A method for increasing the growth rate of rabbits
The single-base mutation of the LTBP2 gene of New Zealand rabbits through gene editing technology solved the problem of slow growth of rabbits, achieved significant improvement in the growth rate and body size of rabbits, and promoted the development of animal husbandry.
Patent Information
- Application Number
- CN202510379617.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-28
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-03-28
AI Technical Summary
The existing technology is difficult to effectively improve the growth rate of domestic rabbits, which affects its economic value and resource utilization efficiency in animal husbandry.
Gene editing technology was adopted to design specific sgRNA sequences to perform single-base mutations on the p.T908M site of the LTBP2 gene in New Zealand rabbits, and LTBP2 gene editing rabbits were prepared by embryonic microinjection technology to promote the improvement of growth traits in rabbits.
It significantly improves the growth rate and body shape of domestic rabbits, promotes the improvement of domestic rabbit breeds, and enhances the economic benefits and international competitiveness of the animal husbandry industry.
Smart Images

Figure CN119876268B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of rabbit breeding, and in particular relates to a method for improving the growth rate of rabbits. Background Art
[0002] Rabbits are important livestock and agricultural economic animals in my country, playing a key role in multiple areas. First, in animal husbandry, rabbits efficiently convert roughage into high-quality meat, hides, and fur products, which not only reduces dependence on grain and feed but also improves resource utilization in the livestock industry. Second, rabbits provide meat and fur, the quality of which has a significant impact on human health and well-being. For animal husbandry, rabbit growth rate and meat yield are crucial. To achieve this goal, identifying the genetic factors that control growth, reproduction, carcass, and meat quality traits has become increasingly important. In recent years, novel gene editing technologies and other approaches have been widely used to accelerate genetic breeding programs for key production traits in rabbits, aiming to increase the economic value of the animals. In scientific research, a considerable number of studies have used candidate gene approaches to identify DNA markers associated with economically relevant traits in meat-producing animals, such as meat quality and carcass traits, reproduction, and growth. For example, latent transforming growth factor β-binding protein 2 (LTBP2) is considered to be related to the number of vertebrae and body length development in animals, among which the p.M911T missense substitution is considered to affect the number of thoracic vertebrae in pig populations.
[0003] The invention provides a method for increasing the growth rate of rabbits. Summary of the Invention
[0004] The object of the present invention is to provide a method for increasing the growth rate of rabbits, aiming to solve the problems raised in the above background technology.
[0005] The purpose of the present invention is achieved through the following technical solutions:
[0006] A method for increasing the growth rate of rabbits comprises the following steps:
[0007] Step 1: Construction of sgRNA expression vector;
[0008] A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M locus, and a pair of oligonucleotide chains were synthesized and annealed to form a double-stranded sgRNA. The double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, followed by enzyme digestion, electrophoresis, and gel recovery.
[0009] The oligonucleotide chain sequence is as follows:
[0010] sgRNA-F: CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO. 1;
[0011] sgRNA-R: CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO. 2:
[0012] Step 2: transcription and synthesis of SpRY-CBE mRNA;
[0013] The SpRY-CBE plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified for transcription and synthesis of SpRY-CBE;
[0014] Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology;
[0015] The synthesized sgRNA and SpRY-CBE were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. After pregnancy, LTBP2 gene-edited rabbits were obtained.
[0016] Step 4: Rabbit genome identification;
[0017] DNA from LTBP2 gene-edited rabbits was extracted, PCR was performed, and sequencing was performed. If the C at position 5 of the sgRNA sequence mutated to T, it was confirmed that a single base mutation had been obtained.
[0018] PCR primers are as follows:
[0019] Upstream primer: CCACTCCTCAAACTGGACATT, specifically as shown in SEQ ID NO.3;
[0020] Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA, as shown in SEQ ID NO.4.
[0021] Furthermore, in step 1, the specific process of the annealing treatment is: annealing the synthesized oligonucleotide chain at 95° C. for 5 minutes, cooling to room temperature, and forming a double-stranded sgRNA.
[0022] Furthermore, in step 1, the enzyme digestion system is: 20 μL of PUC57 plasmid, 20 μL of 10×Buffer, 1 μL of BbsⅠ and 159 μL of ddH2O.
[0023] Furthermore, in step 1, the process of performing enzyme digestion, electrophoresis and gel recovery in sequence is: enzyme digestion at 37° C. overnight, agarose gel electrophoresis, and recovery using a common DNA agarose gel recovery kit.
[0024] Furthermore, in step 2, the enzyme digestion system is: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL and ddH2O 18 μL;
[0025] The transcription synthesis system was as follows: linear SpRY-CBE 1.5 μg, NTP Buffer 10 μL, T7 RNA polymerase 2 μL, and ddH2O 6 μL;
[0026] The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 h; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 min, and then add the polyA tail.
[0027] Furthermore, in step 4, the PCR reaction system is: 1 μL of template DNA, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 12.5 μL of 2×Taq plus and 8.5 μL of ddH2O.
[0028] Furthermore, in step 4, the PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 40 s; 38 cycles; and extension at 72°C for 5 min.
[0029] Compared with the prior art, the present invention has the following beneficial effects:
[0030] The present invention discloses a method for increasing the growth rate of rabbits. Leveraging the advantages of SpRY-CBE gene editing technology, which is not restricted by PAM region sequence recognition, a specific sgRNA sequence was designed for the New Zealand rabbit LTBP2 gene sequence, achieving a single-base mutation at the LTBP2 p.T908M site. Embryo injection followed by embryo transplantation yielded a rabbit breed with increased growth rate. This method utilizes gene editing technology to explore new approaches to animal genetic breeding. By promoting improved growth traits in rabbits and creating new rabbit models or strains, the method significantly promotes the development of my country's animal husbandry industry, improves the economic benefits of the animal industry, and enhances its international competitiveness. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 This is a schematic diagram of sgRNA design.
[0032] Figure 2 This is the Sanger sequencing map of the LTBP2 gene mutation in newborn rabbits.
[0033] Figure 3 This is a comparison of body length between normal rabbits and LTBP2 gene-edited rabbits at different times from 20 to 50 days.
[0034] Figure 4 The weight changes of normal rabbits and LTBP2 gene-edited rabbits within 10-60 days are statistically analyzed; these include normal rabbits (WT), LTBP2 gene-edited rabbits with heterozygous mutations (LTBP2 T / M ) and LTBP2 gene-edited rabbit homozygous mutation (LTBP2 M / M ).
[0035] Figure 5 The body length comparison between 5-month-old normal rabbits and LTBP2 gene-edited rabbits; A is the body length comparison between normal rabbit No. 2 (WT-2) and LTBP2 gene-edited rabbit No. 1 (LTBP2-1), B is the body length comparison between normal rabbit No. 3 (WT-3) and LTBP2 gene-edited rabbit No. 4 (LTBP2-4), C is the body length comparison between LTBP2 gene-edited rabbits with homozygous mutation (LTBP2 M / M ), heterozygous mutation (LTBP2 T / M ) and normal rabbit (WT) body length statistical analysis chart. DETAILED DESCRIPTION
[0036] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of implementation of the present invention.
[0037] The specific implementation of the present invention is described in detail below with reference to specific embodiments.
[0038] One embodiment of the present invention provides a method for increasing the growth rate of rabbits, the method comprising the following steps:
[0039] Step 1: Construction of sgRNA expression vector (PUC57-sgRNA);
[0040] Figure 1This is a schematic diagram of sgRNA design. A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M (LTBP2 p.Thr908Met) site, and a pair of oligonucleotide chains were synthesized, namely sgRNA-F (sequence CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO.1) and sgRNA-R (sequence CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO.2). The principle for selecting these two oligonucleotide chains is to ensure that the mutated base position is located at the 5th position that pairs with the target DNA sequence. Afterwards, the synthesized oligonucleotide chain was annealed at 95°C for 5 minutes and cooled to room temperature to form a double-stranded sgRNA. At the same time, the PUC57 vector was linearized using BbsI restriction endonuclease, and the linearized vector was subjected to gel recovery after agarose electrophoresis. Finally, the double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, and then enzyme digestion, electrophoresis and gel recovery were performed in sequence.
[0041] Enzyme digestion system: PUC57 plasmid 20 μL; 10× Buffer 20 μL; BbsⅠ 1 μL; ddH2O 159 μL.
[0042] The process of enzyme digestion, electrophoresis, and gel recovery was as follows: enzyme digestion was performed at 37°C overnight, and after agarose gel electrophoresis, DNA was recovered using a standard agarose gel recovery kit (purchased from Shanghai Shenggong Company, Shanghai, China). The specific operations were carried out according to the instructions.
[0043] Step 2: transcription and synthesis of SpRY-CBE mRNA;
[0044] The SpRY-CBE plasmid (stored in this laboratory) was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction and then transcribed and synthesized according to the instructions of the in vitro transcription kit.
[0045] The enzyme digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL.
[0046] The transcription synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL.
[0047] The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 hour. After transcription is complete, add 1 μL of DNase I to digest the transcription template, react at 37°C for 15 minutes, and then add the poly A tail.
[0048] Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology;
[0049] Using a microinjector, 15 ng / μL of the synthesized sgRNA and 80 ng / μL of SpRY-CBE were mixed, and 3 μL was aspirated into a needle for injection into the embryonic nucleus. The fertilized egg was then transplanted into the oviduct of a recipient female rabbit in estrus at the same time. The surrogate rabbit was provided with ample water and food. After gestational day 25, the surrogate rabbit was transferred to the delivery room until the expected date of delivery, resulting in the LTBP2 gene-edited rabbit.
[0050] Step 4: Rabbit genome identification;
[0051] DNA was extracted from the LTBP2 gene-edited rabbit ear tissue according to the kit instructions (purchased from Tiangen Biotechnology Co., Ltd., Beijing, China). PCR was then performed using the designed primers. After PCR, electrophoresis was performed to identify the product. If PCR amplification was successful, DNA sequencing was performed on the PCR product to determine the genotype.
[0052] The designed PCR primers are as follows:
[0053] Upstream primer: CCACTCCTCAAACTGGACATT (as shown in SEQ ID NO. 3);
[0054] Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA (as shown in SEQ ID NO. 4);
[0055] PCR reaction system: template DNA 1 μL; upstream primer 1.5 μL; downstream primer 1.5 μL; 2×Taq plus 12.5 μL; ddH2O 8.5 μL.
[0056] Reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.
[0057] The PCR product was sent to Sangon Biotech Co., Ltd. for sequencing. If the C at position 5 of the sgRNA sequence mutated to T, it was confirmed that a single base mutation was obtained. Figure 2 As shown, the C at position 5 of the sgRNA sequence was mutated to T, and the present invention obtained a LTBP2 gene mutant rabbit.
[0058] Example 1: Phenotypic analysis of LTBP2 gene-edited rabbits;
[0059] 1) Comparison of body length between normal rabbits (WT) and LTBP2 gene-edited rabbits at different times from 20 to 50 days;
[0060] The body lengths of normal rabbits and LTBP2 gene-edited rabbits were measured at 20, 30, and 50 days after birth. Figure 3 As shown, the body length of LTBP2 gene-edited rabbits was significantly longer than that of normal rabbits at day 20. The body length of LTBP2 gene-edited rabbits remained significantly longer than that of normal rabbits for 50 days.
[0061] 2) Statistics of body weight changes between normal rabbits (WT) and LTBP2 gene-edited rabbits over 10-60 days;
[0062] The body weights of normal rabbits and LTBP2 gene-edited rabbits were recorded from 10 to 60 days after birth. Figure 4 As shown, homozygous mutations in LTBP2 gene-edited rabbits (LTBP2 M / M ) and LTBP2 gene-edited rabbit heterozygous mutation (LTBP2 T / M ) showed a significantly higher weight gain rate than that of normal rabbits.
[0063] 3) Comparison of body length between normal rabbits and LTBP2 gene-edited rabbits at 5 months of age;
[0064] The body lengths of normal rabbits and LTBP2 gene-edited rabbits were observed at 5 months of age. Figure 5 As shown in A and B, when the rabbits continued to grow to 5 months of age, the body lengths of LTBP2 gene-edited rabbits No. 1 (LTBP2-1) and No. 4 (LTBP2-4) were taller than those of normal rabbit No. 2 (WT-2) and normal rabbit No. 3 (WT-3), respectively. Figure 5 Middle C is LTBP2 gene-edited rabbit (including homozygous mutant LTBP2 M / M and heterozygous mutant LTBP2 T / M ) and normal rabbits (WT), indicating that the body length of LTBP2 gene-edited rabbits was still significantly larger than that of normal rabbits at 5 months of age.
[0065] In summary, the present invention successfully bred a new breed of LTBP2 gene-edited rabbits, whose growth traits such as body length and weight are significantly better than those of normal rabbits. This is of great significance for improving the growth ability of domestic rabbit breeds and promoting the healthy development of my country's animal husbandry industry.
[0066] The above are only preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, several variations and improvements can be made without departing from the concept of the present invention. These should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.
Claims
1. A method for increasing the growth rate of rabbits, characterized in that: The following steps are involved: Step 1: Construction of sgRNA expression vector; A sgRNA target sequence was designed for the New Zealand rabbit LTBP2 p.T908M locus, and a pair of oligonucleotide chains were synthesized and annealed to form a double-stranded sgRNA. The double-stranded sgRNA was ligated to the linearized PUC57 vector to complete the construction of the PUC57-sgRNA vector, followed by enzyme digestion, electrophoresis, and gel recovery. The oligonucleotide chain sequence is as follows: sgRNA-F: CTACACGCTGGCCACCGAGG, as shown in SEQ ID NO. 1; sgRNA-R: CCTCGGTGGCCAGCGTGTAG, as shown in SEQ ID NO. 2: Step 2: transcription and synthesis of SpRY-CBE mRNA; The SpRY-CBE plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified for transcription and synthesis of SpRY-CBE; Step 3: Preparation of LTBP2 gene-edited rabbits using embryo microinjection technology; The synthesized sgRNA and SpRY-CBE were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. After pregnancy, LTBP2 gene-edited rabbits were obtained. Step 4: Rabbit genome identification; DNA from LTBP2 gene-edited rabbits was extracted, PCR was performed, and sequencing was performed. If the C at position 5 in the sgRNA target sequence mutated to T, it was confirmed that a single base mutation had been obtained. PCR primers are as follows: Upstream primer: CCACTCCTCAAACTGGACATT, specifically as shown in SEQ ID NO.3; Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA, as shown in SEQ ID NO. 4; The sgRNA target sequence is TACACGCTGGCCACCGAGGGGGC.
2. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 1, the specific process of the annealing treatment is: annealing the synthesized oligonucleotide chain at 95° C. for 5 minutes, cooling to room temperature, and forming a double-stranded sgRNA.
3. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 1, the enzyme digestion system is: 20 μL of PUC57 plasmid, 20 μL of 10× Buffer, 1 μL of BbsⅠ and 159 μL of ddH2O.
4. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 1, the process of performing enzyme digestion, electrophoresis and gel recovery in sequence is as follows: enzyme digestion is performed overnight at 37° C., agarose gel electrophoresis is performed, and then recovery is performed using a common DNA agarose gel recovery kit.
5. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 2, the enzyme digestion system is: AgeI 1 μL, xBaI 1 μL, SpRY-CBE plasmid 20 μL, rCut Smart Buffer 10 μL and ddH2O 18 μL; The transcription synthesis system was as follows: linear SpRY-CBE 1.5 μg, NTP Buffer 10 μL, T7 RNA polymerase 2 μL, and ddH2O 6 μL; The transcription synthesis process is as follows: after mixing, incubate at 37°C for 1 h; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 min, and then add the polyA tail.
6. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 4, the PCR reaction system is: 1 μL of template DNA, 1.5 μL of upstream primer, 1.5 μL of downstream primer, 12.5 μL of 2×Taq plus, and 8.5 μL of ddH 2 O.
7. The method for increasing the growth rate of rabbits according to claim 1, wherein: In step 4, the PCR reaction conditions are: pre-denaturation at 95° C. for 5 min; denaturation at 95° C. for 30 s, annealing at 58° C. for 30 s, and extension at 72° C. for 40 s; 38 cycles; and extension at 72° C. for 5 min.
Citation Information
Patent Citations
Genetic marker related to body length and nipple number of pig, and applications thereof
CN109112217A
Artificially engineered angiogenesis regulatory system
CN109844123A