Marker and probe composition for detecting intestinal cancer and application of marker and probe composition

Abstract

The invention discloses a marker and a probe composition for detecting intestinal cancer and application of the marker and the probe composition. The marker is an ADRA2C gene or a HAGLR gene. According to the present invention, with the application of the marker, the methylation state of the gene can be sensitively and specifically detected so as to be used for the detection of the peripheral blood free DNA, and the composition is used for the screening of the asymptomatic population in the non-invasive manner so as to reduce the harm caused by the invasive detection; the composition has higher sensitivity and accuracy, and can realize real-time monitoring.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a marker and a probe composition for detecting colorectal cancer and applications thereof. Background Art

[0002] Colorectal cancer is a common cancer and a major health problem worldwide. According to statistics, about 900,000 people die from colorectal cancer each year, making it the fourth most deadly cancer. The incidence and mortality of colorectal cancer are on the rise, and the high incidence and mortality of colorectal cancer are related to its frequent progression in an asymptomatic state. Therefore, early diagnosis and treatment are crucial to the prognosis of colorectal cancer.

[0003] Currently, colonoscopy is one of the most commonly used methods for colorectal cancer screening and diagnosis. It inserts a soft tubular instrument, the colonoscope, into the anus and into the large intestine for observation to check whether there are abnormalities in the inner wall of the large intestine, such as polyps, ulcers, and tumors. However, it is not suitable for all people. Colonoscopy requires patients to prepare their intestines and use a flexible probe through the anus, which may cause discomfort or pain to some patients. In addition, colonoscopy may be risky for some elderly or frail patients. And it cannot fully evaluate the colorectum. Although colonoscopy can directly observe the surface of the colorectal mucosa, it can only observe the area that the lens can reach. Due to the bends and stenosis of the colorectum, some colorectal areas may not be examined, which may result in missing some polyps or tumors. There is also insensitivity to small polyp detection. Due to the limitations of colonoscopy, some small polyps may be missed. Although these small polyps may not have the risk of cancer, if they are not discovered and removed in time, they may gradually grow and eventually cause cancer. In addition, it also requires professional technical support. Colorectal endoscopy requires professional doctor training and qualification certification before it can be performed. In addition, the interpretation of the test results also requires professional knowledge and experience, which may lead to some misdiagnosis or missed diagnosis. Moreover, it also has high examination fees, poor compliance and possible injury, making it difficult for colonoscopy to be used on a large scale for screening of asymptomatic people. In addition, although fecal occult blood test (FOBT) and peripheral blood carcinoembryonic antigen (CEA) are easy to accept, their poor sensitivity and specificity also bring challenges to the early diagnosis and treatment of colorectal cancer. Summary of the invention

[0004] The purpose of the present application is to provide a marker, a probe composition and an application for detecting colorectal cancer, which can be used for screening of colorectal cancer. The marker is used in a non-invasive manner for screening of asymptomatic people and for prognosis detection of cancer patients, reducing the harm caused by invasive detection and having higher sensitivity and accuracy.

[0005] The specific technical solutions of this application are as follows:

[0006] 1. A marker for detecting colorectal cancer, wherein the marker is the ADRA2C gene or the HAGLR gene.

[0007] 2. The marker according to item 1, wherein the target sequence of the ADRA2C gene is shown in any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or the target sequence of the ADRA2C gene includes any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6.

[0008] 3. The marker according to item 1, wherein the target sequence of the HAGLR gene is as shown in any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or the target sequence of the HAGLR gene includes any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0009] 4. A probe composition, wherein the probe composition comprises a probe targeting the methylation of the marker described in any one of items 1-3.

[0010] 5. The probe composition according to item 4, wherein the probe composition comprises a first probe composition with high methylation and a second probe composition with low methylation, the first probe composition is used to hybridize with a region with high methylation of CG converted by bisulfite, and the second probe composition is used to hybridize with a region with low methylation of CG converted by bisulfite.

[0011] 6. The probe composition according to item 5, wherein the first probe composition comprises n probes, and the n probes hybridize with each nucleotide of the sense chain and / or antisense chain of the CG high methylation region converted by bisulfite. Preferably, the second probe composition comprises m probes, and the m probes hybridize with each nucleotide of the sense chain and / or antisense chain of the CG low methylation region converted by bisulfite. Further preferably, n and m are any integers between 1 and 10.

[0012] 7. The probe composition according to item 6, wherein there is x1 nucleotide overlap between the n-1th probe and the nth probe, and preferably, x1 is any integer between 0 and 100;

[0013] Preferably, there are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0 and 100;

[0014] Further preferably, the first probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 13-16; and the second probe composition comprises the nucleotide sequences shown in SEQ ID NOs: 17-20.

[0015] 8. Use of a nucleic acid for detecting a marker in preparing a kit for detecting colorectal cancer, wherein the marker is the ADRA2C gene or the HAGLR gene.

[0016] 9. The use according to item 8, wherein the target sequence of the marker is as shown in any one of SEQ ID NO: 1-SEQ ID NO: 12, or the target sequence of the marker includes any one of SEQ ID NO: 1-SEQ ID NO: 12.

[0017] 10. The use according to item 8 or 9, wherein the nucleic acid is used to target methylated markers of colorectal cancer.

[0018] 11. The use according to any one of items 8 to 10, wherein the nucleic acid is the probe composition according to any one of items 4 to 7.

[0019] 12. The use according to any one of items 8 to 10, wherein the nucleic acid comprises:

[0020] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the ADRA2C gene or the HAGLR gene, and the fragment contains at least one CpG dinucleotide sequence;

[0021] Preferably, the nucleic acid further comprises:

[0022] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the ADRA2C gene or HAGLR gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0023] 13. The use according to any one of items 8 to 12, wherein the nucleic acid further comprises:

[0024] Blockers that preferentially bind to target sequences in their unmethylated state.

[0025] 14. A composition for colorectal cancer detection, wherein the composition comprises a nucleic acid for detecting methylation of the ADRA2C gene or the HAGLR gene.

[0026] 15. The composition according to item 14, wherein the target sequence of the ADRA2C gene is as shown in any one of SEQ ID NO: 1-SEQ ID NO: 6, or the target sequence of the ADRA2C gene includes any one of SEQ ID NO: 1-SEQ ID NO: 6;

[0027] Or the target sequence of the HAGLR gene is shown in any one of SEQ ID NO:7-SEQ ID NO:12; or the target sequence of the HAGLR gene includes any one of SEQ ID NO:7-SEQ ID NO:12.

[0028] 16. The composition according to item 14 or 15, wherein the nucleic acid comprises the probe composition according to any one of items 4 to 7.

[0029] 17. The composition according to item 14 or 15, wherein the nucleic acid comprises:

[0030] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the marker, and the fragment contains at least one CpG dinucleotide sequence.

[0031] 18. The composition according to item 17, wherein the nucleic acid further comprises:

[0032] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the marker under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0033] 19. The composition according to any one of items 14 to 18, further comprising an agent for converting the unmethylated cytosine base at position 5 of the target sequence of the ADRA2C gene or the HAGLR gene into uracil.

[0034] 20. The composition according to any one of items 14-19, wherein the nucleic acid further comprises:

[0035] Blockers that preferentially bind to target sequences in their unmethylated state.

[0036] 21. Use of the target sequence of ADRA2C gene in preparing a kit for detecting colorectal cancer.

[0037] 22. The use according to claim 21, wherein the target sequence of ADRA2C is any one of SEQ ID NO: 1-SEQ ID NO: 6 or comprises the sequence shown in any one of SEQ ID NOs: 1-6.

[0038] 23. Use of the target sequence of HAGLR gene in preparing a kit for detecting colorectal cancer.

[0039] 24. The use according to claim 23, wherein the target sequence of ADRA2C is any one of SEQ ID NO:7-SEQ ID NO:12 or comprises the sequence shown in any one of SEQ ID NOs:7-12.

[0040] 25. A kit comprising a reagent for detecting the marker described in any one of Items 1 to 3, the probe composition described in Items 4 to 7, or the composition described in any one of Items 14 to 20.

[0041] 26. A chip comprising a reagent for detecting the marker described in any one of items 1 to 3, the probe composition described in any one of items 4 to 7, or the composition described in any one of items 14 to 20.

[0042] The inventors of the present application used epigenomic and bioinformatics techniques to analyze the whole genome methylation data of colorectal cancer and found two methylation genes related to colorectal cancer. They also determined the target sequence of the colorectal cancer methylation gene where methylation abnormalities occur. Moreover, through the target sequence of this methylation gene, the methylation status of the gene can be sensitively and specifically detected, which can be used to detect free DNA in peripheral blood.

[0043] This application uses DNA methylation marker detection technology to detect and diagnose colorectal cancer in its early stages. Because DNA methylation markers can change in the early stages of colorectal cancer, it can improve the accuracy and sensitivity of early screening for colorectal cancer, and early colorectal cancer is easy to cure, so early detection of colorectal cancer can avoid disease progression and metastasis, thereby effectively improving treatment outcomes and survival rates.

[0044] The sample used in this application is a 10ml blood sample. Compared with the traditional multiple sampling method, there is no need for the patient to accept sampling multiple times, which greatly reduces the patient's pain and burden. At the same time, compared with highly invasive examination methods such as colonoscopy, this application will not cause too much harm and risk to the patient, nor will it affect the patient's life and work. Therefore, the patient's compliance requirements are relatively low, and it is easier to obtain the patient's approval and acceptance. In addition, the present invention has high sensitivity and specificity, and can effectively solve the problem of low sensitivity of traditional fecal occult blood test (FOBT) and peripheral blood carcinoembryonic antigen (CEA). Through the detection of DNA methylation markers, colorectal cancer can be found in the early stage and accurately diagnosed, improving the treatment effect and survival rate. Compared with traditional detection methods, the present application has a higher detection accuracy and a lower misdiagnosis rate, which effectively reduces the risk of missed diagnosis and misdiagnosis. DETAILED DESCRIPTION

[0045] The present application is described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0046] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the functional differences of components as the criterion for distinction. As mentioned throughout the specification and claims, "including" or "comprising" are open-ended terms and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is based on the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be determined by the attached claims.

[0047] The methylation of the present application refers to the methylation process of the 5th carbon atom on cytosine in CpG dinucleotides. As a relatively stable modification state, under the action of DNA methyltransferase, it can be inherited to the newborn daughter DNA along with the DNA replication process. It is an important epigenetic mechanism. When DNA is methylated, methylation of the gene promoter region can lead to transcriptional silencing of tumor suppressor genes, so it is closely related to the occurrence of tumors. Abnormal methylation includes hypermethylation of tumor suppressor genes and DNA repair genes, hypomethylation of repetitive sequence DNA, and loss of imprinting of certain genes, which are related to the occurrence of various tumors. This is usually (but not necessarily) in the case of CpG (cytosine followed by guanine) dinucleotides. As used herein, "increased methylation level" or "significant methylation level" refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, wherein the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more Cs may be methylated, wherein the Cs at these positions in the control DNA sample are unmethylated.

[0048] The methylation described herein may be a methylation level, a methylation degree or a methylation state. When analyzing the methylation of such a target sequence, those skilled in the art may use a quantitative measurement method to determine the methylation.

[0049] "Homology", "identity" and "similarity" in this application are used interchangeably to refer to the sequence similarity between two nucleic acid molecules. "Homology", "identity" or "similarity" can be determined by comparing the positions in each sequence, and the sequences can be aligned for the purpose of comparison. When equivalent positions in the compared sequences are occupied by the same base, the molecules are identical at that position; when equivalent sites are occupied by the same or similar amino acid (for example, similar in spatial properties or charged properties) residues, the molecules can be said to be homologous (similar) at that position. The expression of homology / similarity or identity percentage refers to the function of the number of identical or similar amino acids at the positions shared by the compared sequences. "Unrelated" or "non-homologous" sequences share less than 40% identity, preferably less than 25% identity with the sequences of this application. When comparing two sequences, the absence of residues (amino acids or nucleic acids) or the presence of extra residues also reduces identity and homology / similarity. In a specific embodiment, two or more sequences or subsequences are considered to be substantially or significantly homologous, similar or identical if their sequences are about 60%, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical over a specified region, as determined using the BLAST or BLAST 2.0 sequence comparison algorithm with the default parameters described below or by manual alignment and visual inspection provided online by, for example, the National Center for Biotechnology Information (NCBI). This definition also relates to or can be used to test the complement of a sequence. Thus, to the extent permitted by the context of the present invention, for example, if the nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally in the form of one or both of the complementary strands, then the nucleotide sequence that is complementary to a specified target sequence or a variant thereof is itself considered to be "similar" to the target sequence, and when referring to "similar" nucleic acid sequences, single-stranded sequences, their complementary sequences, double-stranded strand complexes, sequences that can encode the same or similar polypeptide products, and any allowed variants of any of the above. Circumstances in which similarity must be limited to the analysis of a single nucleic acid strand sequence can include, for example, the detection and quantification of the expression of a specific RNA sequence or coding sequence in a cell. This definition also includes sequences with deletions and / or additions, as well as sequences with substitutions.In embodiments, the identity or similarity can be over a region that is at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region that is more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.

[0050] The "sensitivity" in this application refers to the proportion of cancer detected from a certain cancer sample, and its calculation formula is: Sensitivity = (detected cancer / all cancers), while "specificity" refers to the proportion of normal detected in a certain normal human sample, and its calculation formula is: Specificity = (detected negative / total negative).

[0051] The present application provides a marker for detecting colorectal cancer, wherein the marker is an ADRA2C gene or a HAGLR gene. In some embodiments, the target sequence of the ADRA2C gene is shown in one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or the target sequence of the ADRA2C gene includes any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6. The nucleotide sequence of the HAGLR gene is shown in one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or the target sequence of the HAGLR gene includes any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

[0052] SEQ ID NO: 1 is the nucleotide sequence of ADRA2C gene:

[0053] GAGCAGCGCAGCGGCCGAGAGGCGGCGGCGCCGGGGCGCGTTGCGGCGGGGCGGGCGGCGGCGAGCGGGCGCGGAGGGGGGCGCGGGCGGTCGGGACGG

[0054] SEQ ID NO: 2 is the complementary sequence of the nucleotide sequence of ADRA2C gene

[0055] CCGTCCGCACCGCCCGCGCCCCCCTCCGCGCCCGTCCGCCGCCGCCCGCCCCGCCGCAACGGCCCCCCGGCGCCGCCGCCTCTCGGCCGCTGCG CTGCTC

[0056] SEQ ID NO: 3 is a sequence of an extreme case of the hypermethylation state of the ADRA2C gene:

[0057] GAGTAGCGTAGCGGTCGAGAGGCGGCGGCGTCGGGGCGCGTTGCGGCGGGGCGGGCGGCGGCGAGCGGGCGCGGAGGGGGGCGCGGGCGGTCGGGACGG

[0058] SEQ ID NO: 4 is the sequence of the hypermethylated state of the complementary strand of the ADRA2C gene:

[0059] TCGTTCGTATCGTTCGCGTTTTTTTTCGCGTTCGTTCGTCGTCGTTCGTTTCGTCGTAACGCGTTTCGGCGTCGTCGTTTTTCGGTCGTTGCGTTGTTT

[0060] SEQ ID NO: 5 is a sequence of an extreme case of hypomethylation state of ADRA2C gene:

[0061] GAGTAGTGTAGTGGTTGAGAGGTGGTGGTGTTGGGGTGTGTTGTGGTGGGGTGGGTGGTGTGAGTGGGTGTGGAGGGGGGTGTGGGTGGTGTGGATGG

[0062] SEQ ID NO: 6 is the sequence of the hypomethylated state of the complementary strand of the ADRA2C gene:

[0063] TTGTTTGTATTGTTTGTGTTTTTTTTTGTGTTTGTTTGTTGTTGTTTGTTTTGTTGTAATGTGTTTTGGTGTTGTTGTTTTTTGGTTGTTGTGTTGTTT

[0064] SEQ ID NO:7 is the nucleotide sequence of the HAGLR gene:

[0065] GCAGCCCGGTGTACGTGGGCGGCAACTTCGTCGAGTCCATGGCGCCCGCGTCCGG

[0066] SEQ ID NO: 8 is the complementary sequence of the nucleotide sequence of the HAGLR gene

[0067] CCGGACGCGGGCGCCATGGACTCGACGAAGTTGCCGCCCACGTACACCGGGCTGC

[0068] SEQ ID NO: 9 is a sequence of an extreme case of the hypermethylation state of the HAGLR gene:

[0069] GTAGTTCGGTGTACGTGGGCGGTAATTTCGTCGAGTTTATGGCGTTCGCGTTCGG

[0070] SEQ ID NO: 10 is the sequence of the hypermethylated state of the complementary strand of the HAGLR gene:

[0071] TCGGACGCGGGCGTTATGGATTCGACGAAGTTGTCGTTTACGTATATCGGGTTGT

[0072] SEQ ID NO: 11 is a sequence of an extreme case of the hypomethylated state of the HAGLR gene:

[0073] GTAGTTTGGTGTATGTGGGTGGTAATTTTGTTGAGTTTATGGTGTTTGTGTTTGG

[0074] SEQ ID NO: 12 is the sequence of the hypomethylated state of the complementary strand of the HAGLR gene:

[0075] TTGGATGTGGGTGTTATGGATTTGATGAAGTTGTTGTTTATGTATA TTGGGTTGT.

[0076] Those skilled in the art can also understand that the target sequence of the ADRA2C gene or HAGLR gene is not limited to the specific sequences listed above. The target sequence of the ADRA2C gene should include a sequence that contains one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-6, but is still substantially functionally identical to the sequence, and also includes a sequence that has 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-6. The target sequence of the HAGLR gene should include a sequence that contains one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 7-12, but is still substantially functionally identical to the sequence, and also includes a sequence that has 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 7-12.

[0077] The present application provides a probe composition, wherein the probe composition comprises a probe targeting the methylation of the above-mentioned marker.

[0078] In the present application, the probe is a single-stranded or double-stranded DNA with a length ranging from tens to hundreds or even thousands of base pairs. It can utilize the molecular denaturation, renaturation and high accuracy of base complementary pairing to hydrogen bond (hybridize) with the complementary non-labeled single-stranded DNA or RNA in the sample to be tested to form a double-stranded complex (hybrid). After washing away the unpaired bound probe, the hybridization reaction result can be detected by a detection system such as radioautography or enzyme-linked reaction. In the present application, the area complementary to or hybridized with the probe is a specific target area, and multiple probes are combined into a probe composition.

[0079] In one embodiment, the probe composition comprises a first hypermethylated probe composition and a second hypomethylated probe composition, wherein the first probe composition is used to hybridize with a region of CG hypermethylation converted by bisulfite, and the second probe composition is used to hybridize with a region of CG hypomethylation converted by bisulfite.

[0080] The CG high methylation region refers to the region where the target sequence is more methylated. Since the methylation status of each person is different, the extreme CG high methylation region refers to the region where all CGs of the target sequence are methylated.

[0081] A CG hypomethylated region refers to a region of the target sequence where methylation is low. In the present application, an extremely CG hypomethylated region refers to a region in the target sequence where all CGs are not methylated.

[0082] The CG hypermethylated region after bisulfite conversion refers to the conversion of base C to base T after the target sequence is converted by bisulfite, but if it is a base CG, since the 5-methylcytosine residue (5mC) is resistant to it, the C in CG will not be converted, so the base C remains unchanged;

[0083] The CG hypomethylated region after bisulfite conversion means that after bisulfite conversion, since all or most of the bases CG on the target sequence are not methylated, all or most of the bases C are converted to base T.

[0084] Since the methylation status of each person is different, the sequence obtained after bisulfite conversion is also different. Here is an extreme case of this marker, that is, all CGs in this segment are in a high methylation state, and the high methylation state sequence of its complementary chain is shown:

[0085] An extreme case of the hypermethylated state of SEQ ID NO:1 is shown in SEQ ID NO:3.

[0086] The hypermethylated sequence of the complementary chain of SEQ ID NO:1 is shown in SEQ ID NO:4.

[0087] Similarly, since the methylation status of each person is different, an extreme case is shown here, that is, all CGs are in a low methylation state, and the low methylation state sequence of its complementary chain is also shown.

[0088] An extreme case of the hypomethylated state of SEQ ID NO:1 is shown in SEQ ID NO:5.

[0089] The sequence of the complementary chain of SEQ ID NO:1 in the hypomethylated state is shown in SEQ ID NO:6.

[0090] An extreme case of the hypermethylated state of SEQ ID NO:7 is shown in SEQ ID NO:9.

[0091] The hypermethylated sequence of the complementary strand of SEQ ID NO:7 is shown in SEQ ID NO:8.

[0092] An extreme case of the hypomethylated state of SEQ ID NO:7 is shown in SEQ ID NO:9.

[0093] The sequence of the complementary chain of SEQ ID NO:7 in the hypomethylated state is shown in SEQ ID NO:10.

[0094] In some embodiments, the first probe composition includes n probes that hybridize to each nucleotide of the sense strand and the antisense strand of the bisulfite-converted CG hypermethylated region.

[0095] The second probe composition includes m probes that hybridize to each nucleotide of the sense strand and / or antisense strand of the bisulfite-converted CG hypomethylated region.

[0096] The present application does not impose any limitation on the number of probes in the first probe composition and the second probe composition, and those skilled in the art may select the number as needed. For example, m and n may be any integer between 1 and 10, and m and n may be the same or different.

[0097] For example, m and n can be any integer of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. Preferably, m=n=2.

[0098] In one embodiment, there are x1 nucleotide overlaps between the n-1th probe and the nth probe, preferably, x1 is any integer between 0 and 100;

[0099] Preferably, there are x2 nucleotide overlaps between the m-1th probe and the mth probe, and preferably, x2 is any integer between 0-100.

[0100] Among them, x1 and x2 can be the same or different. When x1 is 0, it indicates that the tail of the n-1th probe is connected to the head of the nth probe. Similarly, when x2 is 0, it indicates that the tail of the m-1th probe is connected to the head of the mth probe.

[0101] The present application hybridizes the probe composition with the target sequence converted by bisulfite, wherein the highly methylated first probe composition hybridizes with the CG highly methylated region, and the low-methylated second probe composition hybridizes with the CG low-methylated region, thereby being able to efficiently and accurately detect the methylation level of the target sequence, and can further be used for colorectal cancer screening.

[0102] In one embodiment, the hypermethylated first probe composition comprises one or two of the nucleotide sequences shown in SEQ ID NOs: 13-16.

[0103] The hypomethylated second probe composition includes one or two of SEQ ID NOs: 17-20.

[0104] The nucleotide sequence shown in SEQ ID NO:13 is:

[0105] CCGCCCCCTACCCGTCCGCACCGCCCGCGCCCCCCTCCGCGCCCGCTCGCCGCCGCCCGCCCCGCCGCAACGCGCCCCGACGCCGCCGCCTCGACCGCTACGCTACTCTCGTCCGACT

[0106] The nucleotide sequence shown in SEQ ID NO:14 is:

[0107] AACCGAACGAAAACAACGCAACGACCGAAAAACGACGACGCCGAAACGCGTTACGACGAAACGAACGACGACGAACGAACGCGAAAAAAAACGCGAACGATACGAACGAACAAAAAACGA

[0108] The nucleotide sequence shown in SEQ ID NO:15 is:

[0109] AAATACGAAAAATAACCCAAATTAAAAACAAACCCGAACGCGAACGCCATAAACTCGACGAAATTACCGCCCACGTACACCGAACTACCCTACAAATTAACGCTAACGAAACCGCCGCCG

[0110] The nucleotide sequence shown in SEQ ID NO:16 is:

[0111] CGACGACGACTTCGCCAACGCCAACTTACAAAACAACCCGATATACGTAAACGACAACTTCGTCGAATCCATAACGCCCGCGTCCGAACCTATCTTCAACCTAAACCACCTCTCGCACCC

[0112] The nucleotide sequence shown in SEQ ID NO:17 is:

[0113] CCACCCCCTACCCATCCACACCACCCACACCCCCCTCCACACCCACTCACCACCACCCACCCACCACAACACACCCCAACACCACCACCTCTCAACCACTACACTACTCTCATCCAACT

[0114] The nucleotide sequence shown in SEQ ID NO:18 is:

[0115] AACCAAACAAAAACAACACAACAACCAAAAAACAACAACACCAAAACACATTACAACAAAACAAACAACAACAAACAAACACAAAAAAAAACACAAACAATACAAACAAACAAAAAACAA

[0116] The nucleotide sequence shown in SEQ ID NO:19 is:

[0117] AAATACAAAAAATAACCCAAATTAAAAAACAAACCCAAACACAAACACCATAAACTCAACAAAATTACCACCCACATACACCAAACTACCCTACAAATTAACACTAACAAAACCACCACCA

[0118] The nucleotide sequence shown in SEQ ID NO:20 is:

[0119] CAACAACAACTTCACCAACACCAACTTACAAAACAACCCAATATACATAAACAACAACTTCATCAAATCCATAACACCCACATCCAAACCTATCTTCAACCTAAACCACCTCTCACACCC

[0120] Specifically, the first probe composition includes the nucleotide sequence shown in SEQ ID NO: 13-14 for hybridizing with the methylation sequence of the ADRA2C gene;

[0121] The first probe composition includes the nucleotide sequence shown in SEQ ID NO: 15-16 for hybridizing with the methylation sequence of the HAGLR gene;

[0122] The second probe composition includes the nucleotide sequence shown in SEQ ID NO: 17-18 for hybridizing with the methylation sequence of the ADRA2C gene;

[0123] The second probe composition includes the nucleotide sequences shown in SEQ ID NOs: 19-20 for hybridizing with the methylation sequence of the HAGLR gene.

[0124] The present application provides the use of a nucleic acid for detecting a marker in the preparation of a kit for detecting colorectal cancer, wherein the marker is the ADRA2C gene or the HAGLR gene. In some embodiments, the nucleotide sequence of the marker is shown in any one of SEQ ID NO:1-SEQ ID NO:12. In some embodiments, the nucleic acid is used to target the methylated marker of colorectal cancer. In some embodiments, the nucleic acid is the probe composition described above.

[0125] In some embodiments, the nucleic acid comprises:

[0126] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the ADRA2C gene or the HAGLR gene, and the fragment contains at least one CpG dinucleotide sequence;

[0127] Preferably, the nucleic acid further comprises:

[0128] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the ADRA2C gene or HAGLR gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0129] That is, in the present application, when the nucleic acid includes primers and probes, if the test sample DNA is converted using bisulfite, the nucleic acid includes a fragment of at least 9 nucleotides in the sequence after the target sequence of the ADRA2C gene or the HAGLR gene is converted with bisulfite, and the fragment contains at least one CpG dinucleotide sequence.

[0130] In some embodiments, the nucleic acid further comprises:

[0131] Blockers that preferentially bind to target sequences in their unmethylated state.

[0132] The blocker is used to improve the amplification specificity of the PCR amplification primer. The 5' end of the blocker nucleotide sequence has an overlap region of greater than or equal to 5 nucleotides with the 3' end nucleotide sequence of the forward or reverse primer. The blocker and the forward or reverse primer are complementary to the same strand of the target gene target sequence DNA. The melting temperature of the blocker is higher than that of the forward or reverse primer by more than (including) 5°C. The nucleotide sequence of the blocker contains at least one CpG dinucleotide sequence and is complementary to the sequence of the target gene target sequence DNA that has not been methylated after bisulfite conversion. Therefore, when the genomic DNA of the biological sample to be detected is a mixture of methylated and unmethylated states, especially when the DNA in the methylated state is far less than the DNA in the unmethylated state, the DNA in the unmethylated state will preferentially bind to the blocker after bisulfite conversion, thereby inhibiting the binding of the DNA template to the PCR primer, so that PCR amplification does not occur, while the DNA in the methylated state does not bind to the blocker, and thus binds to the primer, PCR amplification occurs, and then the fragments obtained by amplification are directly or indirectly detected.

[0133] The present application provides a composition for colorectal cancer detection, wherein the composition comprises a nucleic acid for detecting methylation of the ADRA2C gene or the HAGLR gene. In some embodiments, the nucleotide sequence of the ADRA2C gene or the HAGLR gene is shown in any one of SEQ ID NO: 1-SEQ ID NO: 12. In some embodiments, the nucleic acid comprises the probe composition described above.

[0134] In some embodiments, the nucleic acid comprises:

[0135] A primer, wherein the primer is a fragment of at least 9 nucleotides in the target sequence of the ADRA2C gene or the HAGLR gene, and the fragment contains at least one CpG dinucleotide sequence. In some embodiments, the nucleic acid further comprises:

[0136] A probe that hybridizes to at least a 15-nucleotide fragment in the target sequence of the ADRA2C gene or HAGLR gene under moderately stringent or stringent conditions, wherein the fragment contains at least one CpG dinucleotide sequence.

[0137] In some embodiments, the composition further comprises a reagent for converting the unmethylated cytosine base at position 5 of the target sequence of the ADRA2C gene or the HAGLR gene into uracil.

[0138] In the present application, the 5-position unmethylated cytosine base refers to the cytosine that has not received a methyl group on the fifth carbon, that is, the cytosine has not undergone methylation modification.

[0139] In the present application, the reagent may be, for example, bisulfite or the like.

[0140] In some embodiments, the nucleic acid further comprises:

[0141] Blockers that preferentially bind to target sequences in their unmethylated state.

[0142] In the present application, the target sequence of ADRA2C gene is used in preparing a kit for detecting colorectal cancer.

[0143] In the present application, the target sequence of ADRA2C is any one of SEQ ID NO: 1-SEQ ID NO: 6 or comprises the sequence shown in any one of SEQ ID NOs: 1-6.

[0144] In the present application, the target sequence of the HAGLR gene is used in the preparation of a kit for detecting colorectal cancer.

[0145] In the present application, the target sequence of ADRA2C is any one of SEQ ID NO: 7-SEQ ID NO: 12 or comprises the sequence shown in any one of SEQ ID NOs: 7-12.

[0146] The present application provides a kit comprising a reagent for detecting the marker described above, the probe composition described above, or the composition described above. In some embodiments, the kit further comprises a container for accommodating a biological sample of a subject. In some embodiments, the kit further comprises instructions for using and interpreting the test results.

[0147] In the present application, the biological sample may be, for example, whole peripheral blood, plasma or serum.

[0148] The present application does not impose any limitation on the method for detecting the methylation level of the target sequence using the above-mentioned kit, and those skilled in the art can select it as needed. For example, the present application provides a method for detecting the methylation level of the marker target sequence using the above-mentioned kit, which comprises the following steps:

[0149] Collect samples from subjects;

[0150] Extracting and purifying DNA from the sample;

[0151] Constructing a DNA library for sequencing from the purified DNA sample;

[0152] The constructed DNA library is transformed with bisulfite;

[0153] Pre-PCR amplification of the bisulfite-converted DNA library;

[0154] Using the probe composition to perform hybridization capture on the sample amplified by the pre-PCR;

[0155] Amplify the products captured by hybridization using PCR;

[0156] Perform high-throughput next-generation sequencing on the products amplified by PCR and captured by hybridization;

[0157] Analyze the sequencing data to determine the methylation level of the sample;

[0158] The threshold of each marker is calculated based on the methylation status of existing samples, and the disease condition of the patient is judged based on the methylation level of a marker in the sample. If the methylation level of a marker in the sample exceeds the threshold, it is a cancer sample, and if it is lower than the threshold, it is a healthy person sample.

[0159] For example, the present application provides a method for detecting the methylation level of a target sequence of a marker using the above-mentioned kit, which comprises the following steps:

[0160] (1) Draw peripheral blood from the subject and separate plasma or serum;

[0161] (2) extracting free DNA from plasma or serum;

[0162] (3) treating the free DNA obtained in step (2) with a reagent to convert the unmethylated cytosine base at position 5 into uracil or other bases, that is, the unmethylated cytosine base at position 5 of the target sequence of the marker is converted into uracil or other bases, and the converted base is different from the unmethylated cytosine base at position 5 in terms of hybridization performance and is detectable;

[0163] (4) contacting the free DNA treated in step (3) with a DNA polymerase and a primer of the target sequence of the marker, so that the target sequence of the treated marker is amplified to produce an amplification product or is not amplified; if the target sequence of the treated marker undergoes a DNA polymerization reaction, an amplification product will be produced; if the target sequence of the treated marker does not undergo a DNA polymerization reaction, it will not be amplified;

[0164] (5) detecting the amplified product with a probe;

[0165] (6) Based on the presence or absence of the amplification product, determining the methylation status of at least one CpG dinucleotide of the target sequence of the marker, thereby determining the methylation level of the target sequence of the marker.

[0166] The present application provides a chip, which comprises the world for detecting the above-mentioned marker or the above-mentioned probe combination or the above-mentioned combination.

[0167] The chip is also called a gene chip. Its sequencing principle is a hybridization sequencing method, that is, a method of determining the nucleic acid sequence by hybridization with a group of nucleic acid probes of known sequences. Probes of target nucleotides with known sequences are fixed on the surface of a substrate. When the nucleic acid sequence with a fluorescent marker in the solution produces a complementary match with the nucleic acid probe at the corresponding position on the gene chip, a group of probe sequences with completely complementary sequences are obtained by determining the probe position with the strongest fluorescence intensity.

[0168] The chip is prepared mainly by using a glass sheet or a silicon sheet as a carrier, and using in-situ synthesis and micro-matrix methods to arrange oligonucleotide fragments or cDNA as probes in sequence on the carrier.

[0169] The chip described in the present application is based on signal detection of DNA sequence hybridization after bisulfite treatment. The bisulfite treatment converts non-methylated cytosine into uracil, while the methylated cytosine remains unchanged. Uracil is then converted into thymine, and finally chip hybridization is performed. Finally, the type of added base is judged according to the fluorescent color, thereby determining whether the site is methylated.

[0170] The present application provides a method for colorectal cancer screening, which comprises:

[0171] Detecting the methylation level of the markers, and

[0172] The risk of the subject suffering from colorectal cancer is judged based on the methylation level, and the marker is the ADRA2C gene or the HAGLR gene.

[0173] Example

[0174] The present application provides a general and / or specific description of the materials and test methods used in the experiments. In the following examples, unless otherwise specified, % means wt%, i.e., weight percentage. The reagents or instruments used without indicating the manufacturer are all conventional reagent products that can be obtained commercially.

[0175] Example 1 Screening markers

[0176] 1) Sample collection:

[0177] Regarding the collection of colorectal cancer samples: a total of 38 plasma samples from colorectal cancer patients were collected from cooperating hospitals, and 99 plasma samples from healthy people were collected for whole genome methylation sequencing.

[0178] 2) Candidate marker analysis:

[0179] Analysis of markers for colorectal cancer: DSS software was used to perform differential analysis of the methylation sites obtained from sequencing data between healthy people and colorectal cancer patients. Filtering criteria: P < 0.05, the difference between the means of the two groups was greater than 0.1, and a total of 33 differentially methylated regions were obtained.

[0180] 3) Marker verification:

[0181] Verification of colorectal cancer markers: Probe capture was designed for the above 33 differentially methylated regions, and the data of plasma samples from Boercheng (number of colorectal cancer samples = 28 and number of healthy human samples = 52) were used for verification, and finally 2 markers that can distinguish colorectal cancer from healthy people were obtained. The target sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 7 respectively.

[0182] According to the obtained target sequence region, a probe composition (panel) is customized, which includes a highly methylated first probe composition and a low methylated second probe composition, wherein the first probe composition includes two probes, respectively having nucleotide sequences as shown in SEQ ID NO: 13-16, and the second probe composition includes two probes, respectively having nucleotide sequences as shown in SEQ ID NO: 17-20.

[0183] Then it was validated in plasma samples using Qiagen Circulating Nucleic Acid Kit for cfDNA preparation, catalog number 55114. METHYL-SEQDNALIBRARYKIT was used to prepare the library, the catalog number is 30096, and the experimental detection method is as follows:

[0184] 1.1. cfDNA extraction and purification

[0185] 1.1.1. Preparation of plasma samples:

[0186] Centrifuge the blood sample at 4°C, 2000 g for 10 min and transfer the plasma to a new centrifuge tube. Centrifuge the plasma sample at 4°C, 16000 g for 10 min and proceed to the next step depending on the type of collection tube used. The type of collection tube used in this experiment is Other.

[0187] 1.1.2. Lysis and binding

[0188] 1.1.2.1. Pipette 100μl, 200μl, 300μl, 400μl and 500μl of QIAGEN Proteinase K into 50ml centrifuge tubes respectively.

[0189] 1.1.2.2. Add 1 ml, 2 ml, 3 ml, 4 ml, and 5 ml of plasma or serum respectively into the above 50 ml centrifuge tubes.

[0190] 1.1.2.3. Add 0.8ml, 1.6ml, 2.4ml, 3.2ml and 4.0ml of Buffer ACL (containing 1.0μg carrier RNA) respectively, cover the lid and vortex for 30s; Note: Mix thoroughly to ensure complete lysis; proceed to the next step immediately.

[0191] 1.1.2.4. Incubate at 60°C for 30 min.

[0192] 1.1.2.5. Take out the centrifuge tube, place it on the test bench, and unscrew the tube cap.

[0193] 1.1.2.6. Add 1.8ml, 3.6ml, 5.4ml, 7.2ml and 9.0ml of Buffer ACB into 50ml centrifuge tubes respectively; cover the tubes and mix for 15-30s.

[0194] 1.1.2.7. Incubate the lysis mixture on ice for 5 min.

[0195] 1.1.2.8. Insert the QIAamp Mini column into the vacuum pump connector adapter and insert the 20ml tube extender into the column; Note: Make sure the tube extender is firmly inserted into the QIAamp Mini column to avoid sample leakage.

[0196] 1.1.2.9. Carefully add the lysate-buffer ACB mixture from 1.1.2.7 to the tube extender of the QIAamp Minicolumn and turn on the vacuum pump. When all the lysate has been completely drawn out of the Mini column, turn off the vacuum pump and release the pressure to 0 mbar. Carefully remove and discard the tube extender.

[0197] 1.1.3. Washing

[0198] 1.1.3.1. Add 600 μl BufferACW1 to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0199] 1.1.3.2. Add 750 μl BufferACW2 to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0200] 1.1.3.3. Add 750 μl of ethanol (96-100%) to the Mini column, open the lid, and start the vacuum pump; after all the liquid passes through the column membrane, turn off the vacuum pump and release the pressure to 0 mbar.

[0201] 1.1.3.4. Cover the QIAamp Mini column cap, remove it from the adapter, and discard the VacConnector. Place the QIAamp Mini column in a clean 2 ml collection tube and centrifuge at high speed (20,000 g; 14,000 rpm) for 3 min.

[0202] 1.1.3.5. Place the QIAamp Mini column in a new 2 ml collection tube. Open the tube cap and incubate at room temperature for 5 min to allow the membrane to dry completely.

[0203] 1.1.4. Elution of cfDNA

[0204] 1.1.4.1. Place the QIAamp Mini column in a 1.5 ml elution tube and discard the 2 ml collection tube in step 1.1.3.5. Add 20-150 μl of BufferAVE to the center of the Mini membrane; cover the tube and incubate at room temperature for 3 minutes.

[0205] 1.1.4.2. Centrifuge at full speed (20000g; 14000rpm) for 1 min to elute the nucleic acid.

[0206] For cfDNA samples, Agilent2100 performed fragment detection and Qubit was directly used for subsequent experiments.

[0207] 1.2.Bisulfite conversion and purification:

[0208] 1.2.1. Prepare CT Conversion Reagent:

[0209] 1.2.1.1. Add 700 μl NF water, 300 μl M-Dilution Buffer and 50 μl M-Dissolving Buffer to a tube of CT conversion reagent, mix well at room temperature, and vortex or shake frequently for 10 min.

[0210] 1.2.1.2. After mixing, divide the mixture into 10 reaction volumes.

[0211] 1.2.2. Perform bisulfite conversion on the DNA library and prepare the reaction system according to the table below.

[0212] Table 1

[0213]

[0214]

[0215] 1.2.3. Adjust the pipette to 100 μl, gently pipette and mix 6 times, then divide into two tubes and place on the PCR instrument.

[0216] 1.2.4. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0217] Table 2

[0218] temperature time 98℃ 10min 64℃ 2.5h 4℃ ∞

[0219] 1.2.5. Take a new 1.5ml centrifuge tube and add 600μl of M-Binding Buffer.

[0220] 1.2.6. After PCR, transfer the two tubes of the same sample to the corresponding 1.5ml centrifuge tubes mentioned above by brief centrifugation and mix well.

[0221] 1.2.7. Add the mixed sample to Zymo-Spin TM Invert the IC Column to mix, and centrifuge at 10,000 x g for 30 s.

[0222] 1.2.8. Add 100 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0223] 1.2.9. Add 200 μl of M-Desulphonation Buffer to the column, incubate at room temperature for 15-20 min, and centrifuge at 10,000 x g for 30 s.

[0224] 1.2.10. Add 200 μl of M-Wash Buffer to the column and centrifuge at 10,000 x g for 30 s.

[0225] 1.2.11. Repeat the previous step once.

[0226] 1.2.12. Place the column in a new collection tube and centrifuge again at 10,000 x g for 30 seconds.

[0227] 1.2.13. Place the recovery column in a new 1.5 ml EP tube, add 15 μl LOW EDTA buffer to the center of the column membrane, and centrifuge at 10,000 x g for 30 seconds.

[0228] 1.3. Transformation:

[0229] 1.3.1. Preheat the PCR instrument to 95°C.

[0230] 1.3.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0231] Table 3

[0232] temperature time 95℃ ∞ 95℃ 2min 95℃ ∞

[0233] 1.3.3. After incubation, immediately place the test tube on ice for 2 minutes.

[0234] 1.4. Connector ligation and purification:

[0235] 1.4.1. Configure the reaction system according to the following table:

[0236] Table 4

[0237] Components volume Low EDTA TE 11.5μl Buffer G1 4μl Reagent G2 4μl Reagent G3 2.5μl Enzyme G4 1μl Enzyme G5 1μl Enzyme G6 1μl DNA 15μl Total Volume 40μl

[0238] 1.4.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0239] Table 5

[0240] temperature time 37℃ ∞ 37℃ 15min 95℃ 2min 4℃ ∞

[0241] 1.5. Sample extension and purification:

[0242] 1.5.1. Configure the reaction system according to the following table:

[0243] Table 6

[0244] Components volume Reagent Y1 2μl Enzyme Y2 42μl totalVolume 44μl

[0245] 1.5.2. Set the following program to perform the reaction on the PCR instrument: the heated lid temperature is 105°C.

[0246] Table 7

[0247] temperature time 98℃ ∞ 98℃ 1min 62℃ 2min 65℃ 5min 4℃ ∞

[0248] 1.5.3. The liquid turns blue after adding DNA protection buffer. Mix by gently pipetting, then divide into two tubes and place on the PCR instrument.

[0249] 1.5.4. Set the following program and run: Heated lid 105°C.

[0250] Table 8

[0251]

[0252]

[0253] 1.5.5. Prepare the purification system according to the following table:

[0254] Table 9

[0255] Input Reaction volume Magnetic beads amount volume 200bp (SeqCapEpi) 84μl 101μl(ratio:1.2) 15μl

[0256] 1.5.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0257] 1.5.7. Incubate at room temperature for 5 minutes.

[0258] 1.5.8. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0259] 1.5.9. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant, and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0260] 1.5.10. Repeat the above steps.

[0261] 1.5.11. Add optimal volume of low EDTATE buffer for elution and vortex to mix.

[0262] 1.5.12. Incubate at room temperature for 2 min.

[0263] 1.5.13. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0264] 1.5.14. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0265] 1.6. Connector ligation and purification:

[0266] 1.6.1. Prepare the library reaction system according to the following table:

[0267] Table 10

[0268] Components volume BufferB1 3μl ReagentB2 10μl EnzymeB3 2μl TotalVolume 15μl

[0269] 1.6.2. Set the following program and run: Heated cover 0℃:

[0270] Table 11

[0271] temperature time 25℃ ∞ 25℃ 15min 4℃ ∞

[0272] 1.6.3. Prepare the purification system according to the following table:

[0273] Table 12

[0274] Input Reaction volume Magnetic beads amount volume 200bp (SeqCapEpi) 30μl 36μl(ratio:1.2) 20μl

[0275] 1.6.4. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0276] 1.6.5. Incubate at room temperature for 5 minutes.

[0277] 1.6.6. Mix by shaking and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 minutes). After the solution becomes clear, aspirate the supernatant.

[0278] 1.6.7. Add 200 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol on the inner wall of the dropper.

[0279] 1.6.8. Repeat the above steps.

[0280] 1.6.9. Add low EDTA TE buffer in an optimal volume for elution and then vortex to mix.

[0281] 1.6.10. Incubate at room temperature for 2 min.

[0282] 1.6.11. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0283] 1.6.12. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0284] 1.7. Library amplification and purification:

[0285] 1.7.1. Prepare the library reaction system according to the following table:

[0286] Table 13

[0287] Components volume The above reaction DNA 20μl KAPA HiFi HotStart Uracil+ReadyMix(2x) 25μl index(U001-U024) 5μl Total volume 50μl

[0288] 1.7.2. Set the following program and run: Heated lid 105℃:

[0289] Table 14

[0290]

[0291] 1.7.3. The recommended number of cycles is as follows:

[0292] Table 15

[0293] Input Recommended number of cycles 20ng cfDNA 10-11 100ng gDNA 9-10 20ng gDNA 11-12

[0294] 1.7.4. Prepare the purification system according to the following table:

[0295] Table 16

[0296] Input Reaction volume Magnetic beads amount volume 200bp (SeqCap Epi) 50μl 60μl(ratio:1.2) 22μl

[0297] 1.7.5. Transfer the PCR product into a 1.5 ml centrifuge tube.

[0298] 1.7.6. Add the above proportion of magnetic beads to each sample for recovery, shake and mix, and centrifuge instantly.

[0299] 1.7.7. Incubate at room temperature for 5 minutes.

[0300] 1.7.8. Mix by oscillation and centrifuge briefly. Place on a magnetic rack for adsorption until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0301] 1.7.9. Add 500 μl of 80% ethanol to wash the beads for 30 seconds, discard the supernatant and carefully remove all the remaining ethanol from the inner wall of the dropper.

[0302] 1.7.10. Repeat the above steps.

[0303] 1.7.11. Place on the magnetic stand for 5-10 minutes until the beads are dry (avoid over-drying, which may result in reduced DNA recovery).

[0304] 1.7.12. Add low EDTA TE buffer to the optimal volume for elution and then vortex to mix.

[0305] 1.7.13. Incubate at room temperature for 2 min.

[0306] 1.7.14. Place on a magnetic rack and adsorb until the solution becomes clear (~2 min). After the solution becomes clear, aspirate the supernatant.

[0307] 1.7.15. Transfer the entire eluate into a new 0.2 mL PCR tube, making sure that the eluate does not contain the magnetic beads.

[0308] 1.7.16. Aspirate 1 μl for qubit calibration and perform 2100 quality check.

[0309] 1.8. Hybridization of samples and probes:

[0310] 1.8.1. Mixed samples:

[0311] 1.8.1.1. The amount of DNA library can refer to the table below. The total amount can be more than 1500ng, but not more than 4μg;

[0312] Table 17

[0313] Number of mixed samples The amount of each library Total library volume per reaction 1 500ng 500ng 2 500ng 1000ng 3 500ng 1500ng 4 375ng 1500ng 8 187.5ng 1500ng

[0314] 1.8.1.2. Calculate the amount of different samples and mix them evenly in a centrifuge tube.

[0315] 1.8.1.3. Add the following pre-hybridization reagents to the mixed sample and mix well, trying not to create bubbles.

[0316] Table 18

[0317] Components volume Twist probe panel 4μl Universal sealant 8μl Blocking agent solution 5μl Methylation Enhancer 2μl

[0318] 1.8.1.4. Dry the mixed pre-hybridization reagents in a vacuum concentrator at room temperature (if heating is required, please use low temperature).

[0319] 1.8.2. Hybridization:

[0320] 1.8.2.1. Incubate Fast Hybridization Mix at 65℃ for 10min or until all precipitates are dissolved. Vortex quickly and add 20μl to the freeze-dried sample in the previous step to resuspend the sample (please do not let the hybridization solution return to room temperature). Mix gently with your fingertips to avoid creating bubbles.

[0321] 1.8.2.2. Rapidly centrifuge to remove bubbles and add 30 μl Hybridization Enhancer to the surface of the above reagents.

[0322] 1.8.2.3. Place the PCR tube in the preheated PCR instrument for hybridization.

[0323] 1.8.2.4. Set the following program and run: Heated lid 85°C.

[0324] Table 19

[0325] temperature time 95℃ ∞ 95℃ 5min 60℃ 15min-4h

[0326] 1.8.3. Combination:

[0327] 1.8.3.1. Shake the pre-equilibrated streptavidin magnetic beads until completely mixed, and add 100 μl of magnetic beads to a 1.5 ml centrifuge tube.

[0328] 1.8.3.2. Add 200 μl of binding buffer and mix well by pipetting.

[0329] 1.8.3.3. Place the centrifuge tube on the magnetic rack for 1 minute or until the solution becomes clear, discard the supernatant and remove the centrifuge tube.

[0330] 1.8.3.4. Repeat the above washing steps 2 times, for a total of 3 times.

[0331] 1.8.3.5. After the last wash, add 200 μl of binding buffer and resuspend by vortexing to mix thoroughly.

[0332] 1.8.3.6. After hybridization, open the lid of the PCR instrument and quickly transfer all the hybridization solution to the balanced magnetic beads.

[0333] 1.8.3.7. Mix the magnetic beads with hybridization solution thoroughly on a shaker, rocker or rotator at room temperature for 30 minutes.

[0334] 1.8.3.8. Remove the centrifuge tube from the mixer, centrifuge quickly and place it on the magnetic rack for 1 minute, remove the supernatant and remove the tube.

[0335] 1.8.3.9. Add 200 μl pre-warmed FastWash Buffer 1 and mix well.

[0336] 1.8.3.10.Incubate at 63°C or 65°C for 5 min.

[0337] 1.8.3.11. Place the centrifuge tube on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0338] 1.8.3.12. Repeat the above steps, add 200 μl of preheated Wash Buffer 1 again and mix well.

[0339] 1.8.3.13. Incubate at 63°C or 65°C for 5 min.

[0340] 1.8.3.14. Transfer the liquid to a new tube; place it on the magnetic rack for 1 min, remove the supernatant and take out the tube.

[0341] 1.8.3.15. Add 200 μl preheated wash buffer 2 and mix well with a pipette tip.

[0342] 1.8.3.16.Incubate at 48℃ for 5 min.

[0343] 1.8.3.17. Place on the magnetic rack for 1 minute, remove the supernatant and take out the tube.

[0344] 1.8.3.18. Repeat (steps 3.15-3.17) and wash twice, for a total of three times.

[0345] 1.8.3.19. For the last time, use a 10μl pipette tip to aspirate the wash solution.

[0346] 1.8.3.20. Add 45 μl of water, mix well, and incubate the solution on ice.

[0347] 1.8.4. Post-capture PCR amplification, purification and quality control:

[0348] 1.8.4.1. Set the following program and run: Heated lid 105°C.

[0349] Table 20

[0350]

[0351] 1.8.4.2. Mix the magnetic bead mixture in step 1.8.3.20 and pipette 22.5 μl into a 0.2 ml PCR tube.

[0352] 1.8.4.3. Add 2.5 μl amplification primers and 25 μl KAPA HiFi HotStart ReadyMix to a 0.2 ml PCR tube, for a total of 50 μl reaction system.

[0353] 1.8.4.4. Mix gently with a pipette tip, centrifuge quickly, place in PCR instrument and start amplification.

[0354] 1.8.4.5. Vortex to thoroughly mix the pre-equilibrated DNA purification magnetic beads.

[0355] 1.8.4.6. Add 90 μl (1.8*) DNA purification magnetic beads to the amplified PCR product and vortex to mix thoroughly.

[0356] 1.8.4.7. Incubate at room temperature for 5 min.

[0357] 1.8.4.8. Place the centrifuge tube on the magnetic rack for 1 minute and remove the supernatant after the solution becomes clear.

[0358] 1.8.4.9. Without removing the centrifuge tube from the magnetic rack, add 200 μl of freshly prepared 80% ethanol directly, incubate for 1 min, and discard the supernatant; repeat the 80% ethanol wash once (2 times in total) and keep the centrifuge tube on the magnetic rack.

[0359] 1.8.4.10. Carefully remove the remaining ethanol with a 10μl pipette tip and leave at room temperature for 5-10 minutes or until the magnetic beads are dry. Be careful not to overdry the magnetic beads.

[0360] 1.8.4.11. Remove the tube from the magnetic stand and add 32 μl of water. Mix thoroughly by blowing with a pipette tip and incubate at room temperature for 2 minutes.

[0361] 1.8.4.12. Place the centrifuge tube on a magnetic rack for 3 minutes or until the solution becomes clear.

[0362] 1.8.4.13. Transfer 30 μl of supernatant to a clean 0.2 ml centrifuge tube.

[0363] 1.8.4.14. Take 1 μl of library and use Qubit to quantify and record the library concentration.

[0364] 1.8.4.15. Take 1 μl of sample and use Agilent 2100 to measure the library fragment length.

[0365] 1.9. Methylation bioinformatics analysis process. It is roughly as follows: use fastp quality control software to check the sequencing quality, remove low-quality reads, then use Bismark alignment software to align the clean data after quality control to the reference genome, and use Bismark_methylation_extractor software to extract the corresponding methylation sites. Finally, calculate the methylation level of the target region. If the value exceeds the threshold, it is judged as cancer, and if it is lower than the threshold, it is judged as normal.

[0366] 1.10. Based on the training set of 38 colorectal cancer samples and 99 normal human samples, the above methylation library construction method was used to screen out biomarkers related to colorectal cancer by using the differences in methylation levels in different groups (colorectal cancer and normal), and the site data was verified in normal and colorectal cancer samples by independent data sets, and the two DNA fragments (SEQ ID NO: 1 and SEQ ID NO: 7) that most significantly distinguished normal and colorectal cancer samples were screened out. The methylation biomarkers (hereinafter referred to as sites or markers) and the discrimination thresholds are shown in Table 21;

[0367] The calculation method for the methylation level threshold is: draw the ROC curve according to the data set (including the type and methylation level of each sample). The confusion matrix corresponding to the optimal threshold point on the ROC curve is the basis for calculating indicators such as sensitivity, specificity, and accuracy. Usually we will make a selection through the Youden index. The Youden index, also known as the correct index, refers to the sum of sensitivity and specificity minus 1: Youden index = Sensitivity + Specificity-1. The Youden index ranges from 0 to 1, representing the total ability of the classification model to detect real patients and non-patients. The larger the Youden index, the better the performance of the classification model:

[0368] Table 21 Specific performance data of methylation markers

[0369] SEQ ID Threshold Specificity Sensitivity AUC SEQ ID NO.1 0.1326 0.964 0.926 0.891 SEQ ID NO.2 0.0992 0.903 0.854 0.867

[0370] Example 2

[0371] Six human samples (S1-3 are healthy samples, S4-6 are colorectal cancer patient samples, the methylation marker detection method of the present application was used, and peripheral blood was collected according to the method of Example 1; a library was built, and sequenced through the Illumina platform; the sequencing data was subjected to the above-mentioned bioinformatics analysis process to obtain the methylation level of the marker, and the disease condition of the patient was predicted according to the threshold of the marker. If it is lower than the threshold, it is a healthy sample, and if it exceeds the threshold, it is a colorectal cancer sample. The specific results are shown in the following table.

[0372] The reading results are as follows: 0 represents normal classification, that is, healthy; 1 represents abnormal classification, that is, colon cancer.

[0373] Table 22

[0374]

[0375] As can be seen from the above table, the sequences shown in SEQ ID NO.1 and SEQ ID NO.7 can specifically detect samples from colorectal cancer patients.

[0376] In summary, the inventors of the present application have obtained a methylation gene related to colorectal cancer and determined the target sequence of the colorectal cancer methylation gene where methylation abnormalities occur. Furthermore, through the target sequence of this methylation gene, the methylation state of the gene can be sensitively and specifically detected, thereby being able to be used for the detection of free DNA in peripheral blood. The composition described in the present application can achieve real-time monitoring with higher sensitivity and accuracy.

[0377] The above is only the preferred embodiment of the present application, and does not limit the present application in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment based on the technical essence of the present application without departing from the technical solution of the present application still falls within the protection scope of the technical solution of the present application.

Claims

1. A marker for detecting colorectal cancer, wherein: The marker is the ADRA2C gene or the HAGLR gene.

2. The marker according to claim 1, wherein The target sequence of the ADRA2C gene is shown in any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, or the target sequence of the ADRA2C gene includes any one of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:

6.

3. The marker according to claim 1, wherein The target sequence of the HAGLR gene is shown in any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or the target sequence of the HAGLR gene includes any one of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:

12.

4. A probe composition, wherein: The probe composition comprises a probe targeting the methylation of the marker according to any one of claims 1 to 3.

5. Use of a nucleic acid for detecting a marker in preparing a kit for detecting colorectal cancer, wherein: The marker is the ADRA2C gene or the HAGLR gene.

6. A composition for colorectal cancer detection, wherein: The composition comprises a nucleic acid for detecting methylation of the ADRA2C gene or the HAGLR gene.

7. Use of the target sequence of the ADRA2C gene in the preparation of a kit for detecting colorectal cancer; Preferably, the target sequence of ADRA2C is any one of SEQ ID NO: 1-SEQ ID NO: 6 or comprises the sequence shown in any one of SEQ ID NOs: 1-6.

8. Use of the target sequence of the HAGLR gene in preparing a kit for detecting colorectal cancer; Preferably, the target sequence of ADRA2C is any one of SEQ ID NO: 7 to SEQ ID NO: 12 or comprises the sequence shown in any one of SEQ ID NOs: 7 to 12.

9. A kit comprising a reagent for detecting the marker according to any one of claims 1 to 3, the probe composition according to claim 4, or the composition according to claim 6. 10 . A chip comprising a reagent for detecting the marker according to claim 1 , the probe composition according to claim 4 , or the composition according to claim 6 .

Images