk culture medium, such as between about 100- and about 150-, between about 150- and about 200-, between about 200- and about 250-, between about 250- and about 300-, between about 300- and about 350-, between about 350- and about 400-, between about 400- and about 450-, between about 450- and about 500-, between about 500- and about 550-, between about 550-and about 600-, between about 600- and about 650-, between about 650- and about 700-, between about 700- and about 750-, between about 750- and about 800-, between about 800-and about 850-, between about 850- and about 900-, between about 900- and about 950-, between about 950- and about 1000-, between about 1000- and about 1100-, between about 1100- and about 1200-, between about 1200- and about 1300-, between about 1300- and about 1400-, between about 1400- and about 1500-, between about 1500- and about 1600-, between about 1600- and about 1700-, between about 1700- and about 1800-, between about 1800- and about 1900-, between about 1900- and about 2000-, between about 2000- and about 2500-, between about 2500- and about 3000-, between about 3000- and about 4000-, between about 4000- and about 5000-, between about 5000- and about 6000-, between about 6000- and about 7000-, between about 7000- and about 8000-, between about 8000- and23MF-363428659Attorney Docket No.: 146392068340-P39714WO1about 9000-, or between about 9000 and about 10,000-. In some embodiments, the reporter is a cherry-HaloTag fusion protein and the concentration of the cherry -HaloTag fusion protein in the core-shell particle is about ~10 pM, which is about 1000-fold higher than the about 10 nM cherry -HaloTag fusion protein found in the bulk culture medium. The close proximity of the secreting cells to the core-shell particles drives efficient and selective capture of the reporters into the polymeric matrix of the core-shell particles resulting in higher concentrations of the reporters in the particles over the bulk culture medium.

[0057] In some embodiments, a high-throughput phenotypic cellular screening method of an encoded library for a compound of interest requires detection of cellular activity, wherein the desired change in cellular activity is elicited by a compound of interest contained in the encoded library. In some embodiments, a high-throughput phenotypic cellular screening method of an encoded library for a compound of interest from the encoded library, which requires detection of cell signaling in response to a stimulus, wherein the stimulus is the compound of interest when it activates a signaling pathway of interest. In some embodiments, the high-throughput phenotypic screening method does not require a known cellular target of the stimulus. In some embodiments, the encoded library is a DNA-encoded Library (DEL). In some embodiments, the core-shell particles comprise a DEL bead as the core and polymeric matrix as the shell. In some embodiments, the stimulus is a DEL member attached to the DEL bead via photocleavable linker. In some embodiments, the DEL member is a control agonist of the STING pathway. In some embodiments, the cell signaling in response to a stimulus (e.g., STING agonist) is fluorescence signal. In some embodiments, the stimulus is a molecule that penetrates the plasma membrane of cells and modulates complex signaling pathways.

[0058] In some embodiments, the cell is an engineered HEK293T reporter cell line. In some embodiments, the cell produces and secretes the cherry -HaloTag fusion protein as the reporter in response to a chemical stimulus activating a pathway of interest. In some embodiments, the pathway of interest is the stimulator of interferon genes (STING) pathway and the stimulus is an agonist of STING, wherein the STING agonist is the DEL member used to test the capability of phenotypic cellular DEL screening. In some embodiments, the STING agonist is MSA-2, which is 4-(5,6-dimethoxybenzo[b]thiophen-2-yl)-4-oxobutanoic acid. In some embodiments, the STING agonist is attached to DEL beads or core-shell particles via a photocleavable linker. In some embodiments, the photocleavable linker is a24MF-363428659Attorney Docket No.: 146392068340-P39714WO1nitrobenzene-derived moiety or any moieties that can serve the same purpose, such as 2-nitrobenzyl, 6-nitroveratryl, 3,5-dimethoxybenzoin, 7-nitroindole, 1-pyrenylmethyl, coumarin-based linkers, 4,5-dimethoxy-2-nitrobenzyl, o-nitrophenyl ethyl, and ruthenium-based photolabile linkers. In some embodiments, blank beads are used as a negative control, wherein the blank beads do not contain a DEL member. In some embodiments, the STING agonist is 4-(5,6-dimethoxybenzo[b]thi ophen-2 -yl)-4-oxobutanoic acid, 2'3'-cGAMP (cyclic [G(2',5')pA(3',5')p]), DMXAA (5,6-dimethylxanthenone-4-acetic acid), c-di-GMP (cyclic diguanylate monophosphate), c-di-AMP (cyclic diadenylate monophosphate), ADU-S100 (MIW815), diABZI (di-amidobenzimidazole), ML RR-S2 CDA (mixed-linkage 2', 3 cGAMP), or SB 11285.

[0059] In some embodiments, spheroid culture is exposed to violet light via UV-LED strip light illumination (400 nm) for eight 15 min on / 45 min off irradiation cycles, then the spheroids are dissociated for flow cytometry analysis (Fig. 5B). In some embodiments, spheroid culture is exposed to various wavelengths of light, ranging from about 290 nm to about 490 nm. In some embodiments, there are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 cycles of irradiation. In some embodiments, each irradiation cycle has about 5, about 10, about 15, about 20, about 25, about 30, about 35, or about 40 min light on and about 55, about 50, about 45, about 40, about 35, about 30, about 25, or about 20 min light off. In some embodiments, the spheroids are dissociated by EDTA solution and prepared for flow cytometry analysis.

[0060] These proof-of-concept experiments demonstrate the key inventive concept of leveraging proximity both to stimulate cells with a high concentration of compound and detect their signaling output without any additional compartmentalization. Ordinarily, one would expect compartmentalization to be required for confining the compound for testing with the activity assay. For example, in conventional array-based screening, microtiter well plates (microplates) accomplish this goal. Provided herein is that proximity alone can drive the selective stimulation of and capture of secreted reporters from cells associated with a given DEL bead. The model library screens further demonstrate that proximity is beneficial to stimulate and selectively label the positive control hit beads.

[0061] Provided herein is a technology that unlocks the ability to screen encoded libraries directly for desired cellular activity by liberating the library members (i.e., stimulus) from the library bead (and DNA), as opposed to DNA-tethered species. Thus, the technology disclosed 25MF-363428659Attorney Docket No.: 146392068340-P39714WO1herein can enable unique capabilities in drug discovery that cannot be achieved by conventional affinity selection-based library screening. In some embodiments, the encoded library is a DEL comprising DEL beads.

[0062] Compared to using microfluidic droplets to compartmentalize both cells and DEL beads, the technology disclosed herein can avoid several fundamental limitations and flaws faced by the microfluidic droplets-based approach. For example, oxygen exchange and waste removal are difficult in droplets. Furthermore, cells as assay reagents are discrete like beads, and thus would be subjected to the same stochastic distribution as beads. If cells and beads are stochastic, then the probability that both a cell and a bead are present together becomes very low (< 5%) due to a double Poisson distribution. More importantly, the ability to lock in on a negative control signal (empty droplets) becomes futile as empty droplets are no longer guaranteed to contain a cell (Fig. 2). Establishing a robust negative control population is critical for library screening, where hit identification hinges on the screener’s ability to determine whether any given library member causes an effect that is statistically significantly deviated from the negative control. Spheroid culture provided herein eliminates the challenge of oxygen exchange or waste removal from microfluidic droplets; the culture is homogeneous and in media with free diffusion of gasses and nutrients. Also, cells are associated with beads. Thus, the double Poisson distribution with beads and cells does not occur, and a robust negative control population is acquired.

[0063] Spheroid culture also introduces significant advantages for phenotypic screening, especially for targets in the oncology and central nervous system (CNS) therapy areas. Cellbased screening directly identifies molecules that penetrate the plasma membrane and modulate complex signaling pathways. In oncology specifically, there is a genuine concern that screening 2D monocultures for anti -proliferative compounds does not faithfully recapitulate the tumor microenvironment, which can be enriched in immunosuppressive factors, or offer complex mechanisms for inducing cytotoxicity, for example by immunomodulation. For this reason, spheroid screening holds a significant advantage. In CNS drug discovery, molecules capable of penetrating the blood-brain barrier (BBB) and modulating function are of prime interest yet challenging to discover or design. Building spheroids via coculture could address these screening limitations with high scalability potential, while also recapitulating other complex neuronal cellular activities.26MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0064] In addition to unlocking unique discovery capabilities, the technology provided herein is especially distributable. For example, this mode of screening does not require rooms of robotics or expensive plated compound libraries that cannot be easily distributed and require extensive compound management infrastructure. In some embodiments, the 3D culture DEL technology involves a tube of DEL beads, an incubator for tissue culture, and a flow cytometer for analysis and sorting. Furthermore, on-DNA DELs are commoditized (Hitgen, WuXi, X-Chem). WuXi has released the first generation of their automated DEL selection platform (the “DELman”) and solid-phase bead-based DELs appear to be coming online from these vendors. Moreover, other miniaturized approaches to solid-phase library construction can be united with the 3D culture screening approach provided herein to enable cell-based interrogation of mRNA display, aptamer, phage, and other encoded library modalities that can be reformatted to beads. These innovations further build a foundation that could reduce screening costs by an order of magnitude and globally disseminate other complex and inaccessible cell-based drug discovery technology.Definitions

[0065] A “particle” as used herein refers to a discrete complex comprising a core-shell particle with an encoded library bead as the core and a polymeric matrix as the shell.

[0066] “Cherry -HaloTag” and “sfCherry-HaloTag” as used herein includes superfolder cherry red fluorescent protein-HaloTag.

[0067] “A” or “an” means one and more than one. For example, “a particle” includes one, two, three, or more particles.

[0068] “Dry diameter” as used herein is the diameter of the particle when it is in a dry state, meaning it has not absorbed any water or other solvent. In this state, the particle is typically at its smallest size because it is not swollen with any solvent.

[0069] “Hydrated Diameter” as used herein is the diameter of the particle when it has absorbed water or other solvent. In this state, the particle swells, increasing in size due to the uptake of the solvent. The hydrated diameter is usually larger than the dry diameter because the absorbed solvent causes the particle to expand or swell.

[0070] A “library” as used herein is a collection of molecules or chemical entities.27MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0071] An “encoded library” as used herein is a collection of diverse molecules or chemical entities (e.g., small molecules, peptides, proteins, or nucleic acids) that have unique identifiers (such as DNA barcodes) attached to them. These identifiers allow for easy tracking and identification of the active compounds within the library.

[0072] An “oligonucleotide” as used herein is a polymer of nucleotides having a 5’-terminus, a 3 ’-terminus, and one or more nucleotides at the internal position between the 5’ -and 3 ’-termini. The oligonucleotide may include DNA, RNA, or other derivatives thereof.

[0073] An “oligonucleotide tag” or “DNA encoding tag” as used herein is an oligonucleotide portion of the library at least part of which contains information to identify the particle and / or library. For example, a DNA encoding tag may contain information that allows identification of an associated library member or stimulus. In some embodiments, a DNA tag is used as a barcode.

[0074] A “library member” as used herein is one of the molecules or chemical entities in a library.

[0075] A “signal detection element” as used herein is a functional group or molecule that is used to detect a response by the cell to a library member. In some embodiments, the signal detection element is a reporter ligand and / or a reporter probe that produces a detectable signal when a reporter is produced by a cell in response to the library member.

[0076] A “reporter” as used herein is a molecule or protein used to indicate the occurrence of a specific biological event, typically through a measurable signal. Cells synthesize reporters in response to a stimulus, such as a library member. The reporter may be detectable either on its own, or only in certain circumstances, such as when the reporter binds to a reporter ligand or a reporter probe. As an example, in some embodiments, the reporter is an enzyme secreted by a cell which can process a substrate (reporter probe) into a detectable product. In some embodiments, the reporter is an affinity tag-fluorescent protein fusion comprising a fluorescent marker that could bind to a target, such as a reporter ligand attached to a particle, allowing for the detection of the particle by fluorescence-based methods.

[0077] A “reporter ligand” as used herein is a functional group that can bind to a reporter and produce signal (e.g., fluorescence) upon binding. In some embodiments, a reporter ligand contains an affinity tag. In some embodiments, a reporter ligand contains a detectable tag.28MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0078] A “reporter probe” as used herein is a functional group that interacts with a reporter. In some embodiments, the reporter probe can transform into a detectable product upon interacting with the reporter. In some embodiments, the reporter probe contains an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity.

[0079] “Incorporated” as used herein refer to absorbed, adsorbed, or coated.

[0080] “Phenotypic cellular screening” as used herein is exposing cells to the encoded library and observing changes in the cells' phenotype. The goal is to identify library members that induce a desired phenotypic change in the cells. This approach does not require prior knowledge of the target or mechanism of action, making it useful for discovering novel bioactive compounds.

[0081] In vivo” as used herein includes experiments performed on living cells, for example in a three dimensional cell culture.

[0082] A “spheroid” is a three-dimensional (3D) cellular conglomerate that forms when cells aggregate and grow together in a spherical shape. Unlike traditional monolayer cell cultures, where cells grow as a single layer on a flat surface like a petri dish or a tissue culture flask, spheroids mimic the organization and microenvironment of tissues more closely. A 3D cellular culture can be spheroids, organoids, and other cellular conglomerates such as biofilms.

[0083] In the present disclosure, the terms “DEL member”, “DEL library member”, and “library member” are used interchangeably.I. Particles

[0084] Provided herein is a composition comprising cells and a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the polymeric matrix comprises polyacrylamide and / or other hydrogel polymers such as polyethylene glycol (PEG), poly(2-hydroxy ethyl methacrylate) (pHEMA), polyvinyl alcohol (PVA), alginate, agarose, gelatin, chitosan, hyaluronic acid, polylactic acid (PLA), poly(lactic-co-glycolic acid) (PLGA), poly(N-isopropylacrylamide) (PNIPAM),29MF-363428659Attorney Docket No.: 146392068340-P39714WO1polyvinylpyrrolidone) (PVP), and carrageenan. In some embodiments, the cells are engineered reporter cell lines including HEK293T cell lines.

[0085] In some embodiments, the composition is a 3D tissue culture composition comprising the cells and the core-shell particle, wherein the cells are seeded onto the coreshell particle, forming the spheroid. In some embodiments, the cells are engineered reporter cell lines including HEK293T cell lines. In some embodiments, the cell culture medium is Dulbecco’s Modified Eagle Medium (DMEM), wherein it contains essential nutrients such as amino acids, vitamins, and minerals, supplemented with glucose and sodium bicarbonate to support cell metabolism and pH balance. DMEM can be supplemented with fetal bovine serum (FBS) or other serum substitutes to provide additional growth factors and hormones required for cell growth. In some embodiments, the cell culture medium is RPMI 1640 Medium, wherein it can be supplemented with FBS or other serum substitutes for optimal cell growth. In some embodiments, the cell culture medium is Minimum Essential Medium (MEM), wherein it can be supplemented with FBS or other serum substitutes as needed.

[0086] In some embodiments, the 3D tissue culture is at a temperature of about 37°C in a standard cell culture incubator. This temperature mimics physiological conditions and supports optimal cell metabolism and growth. In some embodiments, the 3D tissue culture is cultured in a humidified atmosphere with about 5% carbon dioxide (CO2). This level of CO2 aids in maintaining the pH of the culture medium and supports cell proliferation. In some embodiments, the 3D tissue culture is cultured in a suitable cell culture medium, such as Dulbecco’s Modified Eagle Medium (DMEM) or RPMI 1640, supplemented with fetal bovine serum (FBS) or other serum substitutes, antibiotics (e.g., penicillin-streptomycin), and additional supplements as needed, such as L-glutamine and non-essential amino acids. In some embodiments, the pH of the culture medium is maintained within the physiological range (pH 7.2-7.4) using a buffered medium such as DMEM or RPMI 1640. This pH range is optimal for supporting cell growth and function.

[0087] In some embodiments, the composition is a 3D tissue culture composition comprising the cells and the core-shell particle, wherein the cells are seeded on the core-shell particle. In some embodiments, the shell of the core-shell particle comprises a signal detection element and a cell adhesion promoter, wherein the cell adhesion promoter is immobilized in or linked to or incorporated into the polymeric matrix via covalent or non-covalent binding. In some embodiments, the cell adhesion promoter is a substance that 30MF-363428659Attorney Docket No.: 146392068340-P39714WO1promotes adherence of the cells to the polymeric matrix. In some embodiments, the cell adhesion promoter is selected from the group consisting of gelatin, gelatin methacrylate, and methacrylated collagen. In some embodiments, the polymeric matrix comprises gelatin, gelatin methacrylate, and methacrylated collagen. In some embodiments, the cell adhesion promoter is attached to the polymer matrix through copolymerization. In some embodiments, the cell adhesion promoter is attached to the polymer matrix through oligonucleotide hybridization. In some embodiments, the cell adhesion promoter is attached to the polymer matrix through click chemistry. In some other embodiments, the cell adhesion promoter is incorporated into the polymer matrix through non-covalent interactions such as Van der Waals Forces, hydrogen bonding, hydrophobic interactions, 71-71 interactions, or electrostatic interactions.

[0088] In some embodiments, the shell of the core-shell particle comprises a signal detection element and a cell adhesion promoter, wherein the signal detection element is immobilized in or linked to or incorporated into the polymeric matrix via covalent or non-covalent binding. In some embodiments, the signal detection element is a reporter ligand or a reporter probe. In some embodiments, a reporter binds to the reporter ligand. In some other embodiments, a reporter transforms the reporter probe into a detectable product. In some embodiments, the signal detection element is attached to the polymer matrix through copolymerization. In some embodiments, the signal detection element is attached to the polymer matrix through hybridization. In some embodiments, the signal detection element is attached to the polymer matrix through click chemistry.

[0089] In some embodiments, a reporter binds to the reporter ligand, wherein the reporter comprises a fluorescent protein selected from the group consisting of red fluorescent protein (RFP), green fluorescent protein (GFP), Yellow Fluorescent Protein (YFP), cyan fluorescent protein (CFP), and orange fluorescent protein (OFP). In some embodiments, the red fluorescent protein is cherry-HaloTag fusion protein or TagRFP. In some embodiments, the orange fluorescent protein is mOrange. In some embodiments, the cyan fluorescent protein is mTurquoise.

[0090] In some embodiments, a reporter binds to the reporter ligand, wherein the reporter comprises a dye molecule selected from the group consisting of ATTO dyes, Alexa Fluor dyes, and Cy dyes. In some embodiments, the Cy dye is Cy3, Cy5, or Cy7.31MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0091] In some embodiments, the reporter ligand is selected from the group consisting of chlorohexane HaloTag ligand, methacrylamide-modified chlorohexane HaloTag ligand, HaloTag diAcFAM ligand, HaloTag PEG-biotin ligand, HaloTag amine-PEG-biotin ligand, or any number of other affinity epitope tags (e.g., HA, Flag, S-tag) or small molecule ligand (e.g., glutathione, NT A, maltose).

[0092] In some other embodiments, the reporter transforms the reporter probe to a detectable product, wherein the reporter is an enzyme selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, enterokinase. In some embodiments, the reporter probe comprises a detectable tag comprising an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity. In some embodiments, the oligonucleotide is a methacrylamide-modified oligonucleotide. In some embodiments, the probe of enzymatic activity is a methacrylamide-modified probe.

[0093] In some embodiments, the cells of the 3D tissue constitutively produce or synthesize the reporters and secrete or release them into the extracellular environment. In some embodiments, the cells of the 3D tissue culture produce or synthesize the reporters in response to a stimulus. In some embodiments, the cells secrete or release the reporters in response to a stimulus. In some other embodiments, the cells display the reporters on the cell surface in response to a stimulus. In some embodiments, the cells attenuate expression of a reporter in response to a stimulus. In some embodiments, the stimulus is an inhibitor.

[0094] In some embodiments, the cells of the 3D tissue are selected from the engineered reporter cell line containing a gene expression promoter such as high gene expression promoter, low gene expression promoter, or endogenous promoter. In some embodiments, the high gene expression promoter is a CAG (cytomegalovirus immediate early enhancer / chicken beta-actin / rabbit beta-globin hybrid) gene expression promoter or EFlo, a CMV (Cytomegalovirus) gene expression promoter, a SV40 (Simian Virus 40) gene expression promoter, or a P-Actin gene expression promoter. In some embodiments, the low gene expression promoter is a PGK (phosphoglycerate kinase) gene expression promoter, a TK (Thymidine Kinase) gene expression promoter, a GAPDH (Glyceraldehyde-3 -Phosphate Dehydrogenase) gene expression promoter, or a tet-responsive gene expression promoter. The CAG promoter is a synthetic promoter widely used in molecular biology and biotechnology to drive high levels of gene expression in mammalian cells.32MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0095] In some embodiments, the cells of the 3D tissue are selected from the engineered reporter cell line containing a high gene expression promoter or a low gene expression promoter. In some embodiments, the secreting cells, which contain a high expression CAG promoter, such as CAG (cytomegalovirus immediate early enhancer / chicken beta-actin / rabbit beta-globin hybrid) gene expression promoter, CMV (Cytomegalovirus) gene expression promoter, SV40 (Simian Virus 40) gene expression promoter, or P-Actin gene expression promoter, produce reporters and release them into the extracellular environment. The level of reporters is considered high when their concentration in the extracellular environment reaches 10 pM. In some embodiments, the secreting cells are HEK293T cells, and the reporters are Cherry-Halo fusion proteins.

[0096] In some embodiments, the reporter ligand or the reporter probe is conjugated to an oligonucleotide, wherein the oligonucleotide is hybridized to a complementary oligonucleotide which is linked to the polymer matrix of the core-shell particle. In some embodiments, the oligonucleotide is a DNA oligonucleotide. In some embodiments, the oligonucleotide is a methacrylamide-modified oligonucleotide.

[0097] In some embodiments, the cells of the 3D tissue culture are engineered reporter cell line. In some embodiments, the cells are engineered HEK293T cells, CHO (Chinese hamster ovary) cells, NS0 (mouse myeloma) cells, COS-7 (African green monkey kidney) cells, or A549 (human lung carcinoma) cells. In some embodiments, the cells lines are MDA-MB-231, HepG2, fibroblasts, HCT116, or HT22. In some embodiments, the 3D tissue culture is a spheroid culture. In some embodiments, the cells of the spheroid culture comprise seeded cells and viable cells.

[0098] In some embodiments, the core-shell particle comprises the encoded library bead, further comprising an encoding tag and a library member, which is a compound or chemical entity. In some embodiments, the library member is a stimulus for a cell to synthesize a reporter. In some embodiments, reporters are synthesized in cells through genetic constructs where the reporter gene is linked to a promoter sequence. The promoter acts as a switch that controls the transcription of the reporter gene into messenger RNA (mRNA), which is then translated into the reporter protein. The promoter used to drive reporter gene expression is inducible and activates a pathway of interest in response to a specific stimulus. In some embodiments, the pathway of interest is the STING pathway together with STING agonist. Examples of reporter genes includes Interferon -Beta (IFNB), Luciferase, Green Fluorescent 33MF-363428659Attorney Docket No.: 146392068340-P39714WO1Protein (GFP), or cherry-HaloTag fusion protein. The promoter gene is interferon -Beta (IFNB) promoter, NF-KB response element, or interferon-stimulated response element (ISRE). In some embodiments, the agonist target pathways include GLP-lr, GIP, CB1, CB2, PPARs, GLUT, TNFR, SIPr, RXR, TRPV, EGFR, VEGFR, TLRs, A2Ar, and RAR. In some embodiments, other signal transduction cascades can also be targeted, including GPCRs, nuclear hormone receptors, and kinase cascades.

[0099] In some embodiments, the library member’s structure and / or synthetic route is described by the encoding tag. In some embodiments, the library member is a STING agonist. In some embodiments, the library member is a STING antagonist. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the library member is a DEL member. In some embodiments, the encoding tag is a DNA-encoding tag. In some embodiments, the DEL member’s structure and / or synthetic route is described by the DNA-encoding tag sequence. In some embodiments, the cells are engineered HEK293T cells. In some embodiments, the cells form a 3D cellular culture on the core-shell particle, such as spheroid, organoids, or other cellular conglomerates. In some embodiments, the cells form a monolayer of cells around the particle. In some embodiments, one cell type forms a monolayer of cells around the particle, then a second layer (mono or multi-layer) of another cell type can be seeded on top.

[0100] In some embodiments, the spheroid culture has a diameter of about 10 pm to about 500 pm, such as, for example, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, or about 500 pm, in diameter, or a diameter within a range defined by any two of the aforementioned values, such as such as between about 10 and about 20, between about 20 and about 30, between about 30 and about 40, between about 40 and about 50, between about 50 and about 60, between about 60 and about 70, between about 70 and about 80, between about 80 and about 90, between about 90 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, or between about 450 and about 500. In some embodiments, the spheroid culture contains from about 10 to about 300,000 cells.

[0101] In some embodiments, the core-shell particle comprises the encoded library bead, further comprising an encoding tag and a library member, which is compound or chemical 34MF-363428659Attorney Docket No.: 146392068340-P39714WO1entity. In some embodiments, the library member is a stimulus for a cell to synthesize a reporter. In some embodiments, the library member’s structure and / or synthetic route is described by the encoding tag. In some embodiments, the encoding tag is modularly assembled on the encoded library bead. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the library member is a DEL member. In some embodiments, the encoding tag is a DNA-encoding tag. In some embodiments, the DEL member’s structure and / or synthetic route is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled on the DEL bead.

[0102] In some embodiments, the core-shell particle comprises the encoded library bead, further comprising an encoding tag and a library member, which is compound or chemical entity. In some embodiments, the library member is a STING agonist. In some embodiments, the library member is a STING antagonist. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the DEL member is a STING agonist. In some embodiments, the DEL member is a STING antagonist.

[0103] In some embodiments, the library member is attached to the encoded library bead of the core-shell particle via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker. In some embodiments, the photocleavable linker is configured to release the library member upon photo induced cleavage. In some embodiments, the photo induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the photo induced cleavage is under the light having a wavelength ranging from about 290 nm to about 490 nm. In some embodiments, the encoding tag is configured to remain attached to the encoded library bead of the core-shell particle when irradiated.

[0104] In some embodiments, the DEL member is attached to the DEL bead of the coreshell particle via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker, spiropyran-based Linker, dithiane-based linker, coumarin-based linker, quinone-based linker, or bipyridyl-based linker. In some embodiments, the photocleavable linker is configured to release the DEL member upon photo induced cleavage. In some embodiments, the photo induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the photo induced cleavage is under the light having a wavelength ranging from about 290 nm to about 490 nm. In some embodiments, the DNA-35MF-363428659Attorney Docket No.: 146392068340-P39714WO1encoding tag is configured to remain attached to the DEL bead of the core-shell particle when irradiated.

[0105] In some embodiments, the reporters produced by the cells are inducible by the stimulus. In some embodiments, the reporters secreted by the cells are inducible by the stimulus. In some embodiments, expression of the reporter in a cell is induced by activation or repression of the cell signaling pathway. In some embodiments, the expression of the cell signaling pathway is activated or repressed by the stimulus. In some embodiments, the stimulus is the library member. In some embodiments, the reporter gene is operably linked to a promoter that is activated by activation or repression of a targeted signaling pathway.

[0106] In some embodiments, the library member is a STING agonist. In some embodiments, the library member is a STING antagonist. In some embodiments, the library member is 4-(5,6-dimethoxybenzo[b]thiophen-2-yl)-4-oxobutanoic acid (i.e., MSA-2), which is a STING agonist. In some embodiments, MSA-2 is attached to the encoded library bead via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker. In some embodiments, the photo induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the photo induced cleavage is under the light having a wavelength ranging from about 290 nm to about 490 nm. In some embodiments, the encoding tag is configured to remain attached to the encoded library bead of the core-shell particle when irradiated.

[0107] In some embodiments, the reporters produced by the cells are inducible by the stimulus. In some embodiments, the reporters secreted by the cells are inducible by the stimulus. In some embodiments, expression of the reporter in a cell is induced by activation or repression of the cell signaling pathway. In some embodiments, the expression of the cell signaling pathway is activated or repressed by the stimulus. In some embodiments, the stimulus is the library member. In some embodiments, the stimulus is the DEL member. In some embodiments, the DEL member is attached to the bead via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker. In some embodiments, the photo induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the photo induced cleavage is under the light having a wavelength ranging from about 290 nm to about 490 nm. In some embodiments, the DNA-encoding tag is configured to remain attached to the DEL bead of the core-shell particle when irradiated.36MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0108] In some embodiments, the released library members are in a concentration gradient around the encoded library bead of the core-shell particle. The concentration of the library member is highest when it’s closer to the encoded library bead. The cells that are closer to the core-shell particle are exposed to the highest concentration of the library members. In some embodiments, the encoded library bead is a DEL bead.

[0109] In some embodiments, the engineered reporter cell line comprises varying degrees of gene expression levels via selection of different strength synthetic promoters or the use of endogenous promoters.

[0110] In some embodiments, the core-shell particle has a diameter of about 10 pm to about 40 pm, such as, for example, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 pm, in diameter, or a diameter within a range defined by any two of the aforementioned values, such as between about 10 and about 11, between about 11 and about 12, between about 12 and about 13, between about 13 and about 14, between about 14 and about 15, between about 15 and about 16, between about 16 and about 17, between about 17 and about 18, between about 18 and about 19, between about 19 and about 20, between about 20 and about 21, between about 21 and about 22, between about 22 and about 23, between about 23 and about 24, between about 24 and about 25, between about 25 and about 26, between about 26 and about 27, between about 27 and about 28, between about 28 and about 29, between about 29 and about 30, between about 30 and about 31, between about 31 and about 32, between about 32 and about 33, between about 33 and about 34, between about 34 and about 35, between about 35 and about 36, between about 36 and about 37, between about 38 and about 39, or between about 39 and about 40. In some embodiments, the core-shell particle has a diameter of about 20 pm, or about 50 pm. In some embodiments, the core-shell particle has an encoded library bead as the core and a polymeric matrix as the shell. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the thickness of the shell of the particle is about 1 pm.

[0111] In some embodiments, a spheroid culture grows on the core-shell particle, which has a diameter of about 10 pm to about 1000 pm, such as, for example, about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 150,37MF-363428659Attorney Docket No.: 146392068340-P39714WO1about 200, about 250, about 300, about 350, about 400, about 450, or about 500 m, in diameter, or a diameter within a range defined by any two of the aforementioned values, such as between about 10 and about 20, between about 20 and about 30, between about 30 and about 40, between about 40 and about 50, between about 50 and about 60, between about 60 and about 70, between about 70 and about 80, between about 80 and about 90, between about 90 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, between about 450 and about 500, between about 500 and about 600, between about 600 and about 700, between about 700 and about 800, between about 800 and about 900, or between about 900 and about 1000 pm. In some embodiments, there are about 10 to about 300,000 cells per a core-shell particle. In some embodiments, spheroids can also contain multiple core-shell particles such as 1 to 50 particles within one spheroid.II. Screening Methods

[0112] Provided herein are methods of screening an encoded library for activity in vivo in a cell culture. In some embodiments, a 3D tissue culture comprises cells and a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells. The core-shell particle is inside the 3D tissue culture. The 3D tissue culture is irradiated with violet light having a wavelength of about 400 nm. In some embodiments, a library member attached to the encoded library bead is released from the bead by cleaving a photocleavable linker attaching the library member to the encoded library bead via irradiation. In some embodiments, a reporter is synthesized by the cell upon activation or repression of a cell signaling pathway caused by the released library member. The screening of an encoded library for activity in vivo can be achieved by detecting binding of the reporter to a reporter ligand or detecting a detectable product resulting from an interaction between the reporter and a reporter probe in the polymeric matrix of the core-shell particle. In some embodiments, the encoded library is a DNA encoded library (DEL). In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the library member is a DEL member.

[0113] In some embodiments, the reporter probe or the reporter ligand comprises a detectable tag, comprising an oligonucleotide, an antibody epitope, or a probe of enzymatic 38MF-363428659Attorney Docket No.: 146392068340-P39714WO1activity. In some embodiments, the reporter probe is an oligonucleotide or modified oligonucleotide. In some embodiments, the reporter probe is an antibody epitope. In some embodiments, the reporter probe is a probe of enzymatic activity. In some embodiments, the reporter ligand is an oligonucleotide or modified oligonucleotide. In some embodiments, the reporter ligand is an antibody epitope.

[0114] In some embodiments, the reporter ligand and / or the reporter probe are attached or incorporated to the polymeric matrix covalently or non-covalently. In some embodiments, the reporter ligand contains oligonucleotide, modified oligonucleotide, and / or antibody epitope. In some embodiments, the reporter probe contains oligonucleotide, modified oligonucleotide, antibody epitope, and / or probe of enzymatic activity. In some embodiments, the oligonucleotide and / or the antibody epitope and / or the probe of enzymatic activity are covalently incorporated as a copolymer in the polymeric matrix of the core-shell particle. In some embodiments, the reporter ligand and / or the reporter probe is attached to the polymer matrix through oligonucleotide hybridization. In some embodiments, the reporter ligand and / or the reporter probe is attached to the polymer matrix through click chemistry. In some other embodiments, the reporter ligand and / or the reporter probe is incorporated into the polymer matrix through non-covalent interactions such as Van der Waals Forces, hydrogen bonding, hydrophobic interactions, 71-71 interactions, or electrostatic interactions.

[0115] In some embodiments, screening is carried out using flow cytometry, fluorescence-activated cell sorting (FACS), microfluidics-based cell sorting, imaging flow cytometry, and / or automated cell sorters. In some embodiments, for the 3D tissue culture, the cells can be optionally dissociated with the core-shell particle before the flow cytometry sorting and analysis. In some embodiments, the core-shell particles are sorted by flow cytometry without the cells. In some embodiments, the core-shell particles are sorted and processed with cells attached.

[0116] In some embodiments, the methods of screening an encoded library for activity in vivo use the composition comprises a 3D tissue culture composition. In some embodiments, the 3D tissue culture comprises cells, wherein the cells are from an engineered reporter cell line. In some embodiments, the cells are HEK293T cells. In some embodiments, the 3D tissue culture is a spheroid culture.39MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0117] In some embodiments, the methods of screening an encoded library for activity in vivo use the composition comprises a 3D tissue culture composition comprising core-shell particles having a diameter of about 10 pm to about 40 pm, such as, for example, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 pm, in diameter, or a diameter within a range defined by any two of the aforementioned values, such as about 10-15 pm, about 10-20 pm, about 15-20 pm, about 20-25 pm, about 20-30 pm, about 25-30 pm, about 30-35 pm, about 30-40 pm, or about 35-40 pm. In some embodiments, the core-shell particle has a diameter of about 20 pm, or about 37 pm. In some embodiments, the core-shell particle has an encoded library bead as the core and a polymeric matrix as the shell. In some embodiments, the encoded library bead is a DEL bead.

[0118] In some embodiments, the methods of screening an encoded library for activity in vivo use the composition comprises a 3D tissue culture composition further comprising coreshell particles. In some embodiments, the core-shell particle comprises a DEL bead as the core and a polymeric matrix as the shell. In some embodiments, a DEL member is attached to the DEL bead of the core-shell particle via a photocleavable linker. In some embodiments, the photocleavable linker is a nitrobenzene-derived linker. In some embodiments, the photocleavable linker is configured to release the DEL member upon photo induced cleavage. In some embodiments, the photo induced cleavage is under violet light having a wavelength of about 400 nm. In some embodiments, the photo induced cleavage is under the light having a wavelength ranging from about 290 nm to about 490 nm. In some embodiments, the DNA-encoding tag is configured to remain attached to the DEL bead of the core-shell particle when irradiated.

[0119] In some embodiments, the methods of screening an encoded library for activity in vivo comprise detecting fluorescent signals from a 3D tissue culture composition. In some embodiments, the 3D tissue composition comprises cells core-shell particles. In some embodiments, the methods of screening an encoded library for activity in vivo comprise dissociation of the cells from the core-shell particles. In some embodiments, the methods of screening an encoded library for activity in vivo comprise sorting with flow cytometry. In some embodiments, the core-shell particle comprises the encoded library bead, further40MF-363428659Attorney Docket No.: 146392068340-P39714WO1comprising an encoding tag and a library member, which is compound or chemical entity. In some embodiments, the library member is a stimulus for a cell to synthesize a reporter. In some embodiments, the library member’s structure is described by the encoding tag. In some embodiments, the encoding tag is modularly assembled on the encoded library bead. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the library member is a DEL member. In some embodiments, the encoding tag is a DNA-encoding tag. In some embodiments, the DEL member’s structure and / or synthetic route is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled on the DEL bead.

[0120] In some other aspects, the present invention comprises a method driven by proximity -based cellular signal detection. In some embodiments, for instance labeling kinetics are dependent on fluorescent protein-HaloTag reporter concentration, wherein significant labeling is only observed after incubating the DEL beads with 10 pM cherry -HaloTag. At 10 nM cherry -HaloTag, which corresponds to the concentration of reporter in the bulk culture medium (as measured by fluorimetry of the spent media), there is minimal observed DEL bead labeling. This observation suggests that promiscuous labeling of DEL beads from incubating in the culture media alone is unlikely to be detectable.

[0121] In some embodiments, the reporter ligand is methacrylamide-modified chlorohexane HaloTag ligand. In some embodiments, the reporter probe comprises a detectable tag comprising an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity. In some embodiments, the reporter probe comprises a detectable tag comprising an oligonucleotide. In some embodiments, the reporter probe comprises a detectable tag comprising an antibody epitope. In some embodiments, the reporter probe comprises a detectable tag comprising a probe of enzymatic activity. In some embodiments, the probe of enzymatic activity generates detectable signal in the presence of the cognate reporter enzyme. In some embodiments, the reporter ligand has an affinity tag.

[0122] In some embodiments, the methods of screening comprise the cells that are optionally dissociated with the core-shell particle and the core-shell particles are further sorted by flow cytometry or other sorting or selection techniques.III. Synthesis Methods41MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0123] Provided herein are methods of producing a composition comprising the coreshell particle by emulsifying an aqueous solution comprising monomer, reporter ligand and / or reporter probe, ammonium persulfate polymerization catalyst, and encoded library beads with an oil phase containing TEMED catalyst and thereby producing the composition comprising the encoded library bead core and the polymeric matrix shell. In some embodiments, the reporter ligand and / or the reporter probe, are covalently and / or non-covalently incorporated in the polymeric matrix via copolymerization, nucleic acid hybridization, click chemistry, Van der Waals Forces, hydrogen bonding, hydrophobic interactions, 71-71 interactions, and / or electrostatic interactions.

[0124] In some embodiments, the methods of producing a composition comprising the core-shell particle comprise emulsifying an aqueous solution comprising acrylamide monomer, reporter ligand and / or reporter probe, ammonium persulfate polymerization catalyst, and encoded library beads with an oil phase containing TEMED catalyst and thereby producing the composition comprising the encoded library bead core and the polymeric matrix shell. In some embodiments, the core-shell particles comprising the encoded library bead core and the polymeric matrix shell are isolated from the oil phase via filtration. In some embodiments, the encoded library bead is a DEL bead.

[0125] In some embodiments, the methods comprise using emulsion process to synthesize the core-shell particles, wherein the emulsified solution forms droplets, with each of the droplet containing an encoded library bead and polymer precursor. Upon polymerization, a polymeric matrix or hydrogel shell forms around each bead, encapsulating it and incorporating the reporter ligands or / and reporter probes into the polymeric matrix or the shell of the core-shell particles. In some embodiments, the methods comprise attaching encoding tags (e.g., DNA-encoding tags) into the library bead core of the core-shell particles, wherein each encoding tag corresponds to a library member attached to the library bead core via a photocleavable linker. In some embodiments, the library member is a stimulus for a cell to synthesize a reporter. In some embodiments, the library member’s structure is described by the encoding tag. In some embodiments, the encoding tag is modularly assembled on the encoded library bead. In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the library member is a DEL member. In some embodiments, the encoding tag is a DNA-encoding tag. In some embodiments, the DEL member’s structure42MF-363428659Attorney Docket No.: 146392068340-P39714WO1and / or synthetic route is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled on the DEL bead.

[0126] In some embodiments, the reporter ligand and / or the reporter probe, are covalently and / or non-covalently incorporated in the polymeric matrix via copolymerization, hybridization, and / or click chemistry. In some embodiments, the reporter probe or the reporter ligand comprises a detectable tag, an oligonucleotide, a methacrylamide-modified oligonucleotide, an antibody epitope, or a probe of enzymatic activity. In some embodiments, the reporter probe is an oligonucleotide or modified oligonucleotide. In some embodiments, the reporter probe is an antibody epitope. In some embodiments, the reporter probe is a probe of enzymatic activity that generates detectable signal in the presence of the cognate reporter enzyme. In some embodiments, the reporter ligand is an oligonucleotide or methacrylamide-modified oligonucleotide. In some embodiments, the reporter ligand is an antibody epitope. In some embodiments, the reporter ligand has an affinity tag. In some embodiments, the reporter ligand is methacrylamide-modified chlorohexane HaloTag ligand. In some embodiments, the reporter probe is an enzymatic activity probe which is methacrylamide-modified.

[0127] In some embodiments, the encoded library bead is a DEL bead. In some embodiments, the composition is a 3D tissue culture comprising the cells and the core-shell particle, wherein the cells are seeded and viable on the core-shell particle. In some embodiments, the shell of the core-shell particle comprises a signal detection element and a cell adhesion promoter, wherein the cell adhesion promoter is immobilized in or linked to or incorporated into the polymeric matrix via covalent or non-covalent binding. In some embodiments, the cell adhesion promoter is gelatin, collagen, fibronectin, laminin, poly-L-lysine, poly-D-lysine, vitronectin, RGD peptides, Matrigel, hyaluronic acid, or chitosan, or methacrylated or acrylated derivatives of the above cell adhesion promoters. These cell adhesion promoters are either covalently grafted, non-covalently incorporated, or copolymerized into the polymeric matrix.

[0128] In some embodiments, the methods of producing a composition comprising the core-shell particle further comprise seeding the polymeric matrix of the core-shell particle with cells and culturing the seeded core-shell particle in a media, thereby producing a composition comprising a 3D tissue culture comprising seeded cells, wherein the polymeric matrix of the core-shell particle serves as a substrate for the 3D tissue culture. In some 43MF-363428659Attorney Docket No.: 146392068340-P39714WO1embodiments, the 3D tissue culture is a spheroid culture, organoid culture, or other multicellular conglomerates.

[0129] In some embodiments, the methods of producing a composition comprising the core-shell particles further comprise coating cell adhesion promoters onto the core-shell particle. In some embodiments, the coating process is introduced as a late-stage functionalization of the core-shell particles. In some embodiments, the core-shell particles have a DEL bead as the core and a polymeric matrix as the shell. The polymeric matrix is coated with cell adhesion promoters such as gelatin, collagen, fibronectin, laminin, poly-L-lysine, poly-D-lysine, vitronectin, RGD peptides, Matrigel, hyaluronic acid, or chitosan, or methacrylated or acrylated derivatives of the above cell adhesion promoters.

[0130] In some embodiments, the methods of producing a composition comprise emulsification of the library beads with signal detection elements and reporter ligands and / or reporter probes. In some embodiments, the methods comprise adding the reporter ligands and / or reporter probes before the emulsion process. In some embodiments, the methods comprise adding the reporter ligands and / or reporter probes during the emulsion process. In some embodiments, the methods comprise adding the reporter ligands and / or reporter probes after the emulsion process. In some embodiments, the methods involve adding the reporter ligands and / or reporter probes directly onto the library bead. In some embodiments, the library beads are DEL beads.

[0131] In some embodiments, the composition produced by methods disclosed herein further comprises the cherry-HaloTag fusion protein as a reporter that binds to a reporter ligand in the polymeric matrix of the core-shell particle, wherein the cherry-HaloTag fusion protein accumulates in the polymeric matrix of the core-shell particle. In some embodiments, the polymeric matrix is polyacrylamide hydrogel. In some embodiments, the reporter ligand is a chlorohexane HaloTag ligand, wherein the cherry-HaloTag fusion protein binds to the chlorohexane HaloTag ligand. The chlorohexane HaloTag ligand is covalently incorporated to the polymeric matrix of the core-shell particle.

[0132] In some embodiments, the cells produce or synthesize enzymatic reporters in response to a stimulus. In some embodiments, the enzymatic reporter is selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, and44MF-363428659Attorney Docket No.: 146392068340-P39714WO1enterokinase. In some embodiments, the cells produce and secrete reporters in response to a stimulus. In some embodiments, the reporter is a cherry -HaloTag fusion protein.

[0133] In some embodiments, the composition comprising the core-shell particle produced by the methods comprises the DEL bead, further comprising a DNA-encoding tag and a DEL library member, which is compound or chemical entity. In some embodiments, the DEL library member is a stimulus for a cell to synthesize a reporter. In some embodiments, the DEL library member’s structure and / or synthetic route is described by the DNA-encoding tag sequence. In some embodiments, the DNA-encoding tag is modularly assembled on the DEL bead. In some embodiments, the DNA-encoding tag is modularly assembled on the DEL bead. In some embodiments, the DEL library member is attached to the DEL bead of the core-shell particle via a photocleavable linker. In some embodiments, the photocleavable linker cleaves after irradiation and releases the DEL library member. In some embodiments, the photocleavable linker is a nitrobenzene-derived moiety. In some embodiments, the DNA-encoding tag remains attached to the DEL bead of the core-shell particle despite the irradiation. In some embodiments, the irradiation is with violet light having a wavelength of about 400 nm.

[0134] In some embodiments, the DEL library member stimulates cells to synthesize a reporter. In some embodiments, the DEL library member stimulates cells to secrete an affinity -tagged fluorescent protein reporter. In some embodiments, the DEL library member is a STING agonist or a STING antagonist.

[0135] In some embodiments, library member is released from the core-shell particle after irradiation. The released library member is in a concentration gradient around the encoded library bead of the core-shell particle. In some embodiments, the cells directly attached to the polymeric matrix of the core-shell particle receive the highest concentration of the released library member. In some embodiments, the library member is a DEL library member. In some embodiments, the encoded library bead is a DEL bead.

[0136] In some embodiments, the cells are optionally dissociated with the core-shell particle and the core-shell particle are further sorted by flow cytometry. In some embodiments, the composition is sorted by flow cytometry, wherein the composition comprises the core-shell particle and the cells. In some embodiments, the core-shall particle inside the 3D tissue composition is optionally dissociated with cells and subsequently sorted45MF-363428659Attorney Docket No.: 146392068340-P39714WO1by flow cytometry. In some embodiments, the cells are optionally dissociated with the coreshell particle and the core-shell particles are further sorted by flow cytometry or other sorting or selection techniques.

[0137] In some embodiments, the DEL beads are further coated with a polymeric matrix containing signal detection elements and cell adhesion promoters. The signal detection elements comprise an affinity-tagged ligand. The present application uses these coated DEL beads as substrates for 3D tissue culture. In some embodiments, a coated DEL bead is seeded with cells, creating a spheroid culture. For example, a particle comprising DEL bead coated in a polymeric matrix further inside a 3D tissue culture, such as a spheroid culture, is further irradiated with violet light (400 nm) (Fig. IB) releasing the DEL member in a gradient around the bead (Fig. 1C), with cells directly attached to the coated DEL beads receiving the highest concentration of the DEL member. If the DEL member is cell active, it can stimulate cells to secrete affinity-tagged reporters, which are subsequently captured by the affinity-tagged ligands within the polymeric matrix coated on the DEL bead (Fig. ID). These captured reporters can be used as marks for the particles for later sorting via flow cytometry (Fig. IE). In some embodiments, the spheroid culture comprises cells from an engineered reporter cell line which can secrete an affinity -tagged fluorescent protein reporter when stimulated. In some embodiments, the seeded coated DEL beads are cultured in media to yield spheroid cultures, organoid cultures, or other multi-cellular conglomerates.

[0138] In some aspects, the present invention features one or more polymer coating processes to prepare polymeric matrix coated DEL beads for 3D tissue culture and cell signaling detection. In some embodiments, DEL beads are emulsified in aqueous solution containing acrylamide monomer, oligonucleotide, and affinity -tagged ligand together with ammonium persulfate polymerization catalyst. The other catalyst, TEMED, is added to the oil phase which is emulsified with the aqueous solution. The emulsion creates a hydrogel shell (i.e., the polymeric matrix) around the DEL beads after curing, with both the affinity-tagged ligand and the oligonucleotide covalently incorporated as a copolymer in the polymeric matrix (Fig. 3A). In some embodiments, the oligonucleotide is methacrylamide-modified DNA oligonucleotide. In some embodiments, the affinity-tagged ligand is methacrylamide-modified HaloTag chlorohexane ligand.

[0139] In some embodiments, the polymeric matrix coated DEL beads are further washed and probed with both Cy5-labeled oligonucleotide complement of the oligonucleotide 46MF-363428659Attorney Docket No.: 146392068340-P39714WO1immobilized in the polymeric matrix and / or a cherry-HaloTag fusion protein. The Cy5-labeled oligonucleotide complement can bind to the oligonucleotide immobilized in the polymeric matrix coated on the DEL beads (Fig. 3B). The cherry-HaloTag fusion protein can bind to the chlorohexane tag of the methacrylamide-modified HaloTag chlorohexane ligand in the polymeric matrix coated on the DEL beads (Fig. 3B). This step can serve as a QC step monitored by flow cytometry, which can readily detect Cy5-oligonucleotide and cherry-HaloTag binding to the polymeric matrix coated DEL beads via their signature fluorescence (Fig. 3C). As shown in Fig. 3C, Cy5-labeled oligonucleotide QC can be achieved by monitoring the fluorescence at 660 nm from the bound particles and HaloTag ligand binding QC can be achieved by monitoring the fluorescence at 580 nm from the bound particles. Titration studies revealed that very high local concentrations of cherry-HaloTag are required to drive labeling of the particles; even modest concentrations of cherry-HaloTag (< 1 pM) inefficiently label the particles (Fig. 3D). Cherry-HaloTag particle labeling kinetics were studied by labeling particles under conditions of systematically lower cherry-HaloTag concentrations at constant incubation conditions for 24 hours.

[0140] In some aspects, the present invention comprises a method of coating a polymeric matrix or a hydrogel layer comprising signal detection elements and cell adhesion promoters on one or more types of beads, wherein the method can be applied to any bead-based encoded library screening technologies. In some embodiments, for instance one can first conduct a highly complex split-and-pool DNA-encoded solid-phase synthesis and complete library chemistry QC procedures to validate the synthesis, then one further modifies the finished DEL beads for cellular screening via coating of a polymer matrix or hydrogel layer comprising signal detection elements and cell adhesion promoters on the bead. This late-stage bead functionalization method, comprising coating a polymeric matrix or a hydrogel layer comprising signal detection elements and cell adhesion promoters, on a DEL bead allows a user to employ the method across any bead-based encoded library technologies.IV. Methods of Producing a DNA-encoded Library

[0141] Also provided herein are methods of producing a DN A-encoded library (DEL). In some embodiments, the DEL comprises particles, wherein each particle comprises a different DNA sequence. In some embodiments, the DNA sequence is associated with a DNA-encoding tag and a corresponding DEL member (i.e., stimulus) In some embodiments, the 47MF-363428659Attorney Docket No.: 146392068340-P39714WO1DEL member is attached to the particle via a photocleavable linker, such as 2-nitrobenzyl, 6-nitroveratryl, 3,5-dimethoxybenzoin, 7-nitroindole, 1-pyrenylmethyl, coumarin-based linkers, 4,5-dimethoxy-2-nitrobenzyl, o-nitrophenylethyl, and ruthenium -based photolabile linkers. In some embodiments, the DNA is used as a barcode or tag to identify the DEL member associated with the particle.

[0142] In some embodiments, the method comprises incubating a core-shell particle comprising a DEL bead as the core, coated in a polymer matrix as the shell comprising a signal detection element and a cell adhesion promoter under conditions that allow cells to seed and grow on the polymer matrix shell, forming a 3D tissue culture composition. In some embodiments, the cell adhesion promoter and / or the signal detection element are immobilized in the polymeric matrix via covalent or non-covalent binding.

[0143] In some embodiments, the library includes one or more labels that allow for detection In some embodiments, the library includes a plurality of signal detection elements. In some embodiments, each signal detection element of the plurality of signal detection elements includes a reporter ligand or a reporter probe.

[0144] In some embodiments, the library includes a plurality of DNA-encoding tags. In some embodiments, each DNA-encoding tag of the plurality of DNA-encoding tags includes a conserved sequence region (e.g., a primer-binding region) and a different encoding region corresponding to the DEL member which can be a chemical entity. In some embodiments, the encoding tag encodes for use of the library and / or the identity of the library. In some embodiments, the encoding tag encodes for individual bead identities, such that the identical library member observed on different beads during screening can be deduced.

[0145] In some embodiments, methods of screening a DNA-encoded library for activity in vivo in a cell culture comprising irradiating the cell culture comprising the DNA-encoded library with violet light, wherein the photocleavable linker attaching a library member to the DEL bead is cleaved and the library member is released. If the library member is a stimulus that can activate or repress a cell signaling pathway of the cell culture, the cell culture produces reporters in response to the activation or repression. In some embodiments, the screening methods provided herein further comprise detecting binding of the reporter to the reporter ligand or a detectable product resulting from an interaction between the reporter and the reporter probe in the polymeric matrix of the core-shell particle. In some embodiments,48MF-363428659Attorney Docket No.: 146392068340-P39714WO1the reporter ligand and / or reporter probe include detectable tags, oligonucleotides, methacrylamide-modified oligonucleotides, antibody epitopes, or probes of enzymatic activity.

[0146] In another aspect, provided herein comprises a library including one or more coreshell particles described herein, wherein the shell serving as a substrate for the cells. In some embodiments, the library includes a plurality of DNA-encoding tags. In other embodiments, each DNA-encoding tag of the plurality of DNA-encoding tags comprises a conserved sequence region (e.g., a primer-binding region) and a different encoding region (e.g., a tag corresponding to a unique DEL member, such as a chemical entity, of the library). In particular embodiments, the library includes between about IO to 1012core-shell particles (e.g., about 102to 103, about 102to 104, about 102to 105, about 102to IO6, about 102to 107, about IO2to 108, about 102to 109, about IO2to IO10, about IO2to 10n, about 102to IO12, about IO2to 108, about 103to 109, about 104to IO9, about 105to IO10, about 10’ to 1011, about 102to l()iS, about 102to IO19, about IO4to 10s, about 104to 106, about IO4to 10'', about IO4to 108, about IO4to 109, about 104to IO10, about 104to 10n, about IO4to 1012, about IO2to 107, about 102to 106, about 102to 105, about 103to 10!2, about 103to 10lf, about IO3to 10s, about 103to IO6, about 104to IO9, about 105to 10°, about 105toabout 10’ to 108, about 10’ to 109, about 105to IO10, about I05to 1011, or about I05to IO12). In some embodiments, each core-shell particle is different.

[0147] In any of the above embodiments, the method further comprises identifying a library member that activates or inactivates a cell pathway of the cell culture to produce reporters. In some embodiments, the method comprises seeding and growing cells on the core-shell particles of the DNA-encoded library under conditions suitable for the cells to grow 3D tissue cultures. In some embodiments, the method further comprises releasing a photocleavable DEL member from the core-shell particle and contacting the released DEL member with a cell on the core-shell particle under photo-irradiation with suitable wavelength. In some embodiments, the cell contacting the DEL member produces a reporter under suitable conditions. In some embodiments, the reporter produced by the cell contacts the core-shell particle generating a detectable signal or a detectable product. The detectable signal or the detectable product is analyzed to identify the DNA-encoding tag associated with the DEL member.49MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0148] In any of the above embodiments, the encoded information is provided in one or more tags or in a combination of more than one tag. In some embodiments, the encoded information is represented by more than one tag (e.g., two, three, four, five, six, seven, eight, nine, ten, or more tags). In some embodiments, the encoded information is represented by more than one tag, where all encoding tags are contained within the encoding sequence (e.g., by using a specific tag combination to encode information). In some embodiments, the encoded information is represented by more than one tag, where less than all encoding tags are contained within the encoding sequence (e.g., by using one tag from a set of more than one individual tag to encode within an individual encoding sequence).

[0149] In any of the above embodiments, the DNA-encoding tag comprises from about 5 to about 300 nucleotides. In some embodiments, the headpiece, and / or the oligonucleotide tag comprises from 5 to 250 nucleotides, from 5 to 200 nucleotides, from 5 to 150 nucleotides, from 5 to 100 nucleotides, from 5 to 90 nucleotides, from 5 to 80 nucleotides, from 5 to 70 nucleotides, from 5 to 60 nucleotides, from 5 to 50 nucleotides, from 5 to 40 nucleotides, from 5 to 30 nucleotides, from 5 to 20 nucleotides, from 5 to 10 nucleotides, from 10 to 300 nucleotides, from 10 to 250 nucleotides, from 10 to 200 nucleotides, from 10 to 150 nucleotides, from 10 to 100 nucleotides, from 10 to 50 nucleotides, from 10 to 25 nucleotides, from 20 to 300 nucleotides, from 20 to 250 nucleotides, from 20 to 200 nucleotides, from 20 to 150 nucleotides, from 20 to 100 nucleotides, from 20 to 50 nucleotides, from 30 to 300 nucleotides, from 30 to 250 nucleotides, from 30 to 200 nucleotides, from 30 to 150 nucleotides, from 30 to 100 nucleotides, from 30 to 50 nucleotides, from 40 to 300 nucleotides, from 40 to 250 nucleotides, from 40 to 200 nucleotides, from 40 to 150 nucleotides, from 40 to 100 nucleotides, from 40 to 75 nucleotides, from 40 to 50 nucleotides, from 50 to 300 nucleotides, from 50 to 250 nucleotides, from 50 to 200 nucleotides, from 50 to 150 nucleotides, from 50 to 100 nucleotides, from 50 to 75 nucleotides, from 60 to 300 nucleotides, from 60 to 250 nucleotides, from 60 to 200 nucleotides, from 60 to 150 nucleotides, from 60 to 100 nucleotides, from 60 to 75 nucleotides, from 70 to 300 nucleotides, or from 70 to 250 nucleotides, from 70 to 200 nucleotides, from 70 to 150 nucleotides, from 70 to 100 nucleotides, from 80 to 300 nucleotides, from 80 to 250 nucleotides, from 80 to 200 nucleotides, from 80 to 150 nucleotides, from 80 to 100 nucleotides, from 90 to 300 nucleotides, from 90 to 250 nucleotides, from 90 to 200 nucleotides, from 90 to 150 nucleotides, or from 90 to 100 nucleotides, from 100 to 300 nucleotides, from 100 to 25050MF-363428659Attorney Docket No.: 146392068340-P39714WO1nucleotides, from 100 to 200 nucleotides, from 100 to 150 nucleotides, from 100 to 120 nucleotides, from 150 to 300 nucleotides, from 150 to 250 nucleotides, from 150 to 200 nucleotides, or from 200 to 300 nucleotides, from 200 to 250 nucleotides, and from 250 to 300 nucleotides.

[0150] In some embodiments, the oligonucleotide sequence of the DNA-encoding tag is associated with additional information such as the concentration of functional sites, unique bead identifier for counting different beads bearing the same library member, unique molecule identifier (UMI) for counting the number of distinct reads of an encoding sequence, or different batches of core-shell particles.

[0151] In some embodiments, the method further comprises amplifying the oligonucleotide of the DNA-encoding tag. In some embodiments, the oligonucleotide is amplified to product the library. In some embodiments, the oligonucleotide is sequenced to determine the DEL member attached to a core-shell particle. In some embodiments, the oligonucleotide sequence of the DNA-encoding tag is associated with additional information such as the concentration of functional sites, unique bead identifier for counting different beads bearing the same library member, unique molecule identifier (UMI) for counting the number of distinct reads of an encoding sequence, or different batches of core-shell particles.

[0152] In yet another aspect, the invention comprises a high-throughput method of screening a plurality of chemical entities. The method includes the following steps. Firstly, irradiating a DEL library, comprising a core-shell particle and cells, wherein the shell of the core-shell particle is configured to serve as a substrate for the cells. When the irradiating light has a suitable wavelength (e.g., violet light), a photocleavable linker is cleaved, releasing a library member (e.g., a DEL member). Secondly, detecting binding of a reporter via a detectable signal (e.g., fluorescence) or detecting a detectable product resulting from an interaction between a reporter and a reporter probe in the shell of the core-shell particle, wherein the reporter is produced by the cells stimulated by the library member (e.g., the DEL member).

[0153] These methods can be used to screen large compound libraries for bioactive molecules. In particular, the methods disclosed herein can be used to screen DELs directly for cell-active compounds, even when the cellular targets are still unknown. These high-throughput screening methods based on phenotypic cellular screening are critical in early51MF-363428659Attorney Docket No.: 146392068340-P39714WO1drug discovery, particularly in the serendipitous discovery of bioactive small molecules that affect difficult-to-drug proteins and pathways. In particular embodiments, the method comprises identifying a disease-correcting library member (e.g., a small molecule) that activates or inactivates a cellular pathway of therapeutic interest. In any of these instances, the library members (e.g., DEL member) can be identified by the oligonucleotide or DNA-encoding tags.

[0154] In some other aspects, provided herein are kits comprising the 3D tissue culture composition. In some embodiments, the kits comprise the library of the 3D tissue culture composition. In some embodiments, the kits comprise a 3D tissue culture composition comprising the core-shell particles produced by the methods disclosed herein. In some embodiments, the kits comprise a library of the 3D tissue culture compositions comprising the core-shell particles produced by the methods disclosed herein.

[0155] In some embodiments, one or more 3D tissue culture compositions comprising the core-shell particles are produced by the methods disclosed herein. In some embodiments, one or more libraries of the 3D tissue culture compositions comprising the core-shell particles are produced by the methods disclosed herein.

[0156] In some embodiments, one or more high-throughput screening methods comprising a phenotypic DEL screening of the library for a compound are provided herein. In some embodiments, the phenotypic DEL screening does not require a known cellular target. In some embodiments, the phenotypic DEL screening is a phenotypic cellular screening. In some embodiments, the phenotypic cell screening comprises detection of a cellular activity. In some embodiments, the cellular activity is cell signaling or other changes in cellular physiological / metabolic state, including gene expression. In some embodiments, the cell signaling comprises a fluorescence signal. In some embodiments, the compound that stimulates the cellular activity is a molecule that penetrates the plasma membrane and modulates complex signaling pathways.EMBODIMENTS

[0157] The following embodiments are exemplary and are not intended to limit the scope of any invention described herein.

[0158] 1. A composition comprising52MF-363428659Attorney Docket No.: 146392068340-P39714WO1(i) a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell; and(ii) cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells.

[0159] 2 The composition of embodiment 1, wherein the composition is a 3D tissue culture composition.

[0160] 3. The composition of embodiment 1 or 2, wherein the polymeric matrix comprises a signal detection element and a cell adhesion promoter.

[0161] 4. The composition of embodiment 3, wherein the cell adhesion promoter is immobilized in the polymeric matrix via covalent or non-covalent binding.

[0162] 5. The composition of embodiment 3, wherein the signal detection element is immobilized in the polymeric matrix via covalent or non-covalent binding.

[0163] 6. The composition of any one of embodiments 3-5, wherein the signal detection element comprises a reporter ligand and / or a reporter probe.

[0164] 7 The composition of embodiment 6, wherein a reporter binds to the reporter ligand.

[0165] 8. The composition of embodiment 7, wherein the reporter is a cherry-HaloTag fusion protein.

[0166] 9. The composition of embodiment 6, wherein a reporter transforms the reporter probe to a detectable product.

[0167] 10. The composition of embodiment 9, wherein the reporter is an enzyme selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, luciferase, and enterokinase.

[0168] 11. The composition of any one of embodiments 1-10, wherein the cell synthesizes the reporter.

[0169] 12. The composition of any one of embodiments 1-11, wherein the cell synthesizes the reporter in response to a stimulus.53MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0170] 13. The composition of any one of embodiments 1-12, wherein the cell secretes the reporter.

[0171] 14. The composition of any one of embodiments 1-12, wherein the cell displays the reporter on the cell surface.

[0172] 15. The composition of any one of embodiments 1-14, wherein the cells of the 3D tissue culture composition are selected from engineered reporter cell lines comprising varying degrees of gene expression levels via selection of different strength synthetic promoters or the use of endogenous promoters.

[0173] 16. The composition of embodiment 15, wherein a high gene expression promoter is a CAG gene expression promoter and a low gene expression promoter is a PGK gene expression promoter.

[0174] 17. The composition of embodiment 7, wherein the reporter ligand is selected from the group consisting of chlorohexane HaloTag ligand, methacrylamide-modified chlorohexane HaloTag ligand, HaloTag diAcFAM ligand, HaloTag PEG-biotin ligand, HaloTag amine-PEG-biotin ligand, HA tag, Flag tag, S-tag, glutathione, NTA, and maltose.

[0175] 18. The composition of embodiment 9, wherein the reporter probe comprises a detectable tag comprising an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity.

[0176] 19. The composition of embodiment 18, wherein the oligonucleotide is a methacrylamide-modified oligonucleotide.

[0177] 20. The composition of embodiment 18, wherein the probe of enzymatic activity is a methacrylamide-modified probe.

[0178] 21. The composition of any one of embodiments 3-20, wherein the cell adhesion promoter and the signal detection element are attached to the polymer matrix through copolymerization, hybridization, or click chemistry.

[0179] 22. The composition of any one of embodiments 6-21, wherein the reporter ligand or the reporter probe is conjugated to an oligonucleotide, wherein the oligonucleotide is hybridized to the polymer matrix comprising a complementary oligonucleotide.54MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0180] 23. The composition of any one of embodiments 1-22, wherein the cells are engineered HEK293T cells.

[0181] 24. The composition of any one of embodiments 1-23, wherein the composition is a 3D cellular culture.

[0182] 25. The composition of any one of embodiments 1-24, wherein the cells comprise seeded and viable cells.

[0183] 26. The composition of any one of embodiments 1-25, wherein the encoded library bead comprises an encoding tag and a library member, wherein the library member is a stimulus for a cell to synthesize a reporter.

[0184] 27. The composition of any one of embodiments 1-26, wherein the encoded library bead is a DNA-encoded library (DEL) bead.

[0185] 28. The composition of any one of embodiments 1-27, wherein the DEL bead of the core-shell particle comprises a DNA-encoding tag and a DEL member.

[0186] 29. The composition of any one of embodiments 1-28, wherein the DEL member is a stimulus for a cell to synthesize a reporter.

[0187] 30. The composition of any one of embodiments 1-29, wherein the DEL member’s structure is described by the DNA-encoding tag sequence.

[0188] 31. The composition of any one of embodiments 1-30, wherein the DNA-encoding tag is modularly assembled.

[0189] 32. The composition of any one of embodiments 1-31, wherein the DEL member is attached to the DEL bead of the core-shell particle via a photocleavable linker.

[0190] 33. The composition of any one of embodiments 1-32, wherein the photocleavable linker is a nitrobenzene-derived linker.

[0191] 34. The composition of any one of embodiments 1-33, wherein the photocleavable linker is configured to release the DEL member upon photo-induced cleavage.

[0192] 35. The composition of embodiment 34, wherein the photo-induced cleavage is under violet light having a wavelength of about 400 nm.55MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0193] 36. The composition of any one of embodiments 27-35, wherein the DNA-encoding tag is configured to remain attached to the DEL bead of the core-shell particle when irradiated.

[0194] 37. The composition of any one of embodiments 1-36, wherein the reporter is inducible.

[0195] 38. The composition of embodiment 37, wherein expression of the reporter in a cell is induced by activation or repression of the cell signaling pathway.

[0196] 39. The composition of embodiment 38, wherein the expression of the cell signaling pathway is activated or repressed by a stimulus, wherein the stimulus is the DEL member.

[0197] 40. The composition of embodiment 39, wherein the DEL member is a STING agonist or STING antagonist.

[0198] 41. The composition of embodiment 40, wherein the STING agonist is 4-(5,6-dimethoxybenzo[b]thiophen-2-yl)-4-oxobutanoic acid.

[0199] 42. The composition of any one of embodiments 27-41, wherein the released DEL member is in a concentration gradient around the DEL bead of the core-shell particle.

[0200] 43. The composition of any one of embodiments 27-42, wherein the concentration of the DEL member is highest closer to the bead.

[0201] 44. The composition of any one of embodiments 1-43, wherein the core-shell particle has a diameter of about 10 pm to about 40 pm.

[0202] 45. The composition of any one of embodiments 1-44, wherein the core-shell particle has a dry diameter of about 20 pm, or hydrated diameter about 37 pm.

[0203] 46. The composition of any one of embodiments 3-45, wherein the cell adhesion promoter is selected from the group consisting of gelatin, gelatin methacrylate, and methacrylated collagen.

[0204] 47. A method of screening an encoded library for activity in vivo in a cell culture comprising56MF-363428659Attorney Docket No.: 146392068340-P39714WO1i) irradiating a composition, comprisinga core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell, and cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells, with violet light,wherein a photocleavable linker attaching a library member to the encoded library bead is cleaved and the library member is released; andii) detecting binding of a reporter to a reporter ligand or a detectable product resulting from an interaction between a reporter and a reporter probe in the polymeric matrix, wherein the reporter is synthesized by the cell upon activation or repression of a cell signaling pathway caused by the library member.

[0205] 48. The method of embodiment 47, wherein the encoded library is a DNA-encoded library (DEL).

[0206] 49. The method of embodiment 48, wherein the reporter probe or the reporter ligand comprises a detectable tag, comprising an oligonucleotide, an antibody epitope, or a probe of enzymatic activity.

[0207] 50. The method of embodiment 49, wherein the detectable tag is attached to the polymeric matrix either covalently or non-covalently.

[0208] 51. The method of embodiment 50, wherein the oligonucleotide and / or the antibody epitope and / or the probe of enzymatic activity are covalently incorporated as a copolymer in the polymeric matrix.

[0209] 52. The method of any one of embodiments 47-51, wherein the cells are optionally dissociated with the core-shell particle and the core-shell particles are further sorted by flow cytometry.

[0210] 53. The method of any one of embodiments 47-51, wherein the composition is sorted by flow cytometry, wherein the composition comprises the core-shell particle and the cells.

[0211] 54. The method of any one of embodiments 47-53, wherein the composition comprises a 3D tissue culture composition.57MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0212] 55. The method of any one of embodiments 47-54, wherein the violet light has a wavelength of about 400 nm.

[0213] 56. The method of any one of embodiments 47-55, the library member is a DEL member comprising STING agonist or STING antagonist.

[0214] 57. The method of any one of embodiments 47-56, wherein the core-shell particle has a diameter of about 10 pm to about 50 pm.

[0215] 58. The method of any one of embodiments 47-57, wherein the cells are engineered HEK293T cells.

[0216] 59. The method of any one of embodiments 47-58, wherein the composition has a 3D cellular culture.

[0217] 60. A method of producing a composition comprising the core-shell particle of embodiment 47, comprisingemulsifying an aqueous solution comprising acrylamide monomer, reporter ligand, reporter probe, ammonium persulfate polymerization catalyst, and encoded library beads with an oil phase containing tetramethylethylenediamine (TEMED) catalyst and thereby producing the composition comprising the encoded library bead core and the polymeric matrix shell; wherein the reporter ligand and / or the reporter probe, are covalently and / or non-covalently incorporated in the polymeric matrix.

[0218] 61. The method of embodiment 60, wherein the encoded library bead is DNA-encoded library bead.

[0219] 62. The method of embodiment 60 or 61, wherein the reporter ligand or the reporter probe comprises oligonucleotide, methacrylamide-modified oligonucleotide, antibody epitope, and probe of enzymatic activity.

[0220] 63. The method of embodiment 62, wherein the reporter ligand is methacrylamide-modified chlorohexane HaloTag ligand.

[0221] 64. The method of embodiment 62, wherein the enzymatic activity probe is methacrylamide-modified.58MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0222] 65. The method of any one of embodiments 60-64, wherein the polymeric matrix further comprises a cell adhesion promoter.

[0223] 66. The method of any one of embodiments 60-65, further comprising seeding the polymeric matrix of the core-shell particle with cells and culturing the seeded core-shell particle in a media,thereby producing a composition comprising a 3D tissue culture comprising seeded cells and viable cells, wherein the polymeric matrix of the core-shell particle serves as a substrate for the 3D tissue culture.

[0224] 67. The method of embodiment 66, wherein the 3D tissue has a spheroid culture.

[0225] 68. The method of any one of embodiments 60-67, wherein the 3D tissue culture comprises cells that synthesize reporters when stimulated.

[0226] 69. The method of any one of embodiments 60-68, wherein the cells secrete reporters in response to a stimulus.

[0227] 70. The method of embodiment 69, wherein the reporter is a cherry-HaloTag fusion protein.

[0228] 71. The method of any one of embodiments 60-70, wherein the cells synthesize enzymatic reporters when stimulated.

[0229] 72. The method of embodiment 71, wherein the enzymatic reporter is selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, beta lactamase, rhamnase, luciferase, and enterokinase.

[0230] 73. The method of any one of embodiments 60-72, wherein the polymeric matrix comprises gelatin, gelatin methacrylate, and methacrylated collagen.

[0231] 74. The method of any one of embodiments 60-73, wherein the encoded library bead of the core-shell particle comprises a DNA-encoding tag and a DEL library member.

[0232] 75. The method of embodiment 74, wherein the DEL library member’s structure is described by the DNA-encoding tag sequence.59MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0233] 76. The method of any one of embodiments 60-75, wherein the DNA-encoding tag is modularly assembled.

[0234] 77. The method of any one of embodiments 60-76, wherein the DEL library member is attached to the DEL bead of the core-shell particle via a photocleavable linker.

[0235] 78. The method of embodiment 77, wherein the photocleavable linker cleaves after irradiation and releases the DEL library member.

[0236] 79. The method of embodiment 78, wherein the photocleavable linker is a nitrobenzene-derived moiety.

[0237] 80. The method of any one of embodiments 60-79, wherein the DNA-encoding tag remains attached to the DEL bead of the core-shell particle despite the irradiation.

[0238] 81. The method of any one of embodiments 60-80, wherein the DEL library member stimulates cells to synthesize a reporter.

[0239] 82. The method of embodiment 81, wherein the DEL library member stimulates cells to secrete an affinity -tagged fluorescent protein reporter.

[0240] 83. The method of any one of embodiments 60-82, wherein the DEL library member is a STING agonist or a STING antagonist.

[0241] 84. The method of any one of embodiments 60-83, wherein the irradiation is with violet light having a wavelength of about 400 nm.

[0242] 85. The method of any one of embodiments 60-84, wherein the released DEL library member is in a concentration gradient around the DEL bead of the core-shell particle.

[0243] 86. The method of embodiment 85, wherein the cells directly attached to the polymeric matrix of the core-shell particle receive the highest concentration of the released DEL library member.

[0244] 87. The method of any one of embodiments 60-86, wherein the cells are optionally dissociated with the core-shell particle and the core-shell particles are further sorted by flow cytometry.60MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0245] 88. The method of any one of embodiments 60-86, wherein the composition is sorted by flow cytometry, wherein the composition comprises the core-shell particle and the cells.

[0246] 89. A 3D tissue culture composition comprising the core-shell particle produced by the method of any one of embodiments 60-88.

[0247] 90. A library of the 3D tissue culture compositions comprising the core-shell particles produced by the method of any one of embodiments 60-88.

[0248] 91. A high-throughput screening method comprising a phenotypic DEL screening of the library of embodiment 90 for a compound.

[0249] 92. The high-throughput screening method of embodiment 91, wherein the phenotypic DEL screening does not require a known cellular target.

[0250] 93. The high-throughput screening method of embodiment 91, wherein the phenotypic DEL screening is a phenotypic cellular screening.

[0251] 94. The high-throughput screening method of embodiment 93, wherein the phenotypic cell screening comprises detection of a cellular activity.

[0252] 95. The high-throughput screening method of embodiment 94, wherein the cellular activity is cell signaling.

[0253] 96. The high-throughput screening method of embodiment 95, wherein the cell signaling comprises a fluorescence signal.

[0254] 97. The high-throughput screening method of embodiment 91, wherein the compound is a molecule that penetrates the plasma membrane and modulates complex signaling pathways.

[0255] 98. A kit comprising the 3D tissue culture composition of embodiment 89.

[0256] 99. A kit comprising the library of the 3D tissue culture compositions of embodiment 90.

[0257] 100. The composition of any one of embodiments 1-46, wherein the concentration of the reporter is about 100 nM to about 100 pM.61MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0258] 101. A library comprising a plurality of DNA-encoding tags, wherein each DNA-encoding tag comprises a conserved sequence region and a different encoding region corresponding to a DEL member, wherein the DEL member is a chemical entity.

[0259] 102. The library of embodiment 101, wherein the encoding region encodes for individual bead identities.

[0260] 103. The library of embodiment 102, wherein the library member observed on different beads during screening can be deduced based on the encoding region.

[0261] 104. A method of identifying library members in a library of embodiments 101-103, comprising:providing a library comprising a plurality of DNA-encoding tags, each encoding tag comprising an encoding region that encodes for individual bead identities,screening the library to identify library members on different beads, and deducing the identity of the library members based on the encoding region.EXAMPLES EXAMPLE 1 - Preparation of core-shell particles for signal detection and control labeling reaction analysis

[0262] This example provides a coating process to prepare core-shell particles, comprising a DEL bead as the core and a polymeric matrix as the shell. Such coating process can be introduced as a late-stage functionalization of the DEL beads. In other words, one could first conduct the highly complex split-and-pool DNA-encoded solid-phase synthesis including library chemistry QC procedures, then one could modify the finished DEL beads for cellular screening by the coating procedure, as demonstrated below.

[0263] DEL beads were first suspended in signal detection hydrogel precursor aqueous solution, comprising acrylamide monomer, methacrylamide-modified DNA oligonucleotide, and methacrylamide-modified HaloTag chlorohexane. Ammonium persulfate was added to the aqueous solution. Then, the aqueous solution was emulsified with oil containing polymerization catalysts such as tetramethylethylenediamine (TEMED) to form a reaction mixture. Then the reaction mixture was cured to form a hydrogel around the DEL bead,62MF-363428659Attorney Docket No.: 146392068340-P39714WO1which was a polymeric matrix. The polymeric matrix-coated DEL beads were isolated from the oil phase via filtration, which was the core-shell particle (Fig. 3 A).

[0264] The polymeric matrix shell of the core-shell particle was functionalized with signal detection elements. Signal detection elements were incorporated via copolymerization. In some instances, the signal detection elements in the polymeric matrix contained copolymerized functional groups, including acrydite-modified oligonucleotide, denoted as quality control 1 (QC1, 10 pM, 10-5relative to hydrogel monomer) and methacrylamide-modified chlorohexane HaloTag ligand (1 mM, 10-3relative to hydrogel monomer).

[0265] The acrydite-modified oligonucleotide (i.e., QC1) was 5' methacrylamide-modified DNA oligonucleotide and the methacrylamide-modified chlorohexane HaloTag ligand was a methacrylamido-PEG4-PEG2-chlorohexane HaloTag ligand for capturing secreted superfolder cherry red fluorescent protein-HaloTag (sfCherry -HaloTag) reporters. The synthesis of methacrylamido-PEG4-PEG2-chlorohexane HaloTag ligand is provided in Example 4.

[0266] Incorporation of the copolymerized functional groups in the polymeric matrix shell of the core-shell particle was validated by either complementary DNA hybridization with Cy5-labeled oligonucleotide complement Cy5-QCl' or covalent labeling by addition of Cherry -HaloTag fusion protein (Fig. 3B). Subsequently, flow cytometry analysis was employed to monitor Cy5 or cherry fluorescence (586 and 660 nm, respectively) (Fig. 3C). Particle fluorescence signals at 586 nm and 660 nm indicated the successful incorporation of the signal detection elements into the polymeric matrix of the core-shell particle. Fig. 3D shows Cherry-HaloTag particle labeling kinetics at constant incubation for 24 hours.

[0267] To study labeling kinetics, the core-shell particles were treated with varying concentrations of purified sfCherry -HaloTag protein (0.1-10 pM) over the course of a standard culture experiment (24 h, 37 °C) and analyzed via flow cytometry. Labeling of the core-shell particles with sfCherry -HaloTag was undetectable (signal -to-noise < 3) below 100 nM sfCherry -HaloTag. Above 1 pM sfCherry -HaloTag, core-shell particle fluorescence was significant (p < 0.01 at 1 pM) and 100-fold higher than background at 10 pM sfCherry-HaloTag (Fig.3D). The quality control labeling reactions described above increased the coreshell particle fluorescence 100-fold over background (Fig. 3C).63MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0268] Labeling kinetics were dependent on cherry -HaloTag reporter concentration, as shown in Fig. 3D. Significant labeling was only observed after incubating the DEL beads with 10 pM cherry -HaloTag. At 10 nM cherry -HaloTag, which corresponded to the concentration of reporter in the bulk culture medium secreted by the cells during culture (as measured by fluorimetry of the spent media), there was undetectable DEL bead labeling. This observation suggested that promiscuous labeling of DEL beads from incubating in the culture media alone is unlikely to be detectable. Therefore, Fig. 3D demonstrated that high local concentrations of cherry -HaloTag (e.g., above 10 pM) are required to drive labeling of the core-shell particle. If the local concentration of cherry -HaloTag was below certain threshold concentration (e.g., around 10 nM), there would be no detectable fluorescence signal.

[0269] The signal detection hydrogel coating does not alter existing DEL synthesis protocols and labeling is kinetically limited for the cherry -HaloTag affinity tag fusion protein. The gel coating occurs as a late-stage functionalization of DEL beads, meaning that the complex split-and-pool solid-phase DEL synthesis is completed before introduction of the polymer shell layers and largely orthogonal to polymer coating. DELs should be devoid of functional groups that react with acrylamide (e.g., thiols) and possibly radical carriers. The 100-fold signal increase during hybridization and cherry -HaloTag capture coating quality control analyses indicate that the signal detection coat will generate sufficient assay window for screening. Kinetically-limited cherry -HaloTag labeling of the chloroalkane signal detection coating is also advantageous: detectable labeling will only occur under high local concentrations of cherry -HaloTag, and not merely incubating in culture media where the concentration of secreted cherry -HaloTag is 10-100 nM.

[0270] Core-shell particles comprising a polymeric matrix (e.g., hydrogel) as the shell and a DEL bead as the core were synthesized. The diameter of the synthesized core-shell particles could be controlled to range from about 10 pm to about 50 pm. The coating procedure yields uniformly coated particles (20 pm dry diameter, 34-38 pm swelled diameter, ~l-pm coat thickness).

[0271] The core-shell particles comprising the polyacrylamide shell and the DEL bead core have a dry diameter of about 20 pm and a hydrated diameter of 37 pm. Signal detection elements, such as chlorohexane HaloTag-containing ligands or Cy5-labeled oligonucleotide complement Cy5-QCl', were incorporated into the polymeric shell of the core-shell particles via covalent interaction. These signal detection elements have been demonstrated to bind to 64MF-363428659Attorney Docket No.: 146392068340-P39714WO1cognate reporters, including Cherry -HaloTag fusion proteins or oligonucleotide-modified dye molecules. Upon binding to the designated reporters, detectable signals such as fluorescence were generated only if the local concentration of the reporters was above a certain threshold value, as determined by titration experiments.EXAMPLE 2 - Cell Growth on Core-Shell Particles and Proximity-Driven Reporter Capture for Signal Detection

[0272] This example shows the preparation of a 3D tissue culture on the core-shell particle.

[0273] Core-shell particles containing signal detection elements in the polymeric matrix were suspended in gelatin solution, with a cell adhesion promoter, and immediately treated with microbial transglutaminase (MTG) to crosslink the gelatin coating, and finally washed to furnish the core-shell particles which were DEL microcarriers with an almost undetectable coating thickness (i.e., core-shell particles containing cell adhesion promoters) (Fig. 4A).

[0274] After the gelatin coating of the core-shell particles, seeding, signal capture, and screening workflow (Fig. 4B) were carried out as follows. First, the gelatinized core-shell particles were seeded with a HEK293T cell reporter line. Wild type (WT), non-secreting cherry -HaloTag expression driven by the low expression PGK promoter (sec- PGK), secreting cherry -HaloTag expressed by the low expression PGK promoter (sec+ PGK) and secreting cherry -HaloTag driven by the high expression CAG promoter (sec+ CAG) were tested (FIG. 4C).

[0275] The reporter cells formed into spheroids around the core-shell particles during culture. The secreted cherry -HaloTag reporters accumulated in the polyacrylamide hydrogel signal detection matrix via covalent linkage to the chlorohexane tags during culture. After culture incubation for 24 hours, cells and core-shell particles were dissociated using 10 mM EDTA treatment. The entire sample including cells and core-shell particles was analyzed by flow cytometry using forward and side scatter as gates to differentiate signals from core-shell particles versus cells.

[0276] The core-shell particles containing spheroids from each of the four cell lines were imaged in phase contrast and epifluorescence ( ex / em = 550 / 586 nm) 20- and 40-hours post seeding (Fig. 4D). WT and non-secreting particle populations were indistinguishable while65MF-363428659Attorney Docket No.: 146392068340-P39714WO1the CAG reporter line shifted mean fluorescence of particles on which they were grown ~ 100-fold (FIG. 4C). The PGK reporter line shifted mean fluorescence of particles on which they were grown ~ 10-fold (FIG. 4C). The WT and non-secreting (sec- PGK) core-shell particles were indistinguishable (FIG. 4C). Phase contrast and epifluorescence micrographs (20 and 40 h post seeding) showed cherry fluorescence distributed throughout the spheroid and visible accumulation of cherry fluorescence on the particle in the PGK and CAG reporter lines.

[0277] The data in Fig. 4C and Fig. 4D showed that a secretion tag was required for generating detectable cherry fluorescence on the core-shell particles. Moreover, the high-expressing CAG cell line produced and secreted reporters, and the core-shell particles generated a signal that was 100-fold over the background, which was readily visualized using imaging microscopy. The intensity of the captured reporters in the shell of the core-shell particles was similar to that observed in a ~10 pM Cherry-Halo labeling experiment and much higher than the ~10 nM Cherry -Halo resulting from core-shell particle incubation in the bulk culture medium.

[0278] Wider field of view micrographs show the uniformity of spheroid size and bead loading in typical seeding and culture experiments while confocal sectioning data confirm that reporter capture is occurring in the spheroid interior (Figs. 4E and 4F).

[0279] Thus, the fluorescence signal detection of the core-shell particles resulted from the selective capture and enrichment of the fluorescent reporters in the shells, rather than from their diffusion in the culture medium. These observations suggested that proximity of the secreting cells to the core-shell particle drove efficient and potentially selective labeling of the core-shell particle with the affinity -tagged secreted reporter protein.

[0280] The above experiments indicate that both reporter expression and a secretion tag are necessary and sufficient for generating detectable cherry fluorescence on the DEL beads. The PGK and CAG cell line reporter capture signals are equivalent to solution concentrations of ~1 and ~10 pM sfCherry-HaloTag standards, indicating high sfCherry-HaloTag concentrations in the immediate vicinity of the reporter cells. Signal detection hydrogel-coated beads thus sense cell signaling in a proximity-driven fashion.66MF-363428659Attorney Docket No.: 146392068340-P39714WO1EXAMPLE 3 - Photochemical induction and on-particle detection of STING signaling in 3D tissue cultures

[0281] This example shows that the core-shell particle system can be used to detect activation of cellular pathways using a candidate compound from a DEL screening library.

[0282] The cancer immunotherapy target cGAS-STING pathway was chosen as a model, and a HEK293 reporter line with both secreted sfCherry-HaloTag and secreted embryonic alkaline phosphatase (SEAP) reporters downstream of interferon stimulated response elements (ISRE) was engineered to test the hypothesis that compound released from the beads inside a spheroid will generate a similarly high concentration field, selectively inducing signaling in core-shell particle-proximal cells.

[0283] Tool beads were generated either by coupling beads with a known STING agonist, such as MSA-2, to a photocleavable linker (PC-MSA-2), or by using negative control blank beads (NEG). Both bead types were encapsulated in polyacrylamide signal detection hydrogel matrix (i.e., the polymeric matrix shell containing signal detection elements) and NEG containing particles were hybridized with a Cy5-labeled oligonucleotide to mark them as negative particles (Fig. 5 A). The PC-MSA-2 and NEG beads were both gelatinized and mixed at either 100:1 or 10:1 NEG: PC-MSA-2 to form model libraries and seeded with the cherry -HaloTag STING reporter line to form spheroids.

[0284] Either 100:1 or 10:1 NEG: PC-MSA-2 mock libraries were seeded at 1000-fold excess of HEK293 STING reporter line (ISRE-sfCherry -HaloTag), yielding empty, singleton, or multi-beaded spheroids (Fig. 5B).

[0285] Spheroid culture was then exposed to violet light via UV-LED strip light illumination (400 nm) for eight 15 min on and 45 min off irradiation cycles, then the spheroids were dissociated for flow cytometry analysis (Fig. 5B). Fig. 5B also shows UV-LED strip (and foil-covered negative control) and cultured to track cellular signaling.Spheroids were imaged in epifluorescence / phase contrast overlay (cherry ex / em = 550 / 580 nm; Cy5 kex / kem = 600 / 660 nm) (Figs. 5C-E and H).

[0286] STING signaling was validated by MSA-2 treatment and detection of secreted embryonic alkaline phosphatase (SEAP) (fluorescein diphosphate substrate) and secreted sfCherry -HaloTag reporters (Fig. 5F).67MF-363428659Attorney Docket No.: 146392068340-P39714WO1

[0287] Spheroid cultures of the STING ISRE-cherry-HaloTag reporter cell line using 100% NEG, 100% PC-MSA-2, and the two model libraries (90: 10, 99: 1) were analyzed by flow cytometry, gating on the particle population (Fig. 5G)

[0288] Micrographs show PC-MSA-2 beads locally inducing on-bead signal capture (Cherry -HaloTag labeling, red) and quiescent cells surrounding NEG beads (Cy5) in separate spheroids (Fig. 5H) and in the same spheroid (Figs. 5D-E), in addition to full field of view (Fig. 5C). Phase contrast and epifluorescence imaging of the irradiated spheroid culture confirmed that core-shell particles were distributed in the spheroids, with predominantly NEG beads. Rarely, PC-MSA-2 and NEG beads were observed in the same spheroid, but Cherry -HaloTag labeling of the NEG beads did not occur (Figs. 5C-E). The data established that promiscuous labeling of beads from incubating in the culture media alone was minimized.

[0289] Validation of the STING reporter cell line on the core-shell particles was performed by conducting a dose-response analysis using MSA-2 as the ligand (i.e., stimulus) and observing reporter secretion as the response. The reporter line cells expressed both a secreted embryonic alkaline phosphatase (SEAP) and the secreted cherry -HaloTag reporters, showing comparable ECso (10-20 pM, Fig. 5F). Flow cytometry analysis of the model 100:1 and 10:1 NEG: PC-MSA-2 libraries revealed 3% and 11% of high-cherry fluorescence beads, respectively, with signals comparable to those of a 100% PC-MSA-2 control bead culture (Fig. 5G).

[0290] These proof-of-concept experiments demonstrated that it is possible to stimulate cells with a high concentration of compounds and detect their signaling output via proximity alone and without any other mode of compartmentalization. Ordinarily, one would expect compartmentalization to be required for confining the compound for testing with the activity assay. Here, the example demonstrated that utilizing proximity alone can drive the selective stimulation and capture of secreted reporters from cells associated with a given DEL coreshell particle. The model library screens further demonstrated the surprising finding that proximity is beneficial to stimulate and selectively label the positive control hit particles.

[0291] These experiments also establish the feasibility of proximity-driven photoinduction and detection of cell signaling using DEL beads and the model cGAS-STING pathway. Party lighting mediates sub-optimal excitation of the o-nitroveratryl system,68MF-363428659Attorney Docket No.: 146392068340-P39714WO1resulting in linear and steady compound release while simultaneously avoiding toxicity of standard 365 nm photocleavage. Compound photocleavage and induced signaling is highly localized as crosstalk is undetectable even in micrographs where NEG and PC-MSA-2 beads are in direct contact within the spheroid. Furthermore, the volume of a shell of HEK cells (~10 pm diameter) around a DEL bead (~40 pm diameter when swelled) is ~ 100 pL, yielding ~ 10-pM compound pulses from each ~l-fmol photocleavage event, not accounting for compound sequestration in cells or transport through membranes. Model library screening data further corroborate the theoretical arguments and micrograph data as PC-MSA-2 positive control bead identification based on STING signaling in spheroid culture agrees with calculated bead spike-in frequencies.Table 1. Oligonucleotide SequencesEXAMPLE 4 - Synthesis of Chlorohexane HaloTag ligandStep 1 Synthesis of 2-(2-((6-chlorohexyl)oxy)ethoxy)ethanamine hydrochloride58% yield over 2 steps

[0292] 2-(2-((6-chlorohexyl)oxy)ethoxy)ethanamine hydrochloride was synthesized according to protocols published in Neklesa, T. K., et al. Nature Chemical Biology 2011, 7,69MF-363428659Attorney Docket No.: 146392068340-P39714WO1538-54 and Banala, S. et al. W02020120636, each of which is incorporated by reference in its entirety.Step 2'. Synthesis of 2-(2-((6-chlorohexyl)oxy)ethoxy)ethanamine93% yieid

[0293] A round bottom flask (50 mL) was charged with ethanolamine (0.048 mL, 0.0500 g, 0.476 mmol, 1 equiv) and the silver tritiate (0.2018 g, 0.785 mmol, 1.65 equiv) and 1.5 mL CH2CI2 was added. 2,6-di-t-butylpyridine (0.214 mL, 0.1820 g, 0.951 mmol, 2 equiv) was added, followed by the remaining 1.5 mL CH2CI2 (final concentration 0.16 M). The iodide was added dropwise. The flask was capped, the reaction sonicated (10 s), and then shielded from light and left to stir (72 h, RT). The resulting reaction mixture consisted of a green-grey solid and a colorless supernatant. The stir bar was removed and base-treated SiC>2 was added to the flask and the mixture concentrated in vacuo to dry load. The product was purified by automated column chromatography on a 12 g column with MeOH (containing 10% NH4OH) in CH2CI2 gradient. 2.5 CV 0.1%, 12.5 CV 0.1 to 10%, 14 CV 10%. The product was isolated as a yellow, viscous oil (0.0992 g, 93% yield). 'H-NMR (400 MHz, CDCI3): 83.73 (br s, 4H), 3.63-3.57 (m, 6H), 3.53 (t, J = 6.7 Hz, 2H), 3.47 (t, J = 6.8 Hz, 2H), 2.99 (t, J = 4.9 Hz, 2H), 1.77 (dt, J = 14.4, 7.0 Hz, 2H), 1.59 (dt, J = 14.5, 7.1 Hz, 2H), 1.49-1.42 (m, 2H), 1.39-1.33 (m, 2H).Step 3 Synthesis of tert-butyl 2-methyl-3-oxo-7, 10, 13,16-tetraoxa-4-azanonadec-l-en- 19-oate

[0294] In a 5-mL centrifuge tube the amine (0.9871 g, 3.0071 mmol, 1 equiv), zirconium beads (6 mm dia.), K2HPO4 (1.0802 g, 6.202 mmol, 2 equiv), methacrylic acid (0.26 mL, 0.2639 g, 3.065 mmol, 1 equiv), COMU (1.4500 g, 3.386 mmol, 1.1 equiv), and the EtOAc (0.6 mL) were combined and homogenized (60 min). Acetonitrile (CAN) was added to fill the volume in the tube and the contents were vortexed and briefly centrifuged. The70MF-363428659Attorney Docket No.: 146392068340-P39714WO1supernatant, which contained the product, was transferred to a round bottom flask. The pellet was washed (3 x ACN) and the combined supernatants were dry loaded on base-treated SiC>2. The product was partially purified by automated column chromatography on a 24 g column, preequilibrated with 20% MeOH (containing 10% NH4OH) in 80% CH2CI2. The gradient used the same solvent system from 2.5 CV 0.1%, 7.1 CV 0.1 to 2.9%, 5.4 CV 2.9 to 10%, 1 CV 10%, 1 CV 10 to 20%, 12.5 CV 20%. A clean fraction (0.3135 g, 26% yield colorless, viscous oil) from the middle of the product trace was used for characterization. The bulk of the material was a yellow, viscous oil, whose mass was inflated by the presence of N, N-Dimethyl-4-morpholinecarboxamide. ’H-NMR (400 MHz, CDCI3): 86.36 (br s, 1H), 5.69 (s, 1H), 5.31 (s, 1H), 3.69 (t, J = 6.6 Hz, 2H), 3.64-3.58 (m, 14H), 3.50 (q, J = 5.1 Hz, 2H), 2.49 (t, J = 6.6 Hz, 2H), 1.95 (s, 3H), 1.43 (s, 9H).13C-NMR (101 MHz, CDCI3): 6 170.99, 168.51, 140.19, 119.58, 80.66, 70.74, 70.71, 70.65, 70.50, 70.39, 69.87, 67.03, 39.49, 36.39, 28.23, 18.80. ESI-HRMS calculated for: Ci^sNOjNa [(M+Na)+]: 412.2311; observed 412.2307.Step 4 Synthesis of 2-Methyl-3-oxo-7, 10, 13,16-tetraoxa-4-azanonadec-l-en- 19-oic acid

[0295] For the purified substrate: In a 100-mL round bottom flask the substrate (0.3135 g, 0.805 mol, 1 equiv) was combined with 2 mL trifluoroacetic acid (TFA) and incubated (24 h). The product was a sticky hydrogel that could not be easily transferred to other containers for further reactions. Using the crude substrate: in a 100-mL round bottom flask the partially dried crude material from the previous step (~4 g) was dissolved in 8 mL 4 M HC1 in dioxane (24-72 h). The crude mixture was partially concentrated in vacuo and then dissolved in ACN, then transferred to a 50-mL centrifuge tube. The tube was frozen and the material lyophilized, leaving the desired crude acid (~3.5 g). 'H-NMR. (400 MHz, CD3OD): 65.71 (app quin, J = 1.0 Hz, 1H), 5.38 (app quin, J = 1.4 Hz, 1H), 3.74 (t, J = 6.2 Hz, 2H), 3.64-3.60 (m, 12H), 3.60-3.57 (m, 3H), 3.43 (t, J = 5.6 Hz, 2H), 2.58 (t, J = 6.2 Hz, 2H), 1.94 (dd, J = 1.5, 1.0 Hz, 3H).13C-NMR (101 MHZ, CD3OD): 6 173.93, 171.32, 141.24, 120.57, 71.50, 71.41, 71.37, 71.24, 70.45, 40.55, 35.70, 18.80. ESI-HRMS calculated for: Cis^NChNa [(M+Na)+]: 356.1685; observed 356.1690.71MF-363428659Attorney Docket No.: 146392068340-P39714WO1Step 5 Synthesis of N-(2-(2-((6-chlorohexyl)oxy)ethoxy)ethyl)-l-methacrylamido-3,6,9,12-tetraoxapentadecan- 15 -ami de

[0296] In the 50-mL centrifuge tube containing the product of the previous step (theoretical starting mass: 2.1758 g, 6.527 mmol, 1 equiv) was added to the lyophilized amine (1.7087 g, 6.567 mmol, 1 equiv), followed by 5 zirconium beads (6mmdia.), K2HPO4 (4.5431 g, 26.08 mmol, 4 equiv), and an additional 5 zirconium beads (6 mm dia.). This mixture was vortexed (30 min). COMU (3.0034 g, 7.013 mmol, 1.1 equiv) was added. The reaction was vortexed (10 min) and then the ACN (1.5 mL) was added. Then the reaction was vortexed (4.5 h). ACN was added (40 mL), the mixture was vortexed and centrifuged. The supernatant was collected in a round bottom flask. The pellet was washed (3 x ACN). The combined supernatants were dry loaded onto 18 g of base-treated SiCh and purified via normal phase chromatography. The column was preequilibrated with 20% MeOH (containing 10% NH4OH) in 80% CH2CI2. The gradient used the same solvent system from 2.5 CV 0.1%, 12.5 CV 0.1 to 10%, 2 CV 10%. This yielded 1.6828 g (48% yield, 40% of product) of a yellow-orange oil of 84% purity. A second column was run to remove the unreacted amine.1H-NMR. (400 MHz, CD3OD): 85.71 (s, 1H), 5.38 (t, J = 1.3 Hz, 1H), 3.72 (t, J = 6.2 Hz, 2H), 3.64-3.53 (m, 22H), 3.49 (t, J = 6.6 Hz, 2H), 3.44 (t, J = 5.6 Hz, 2H), 3.37 (t, J = 5.6 Hz, 2H), 2.46 (t, J = 6.1 Hz, 2H), 1.94 (s, 3H), 1.77 (dt, J = 14.3, 7.0 Hz, 2H), 1.60 (dt, J = 14.2, 7.0 Hz, 2H), 1.51-1.36 (m, 4H).13C-NMR (101 MHz, CD3OD): 6 174.00, 171.27, 141.31, 120.49, 72.22, 71.51, 71.49, 71.42, 71.32, 71.29, 71.26, 71.20, 70.55, 68.28, 45.70, 40.55, 40.39, 37.55, 33.75, 30.54, 27.74, 26.49, 18.81. ESI-HRMS calculated for: C25H47ClN2O8Na [(M+Na)+]: 561.2919; observed 561.2916.EXAMPLE 5 - PC-MSA-2 Control Bead Synthesis72MF-363428659Attorney Docket No.: 146392068340-P39714WO1Expected m / z: 295.1Observed m / z: 295.1

[0297] DEL beads (100 mg) were added to a syringe (6 mL) fitted with an additional frit. Fmoc was removed (20% piperidine in DMA, 2 x 15 min, RT, 8 rpm) and resin was washed (3 x DMA; 3 x DCM; 3 x DMA). HOCH2-PC-OH (150 pmol) was activated with Oxyma / DIC / TMP (150 / 150 / 300 pmol) in N, N-dimethylformamide (DMA) (150 pL), added to the resin. The beads were incubated (1 h, 50 °C, 8 rpm) then washed (3 x DMA; 3 x DCM; 3 x DMA). The beads (50 mg) were transferred to a fresh syringe (6 mL) fitted with an additional frit. The beads were resuspended (DMA / dichloromethane (DCM), 3 mL) with MSA-2 / 4-dimethylaminopyridine (DMAP) / N, N’ -diisopropylcarbodiimide (DIC) (75 / 30 / 2850 pmol, respectively), incubated (50 °C, 2 h, 8 rpm), then washed (3 x DMA; 3 x DCM; 3 x DMA). A small aliquot of resin was isolated and washed (6 x Bis-Tris propane wash buffer (BTPWB)). Supernatant was removed and replaced with 1: 1 ACN: 0.1% trifluoroacetic acid (TFA) (20 pL). Samples were transferred to a UV oven (CL- 1000, Jena Analytik) and irradiated (2 h, power = 800). Supernatant was removed and analyzed by LC-MS (Thermo ISQ, expected m / z=295.1, observed m / z=295.1).73MF-363428659Attorney Docket No.: 146392068340-P39714WO1EXAMPLE 6 - DEL synthesis and screening for agonists of the cGAS-STING pathway

[0298] This example describes the design, synthesis, and screening of a combinatorial DEL.

[0299] A 3,456-member bespoke DEL was synthesized using two cycles of split-and-pool synthesis. DEL beads displaying both DNA sites for encoding and photocleavable linker for compound synthesis were used as starting material. Bespoke DEL preparation comprised 2 cycles of chemistry: acylation with 48 Fmoc-protected amino acids (AAs) followed by capping with 72 carboxylic acids. (Fig. 6A). Photocleaved library members release from the bead as primary amides, leaving the DNA tag attached to the DEL bead surface.

[0300] PC-MSA-2 and NEG beads comprising a signal detection hydrogel and gelatin cell adhesion layer were prepared as described in Examples 3-5; PC-MSA-2 labeling with Cy5-QCl' rendered the beads traceable during DEL screening (Fig. 6B). DEL screening aliquots, containing ~5 library equivalents (~20k core-shell particles) with ~1% spiked Cy5-labeled PC-MSA-2 positive control beads, underwent seeding with the ISRE-sfCherry-HaloTag reporter cells, spheroid formation, LED illumination, spheroid dissociation, and FACS analysis.

[0301] FACS analysis identified core-shell particles exhibiting the highest 1% and next highest 5% sfCherry fluorescence signal in addition to high-Cy5 fluorescence PC-MSA-2 beads; of the PC-MSA-2 beads, 26% were in the highest 1% Cherry collection gate while 62% were in the next highest 5% sfCherry gate. (Fig. 6C). Negative control experiments included FACS analysis and sorting of top 1% and 5% Cherry fluorescence beads: (1) without cell culture but with party lighting (“no cell”, FIG. 9) or (2) without party lighting but seeded with cells (“Av-”). PCMSA- 2 bead recovery was 88% for illuminated cultures and 2% for Av-control culture (Fig. 6D).

[0302] The STING agonist-inspired DEL screens identified numerous high-Cherry -fluorescence beads and Cy5-labeled positive control PC-MSA-2 beads. Selection of building blocks (BBs) for the STING agonist-inspired DEL favored functional groups common to STING agonists, such as aryl halides, heterocycles, and tetrazole bioisosteres of carboxylic acids. STING agonists contain negatively charged groups such as phosphates and carboxylic acids, which appear to be important in engaging Arg 84 of STING. The STING reporter line screening hit rate is modest (1.3%), indicating that the DEL does not contain promiscuously 74MF-363428659Attorney Docket No.: 146392068340-P39714WO1active building blocks (BBs). Near-quantitative retrieval of PC-MSA-2 beads is strong evidence of the DEL screen’s ability to identify prospective spheroid-active STING pathway activators. However, high-fluorescence hits from the no cell negative control screen coincide with the collection gate from the STING reporter screen, indicating that DNA sequencing analysis of no cell negative control screen’s hits is able to triage high-fluorescence interference compounds.

[0303] Hit deconvolution and validation was then performed for the hits from the STING agonist-inspired DEL screens. DNA tags from 6 replicate library screens (~ 20 library equivalents) were sequenced to deduce the structures of hits that sorted into the top 1 or 5% cherry fluorescence gates. Hit calling by k class, the number of recovered hit beads that display the same compound, was binary according to a false discovery statistical cutoff. The cutoff was determined by randomly sequencing samples of the DEL (3 x 1500-bead samples) to establish a false discovery matrix. Random samples of the library (1500 beads, 3 replicates) were sequenced, deconvoluted, and aggregated by k class (Fig. 7). The Poisson distribution of k classes in a 1500-bead random sample is shown in Fig. 7. False discovery rate (FDR) was calculated as the average observed number of compounds at each k class in the random sample divided by the total number of compounds observed as hits in the screen at each k class. Hits of k > 3 had a false discovery rate < 2.5 % (Fig. 7).

[0304] Aggregation of hits in the top 1% and 5% yielded 44 unique hit structures with k > 3 across the 6 replicate library screens. Several BBs occurred frequently, including cycle 1 amino acids 1 and 2, and cycle 2 carboxylic acid tails 3, 4, and 5 (Fig. 8A); hit 6 contains two of the highly conserved BB series (2 and 4) and hit 7 is a high k class hit with few other hits using either of its BB constituents (Fig. 8B). Sequencing of the no cell negative control revealed several candidate false positive hit series, with one such series extensively using acid tail 3 (Fig. 9). Hits 6 and 7 analyzed as individually synthesized bead sets in spheroid cultures of the ISRE-sfCherry reporter line increase bead cherry fluorescence ~ 10-fold upon party light illumination (Fig. 8B).

[0305] Integration of screening and counter screening data robustly identified promising hit structures for follow-up studies in spheroid culture, the results of which validated screening deconvolution. Compounds with high k class in STING reporter next generation sequencing (NGS) data contain structural features that are reminiscent of known STING agonists. For example, P-dichlorophenylalanine BB 1 is structurally similar to SR-717. As the 75MF-363428659Attorney Docket No.: 146392068340-P39714WO1screen is phenotypic, hits may also act on other elements of the cGAS-STING; compounds that upregulate IFN-P would also trigger this reporter line. High-fluorescence hits from the culture-free negative control screen coincided with the collection gate from the STING reporter screen, indicating that sequencing of beads from this negative control is effective to triage high fluorescence interference compounds. Hits 6 and 7 increase bead fluorescence similar to that of PC-MSA-2 when seeded with reporter cells and illuminated. The reproducibility of these findings suggests that the cellular assay reliably detects compound activity, even outside of library screening conditions.

[0306] Overall, the DEL screen for agonists of the cGAS-STING pathway yielded several hit families and individual compounds that phenotypically validated, and robust recovery of positive control STING agonist MSA-2 beads confirmed that screening was identifying known actives. The synthesis and screening of the bespoke library of 3,456 compounds yielded several BBs and full compounds that recapitulate STING agonist structural trends. The above experiments indicate that spheroid culture and DEL technology scalably interface and facilitate the exploration of structure-activity relationships in complex, tissue-like contexts.

[0307] The custom DEL described in this example allowed elucidation of the structureactivity of known STING agonists while mitigating potential metabolic liabilities. For example, all library members cleaved as primary amides rather than the ubiquitous synthetic STING agonist carboxylic acid.76MF-363428659

Claims

Attorney Docket No.: 146392068340-P39714WO1CLAIMSWhat is claimed is:

1. A composition comprising(i) a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell; and(ii) cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells.

2. The composition of claim 1, wherein the composition is a 3D tissue culture composition.

3. The composition of claim 1 or 2, wherein the polymeric matrix comprises a signal detection element and a cell adhesion promoter.

4. The composition of claim 3, wherein the signal detection element comprises a reporter ligand and / or a reporter probe.

5. The composition of claim 4, wherein a reporter binds to the reporter ligand.

6. The composition of claim 5, wherein the reporter is a cherry -HaloTag fusion protein.

7. The composition of claim 4, wherein a reporter transforms the reporter probe to a detectable product.

8. The composition of claim 7, wherein the reporter is an enzyme selected from the group consisting of beta galactosidase, alkaline phosphatase, horseradish peroxidase, luciferase, and enterokinase.

9. The composition of any one of claims 5-8 wherein:(i) the cell synthesizes the reporter; and / or(ii) the cell synthesizes the reporter in response to a stimulus; and / or(iii) the cell secretes the reporter; and / or(iv) the cell displays the reporter on the cell surface.

10. The composition of claim 5, wherein the reporter ligand is selected from the group consisting of chlorohexane HaloTag ligand, methacrylamide-modified chlorohexane HaloTag 77MF-363428659Attorney Docket No.: 146392068340-P39714WO1ligand, HaloTag diAcFAM ligand, HaloTag PEG-biotin ligand, HaloTag amine-PEG-biotin ligand, HA tag, Flag tag, S-tag, glutathione, NTA, and maltose.

11. The composition of claim 7, wherein the reporter probe comprises a detectable tag comprising an oligonucleotide and / or an antibody epitope and / or a probe of enzymatic activity.

12. The composition of claim 11, wherein the oligonucleotide is a methacrylamide-modified oligonucleotide.

13. The composition of claim 11, wherein the probe of enzymatic activity is a methacrylamide-modified probe.

14. The composition of any one of claims 4-13, wherein the reporter ligand or the reporter probe is conjugated to an oligonucleotide, wherein the oligonucleotide is hybridized to the polymer matrix comprising a complementary oligonucleotide.

15. The composition of any one of claims 1-14, wherein the cells are engineered HEK293T cells.

16. The composition of any one of claims 1-15, wherein the cells comprise seeded and viable cells.

17. The composition of any one of claims 1-16, wherein the encoded library bead comprises an encoding tag and a library member, wherein the library member is a stimulus for a cell to synthesize a reporter.

18. The composition of any one of claims 1-17, wherein the encoded library bead is a DNA-encoded library (DEL) bead.

19. The composition of claim 18, wherein the DEL bead of the core-shell particle comprises a DNA-encoding tag and a DEL member.

20. The composition of claim 19, wherein the DEL member is a stimulus for a cell to synthesize a reporter.

21. The composition of claim 19 or 20, wherein the DEL member’s structure is described by the DNA-encoding tag sequence.

22. The composition of any one of claims 19-21, wherein the DEL member is attached to the DEL bead of the core-shell particle via a photocleavable linker.78MF-363428659Attorney Docket No.: 146392068340-P39714WO123. The composition of claim 22, wherein the DEL member is a STING agonist or STING antagonist.

24. The composition of claim 23, wherein the STING agonist is 4-(5,6-dimethoxybenzo[b]thiophen-2-yl)-4-oxobutanoic acid.

25. The composition of any one of claims 1-24, wherein the core-shell particle has a diameter of about 10 pm to about 40 pm.

26. A method of screening an encoded library for activity in vivo in a cell culture comprisingi) irradiating a composition, comprising a core-shell particle comprising an encoded library bead as the core and a polymeric matrix as the shell, and cells, wherein the polymeric matrix of the core-shell particle is configured to serve as a substrate for the cells, with violet light,wherein a photocleavable linker attaching a library member to the encoded library bead is cleaved and the library member is released; andii) detecting binding of a reporter to a reporter ligand or a detectable product resulting from an interaction between a reporter and a reporter probe in the polymeric matrix, wherein the reporter is synthesized by the cell upon activation or repression of a cell signaling pathway caused by the library member.

27. A method of producing a composition of any one of claims 1-25, comprising emulsifying an aqueous solution comprising acrylamide monomer, reporter ligand, reporter probe, ammonium persulfate polymerization catalyst, and encoded library beads with an oil phase containing tetramethylethylenediamine (TEMED) catalyst and thereby producing the composition comprising the encoded library bead core and the polymeric matrix shell; wherein the reporter ligand and / or the reporter probe, are covalently and / or non-covalently incorporated in the polymeric matrix.

28. The method of claim 27, further comprisingseeding the polymeric matrix of the core-shell particle with cells and culturing the seeded core-shell particle in a media,79MF-363428659Attorney Docket No.: 146392068340-P39714WO1thereby producing a composition comprising a 3D tissue culture comprising seeded cells and viable cells, wherein the polymeric matrix of the core-shell particle serves as a substrate for the 3D tissue culture.

29. The method of claim 27 or 28, wherein the encoded library bead of the core-shell particle comprises a DNA-encoding tag and a DEL library member.

30. The method of claim 29, wherein the DEL library member’s structure is described by the DNA-encoding tag sequence.

31. The method of claim 29 or 30, wherein the DEL library member stimulates cells to synthesize a reporter.

32. The method of any one of claims 29-31, wherein the DEL library member is a STING agonist or a STING antagonist.

34. A library of one or more compositions of any one of claims 1-25.

35. A high-throughput screening method comprising a phenotypic DEL screening of the library of claim 34 for a compound.

36. A kit comprising the 3D tissue culture composition of claim 2.

37. A kit comprising the library of claim 34.

38. A library comprising a plurality of DNA-encoding tags, wherein each DNA-encoding tag comprises a conserved sequence region and a different encoding region corresponding to a DEL member, wherein the DEL member is a chemical entity.

39. The library of claim 38, wherein the encoding region encodes for individual bead identities.

40. The library of claim 39, wherein the DEL member observed on different beads during screening can be deduced based on the encoding region.

41. A method of identifying DEL members in a library of any one of claims 38-40, comprising:providing a library comprising a plurality of DNA-encoding tags, each encoding tag comprising an encoding region that encodes for individual bead identities, screening the library to identify DEL members on different beads, and80MF-363428659Attorney Docket No.: 146392068340-P39714WO1 deducing the identity of the DEL members based on the encoding region.81MF-363428659

Images