Multiplex PCR primer probe combination and kit for human red blood cell RHD gene typing detection

Abstract

The present application relates to a multiplex PCR primer probe combination and kit for human red blood cell RHD gene typing detection, and belongs to the field of biomedical clinical molecular detection. The multiplex PCR primer probe combination for human red blood cell RHD gene typing detection comprises 19 pairs of specific primers and corresponding probes distributed in 8 reaction wells. The present application also provides a kit containing the multiplex PCR primer probe combination for human red blood cell RHD gene typing detection. The RHD gene variant site specific primers and probes designed by ARMS combined with homologous sequence specific base method are more specific and accurate; all high frequency RHD gene variants of Chinese population can be detected by one experiment, including DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotypes of Chinese population, RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC), and normal RHD positive types (RHD*01) can also be detected.

Description

TECHNICAL FIELD

[0001] The present application relates to a multiplex PCR primer probe combination and kit for human red blood cell RHD genotyping detection, belonging to the field of biomedical clinical molecular detection. BACKGROUND

[0002] The Rh blood group system is the second largest blood group system after the ABO blood group system, with complex polymorphism. The Rh blood group system includes two most important antigens: D antigen (Rh factor) and C, c, E, e antigens. Among them, the D antigen is the main feature of the Rh blood group system, which exists on the surface of human red blood cell membrane, has the strongest immunoreactivity and the most significant clinical significance. According to whether the individual carries the D antigen, the Rh blood group can be divided into Rh positive and Rh negative two types. In addition to the D antigen, due to the deletion, recombination, mutation and other factors of RhD gene, it will also cause changes in amino acids outside the cell, transmembrane region and intracellular region, thereby producing other different RHD genotypes, such as partial D, weak D and DEL type, which are collectively referred to as D variant type.

[0003] RHD genotyping is very important for blood group identification and transfusion medicine. In the process of blood transfusion, understanding the specific type of RHD gene of the blood recipient and the blood donor can avoid the transfusion reaction caused by Rh blood group incompatibility, such as hemolytic reaction, and help ensure the safety of blood transfusion matching. At the same time, in the prenatal screening of pregnant women, RHD genotyping can be used to detect the Rh negative or Rh positive blood type of pregnant women, so as to predict the Rh blood type of the fetus, and provide an important reference for the prenatal prevention of hemolytic disease for Rh negative pregnant women. In addition, RHD genotyping is also helpful to understand the association between different RHD genotypes and Rh blood group related diseases, such as the pathogenesis and clinical manifestations of genetic diseases such as autoimmune hemolytic anemia. At the same time, it is also helpful to evaluate the possible risk of certain specific RHD genotypes and transfusion reactions. Therefore, RHD genotyping has important application value for clinical blood transfusion, prenatal diagnosis, genetic disease research, transfusion reaction risk assessment and individualized disease treatment, etc. Through RHD genotyping, the Rh blood group information of individuals can be more accurately understood, thereby providing more accurate guidance for medical diagnosis and treatment.

[0004] Traditional serological methods for RHD genotyping typically include two methods: direct antiglobulin test (DAT) and indirect antiglobulin test (IAT). DAT is a method for directly detecting antibodies on the surface of red blood cells. After red blood cells react with an anti-human globulin reagent (usually anti-IgG and / or anti-C3d antibodies), whether antibodies or complements are bound to the surface of red blood cells is observed under a microscope. IAT is a method for indirectly detecting antibodies in body fluids such as serum or plasma. Serum is reacted with known red blood cell antigens (usually RhD antigens), and then whether antibodies are bound is observed by adding an anti-human globulin reagent (such as a polyclonal antibody against human globulin G or human globulin A). However, traditional serological methods have limitations, for example, due to the high polymorphism of the RHD gene, there are many possible mutation types, so traditional serological methods cannot accurately identify specific variants, resulting in false negative results. In addition, due to the location of the RHD gene adjacent to other genes on the chromosome, there may be a locus linkage effect, which means that variations in other genes connected to the RHD gene may affect the expression of Rh proteins, resulting in false positive results.

[0005] In addition, in terms of RHD genotyping, gene chip technology can also be applied, which is a high-throughput gene analysis technology that can simultaneously detect the expression or polymorphism of thousands to millions of genes. A chip containing DNA sequences related to the RHD gene is prepared, and sample DNA is extracted, labeled and hybridized to the chip. After hybridization of the sample DNA, a scanner is used to detect the intensity of the fluorescent signal, thereby determining the genotype of each site. Compared with traditional methods, gene chip technology has the advantages of high throughput, precision, low sample requirement, high automation, rich data, etc. However, gene chip technology may have disadvantages such as high initial cost, complex data analysis, high technical threshold and strict sample processing requirements, which may make gene chip technology unsuitable in some cases.

[0006] Real-time PCR (Real-time PCR) is a technology for quantitative detection and analysis of DNA, RNA or genotype by monitoring the fluorescence signal generated during the PCR reaction in real time. The principle is as follows: first, a pair of specific primers is designed for the target DNA or RNA sequence. These two primers will bind to the two ends of the target sequence and undergo amplification in the PCR reaction. In addition, a fluorescently labeled probe specific to the target sequence is also designed. This probe has a fluorescent group and a fluorescence signal suppression group. During the PCR reaction, the probe binds to the PCR product and is recognized by the 3'-5' exonuclease activity of the Taq polymerase. This causes the fluorescence signal suppression group on the probe to be cleaved, releasing the fluorescent group and generating a fluorescence signal.

[0007] Real-time fluorescent PCR technology has many advantages over other methods in genotyping. First, it has high sensitivity and specificity, which can detect very low concentrations of DNA and accurately distinguish different alleles. Second, real-time fluorescent PCR technology is fast, and a batch of samples can be analyzed within a few hours, saving time and cost. In addition, it is quantitative, which can be used to quantify the target DNA and determine the copy number of genes, which is very important for genetic research of some diseases. Real-time fluorescent PCR technology can be used with automated equipment, making the analysis process more efficient and accurate, while reducing human error. In addition, this technology has the ability of multiplex analysis, which can detect multiple genes or multiple sites at the same time, and can obtain more information in one experiment, which is helpful for comprehensive analysis of genotyping. Finally, real-time fluorescent PCR technology has a wide range of applications, which can be applied to various sample types, including blood, tissue, saliva, etc., and has a wide application prospect in clinical and scientific research fields. In summary, real-time fluorescent PCR technology has higher sensitivity, faster analysis speed, higher automation degree and more information acquisition ability in genotyping, making it one of the preferred methods for genotyping at present.

[0008] Chinese patent CN 115927646A, entitled "Primer probe set for detecting Rh blood group genotype of human family and pregnant woman's fetal free DNA, kit and application thereof", provides a primer probe set kit for RHD genotyping. The kit is configured with specific primers and probes. After amplification, the probe melting curve can be observed to identify the RHD genotype, and then complete the RHD allele genotyping detection. Its detection range includes RHD full gene deletion and RhD1227G>A mutant two gene types. However, the application scenario of this kit is relatively limited, and it cannot meet the detection needs of other common RHD genotypes, so its application range has certain limitations.

[0009] Amplification Refractory Mutation System (ARMS) is a molecular biology technique used to detect single nucleotide polymorphisms (SNP) or specific DNA variations. Its principle is based on PCR amplification technology, through the introduction of specific primer design, to realize the highly specific detection of base variation on specific site. In the ARMS system, two pairs of primers are designed, one pair for amplifying normal alleles and the other pair for amplifying mutant alleles. These primers have specificity and can selectively bind to normal alleles or mutant alleles. In the PCR reaction, the DNA of the sample to be detected is placed in the reaction system with the two pairs of primers, and then PCR amplification is carried out. By analyzing the PCR amplification products, it can be directly judged whether there is a specific mutation in the sample. ARMS system has high specificity and sensitivity, can quickly and accurately detect specific single nucleotide polymorphisms or DNA mutations, and has been widely used in molecular diagnosis, research and clinical detection.

[0010] Therefore, in view of the limitations of the prior art, there is an urgent need for a faster, more accurate and more convenient human red blood cell RHD gene typing detection method to meet the clinical needs, improve accuracy, simplify operation process, reduce cost, and be able to meet the needs of different fields. SUMMARY

[0011] The purpose of the present application is to improve the prior art and provide a multiplex PCR primer probe combination and kit for human red blood cell RHD gene typing detection to solve the deficiencies in the prior art.

[0012] The principle of the present application is: using real-time fluorescent PCR combined with Taqman probe technology to detect the qualitative typing of human red blood cell RHD gene. According to the RHD gene sequence published in GENBANK database, the RHD Exon1-10, DEL1227, weak D15, DVI.3, 711delC and other subtype specific primers and probes are designed by using amplification refractory mutation system (ARMS) analysis method combined with homologous sequence specific base method, which are labeled with FAM / HEX / ROX and distributed in 8 reaction wells. Each detection is carried out in 8 wells, which can detect the variation of 19 groups of RHD specific positions at one time, judge all high-frequency RHD gene variation types in Chinese population, including DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotype RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC) in Chinese population, and can also detect normal RHD positive type (RHD*01). At the same time, a pair of internal standard primers and probes are added in each tube, which are labeled with CY5, which can monitor false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample. The probe is an oligonucleotide including 5' end reporter group and 3' end quenching group. During PCR amplification, when the probe is complete, the fluorescence emitted by the reporter group is absorbed by the quenching group, and no fluorescence signal is emitted. When the primer is extended, the probe combined with the template is cut by Taq enzyme (5'→3' exonuclease activity), the reporter group is separated from the quenching group, and the fluorescence signal is generated. The fluorescence quantitative PCR instrument automatically draws the real-time amplification curve according to the detected fluorescence signal, so as to realize the qualitative typing detection of RHD gene.

[0013] The Rh blood group system is one of the most important blood group systems in clinical practice, and is also the most complex and polymorphic system in human red blood cell blood group systems. More than 50 antigens are known in the Rh system, and the common antigens are C, c, D, E and e, among which the immunogenicity of the D antigen is the strongest. The Rh blood group gene (RH) is located in the region of human chromosome 1P34.3-36.1, and is mainly composed of the tandem arrangement of RHD and RHCE genes. The RHD gene includes 10 exons and 9 introns, encodes 417 amino acids, and expresses all D antigens. The RHD and RHCE gene sequences are opposite, and are both composed of 10 exons and 9 introns, each encoding 417 amino acids. The 3' ends of the two genes are close to each other, with a spacing of about 30 kb. The structures of the two genes are very similar, and the homology is more than 96%. The Rh blood group has complex and rich genetic polymorphism, and there are differences in the genetic background of RHD molecules among different populations. There are various D variants, and the RHCE gene mainly encodes the CE antigen. Base substitution is the basis for the formation of Rh CcEe polymorphism.

[0014] The high homology of RHD and RHCE makes it extremely difficult to accurately identify RHD subtypes. The ordinary primer design method has certain limitations for distinguishing RHD gene subtypes, and the accuracy is not high, or specific probes need to be designed, and the cost is high.

[0015] Due to the high polymorphism of the RHD gene and the high similarity with the RHCE sequence, most of which only have one base difference, false positives are easily generated in actual detection. In order to more accurately detect and avoid the occurrence of false positives, the inventors use the ARMS primer design method, and improve the traditional ARMS to design RHD gene variant site specific primers and probes by using ARMS combined with homologous sequence specific base method, thereby improving the accuracy of detection.

[0016] The real-time fluorescent PCR technology used in the application has high sensitivity and specificity compared with other traditional methods, and can quickly and accurately perform RHD gene typing, can provide an important molecular biology detection tool for clinical blood group identification and blood transfusion matching, and has a wide application prospect in clinical transfusion and genetics research.

[0017] The main technical idea of the application is that the RHD gene mutation site specific primer and probe are designed by using innovative ARMS combined with homologous sequence specific base method. One primer is designed by using the identification position base of RHD and RHCE, and according to the preliminary detection result, the base with different degrees of mismatch is added; the other primer is designed by using the identification position base of each subtype of RHD, and according to the preliminary detection result, the base with different degrees of mismatch is added; the detection considers that the base close to the 3' end of the primer is a strong mismatch primer, and the base close to the 5' end of the primer is a weak mismatch primer; in addition, the Taqman probe is designed to be universal, which is suitable for normal RHD gene detection and also suitable for mutation type RHD gene detection. By combining the specific primer with the Taqman probe, the accuracy and sensitivity are improved, the cost is significantly reduced, it is more suitable for the demand of large-scale detection, and has a wide application prospect.

[0018] The application uses innovative ARMS combined with homologous sequence specific base method to design RHD gene mutation site specific primer and probe, combines Taqman probe technology, and identifies the deletion of all exons of RHD gene by using real-time fluorescent PCR technology for the first time, and develops a multiplex PCR primer probe combination and kit for detecting RHD positive, DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01) and other common D negative phenotype RHD*D-CE (2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC) for the first time.

[0019] The application has higher sensitivity, faster experimental speed, higher accuracy and wider applicability compared with traditional methods, and has a wide application prospect and clinical reference value.

[0020] In addition, the application uses innovative simple and rapid drying technology, and the primer probe mixture is concentrated by vacuum centrifugation at the bottom of the 96-well plate, so that the primer probe is dried at the bottom of the 96-well plate, the stability of the primer probe is significantly enhanced, and compared with the previous freeze-drying technology, the application is more simple and fast, the cost is low, and has high practical application value.

[0021] The technical scheme of the application is as follows:

[0022] In the first aspect of the application, a multiplex PCR primer probe combination for human red blood cell RHD gene typing detection is provided, the combination contains 19 pairs of specific primers and corresponding probes, and the 19 pairs of specific primers and corresponding probes are distributed in 8 reaction wells. The nucleotide sequences of the primer pairs and the corresponding probes contained in each reaction well are shown in the following table:

[0023]

[0024] The nucleotide sequences of the 19 pairs of specific primers and corresponding probes, and the 19 amplification sites targeted by the 19 pairs of specific primers and corresponding probes are shown in the following table:

[0025]

[0026]

[0027]

[0028] Each of the eight reaction wells further contains a pair of internal control primers and a corresponding probe, the nucleotide sequences of which are shown in SEQ ID No. 44-46, for monitoring false negative results caused by instrument failure, reagent factors, polymerase activity, or inhibitors in the sample;

[0029] The nucleotide sequences of SEQ ID No. 44-46 are shown in the following table:

[0030] SEQ ID No Sequence 5'→ 3' 44 GCATCTGGACATGCTTGCT 45 ACACACATGGAAGACCACAGA 46 CY5 5'-CTGTGTTAAAGCTCTGAATAATGGTA-3'BHQ2

[0031] The reporter group at the 5' end of the Taqman probe is FAM, HEX, ROX, or CY5, and the quencher group at the 3' end is BHQ-1 or BHQ-2.

[0032] In the second aspect of the present application, a kit containing the multiplex PCR primer probe combination of the first aspect is provided. The kit contains 19 pairs of specific primers and corresponding probes targeting 19 amplification sites, which are distributed in eight reaction wells, each of which can simultaneously amplify two to three different sites. The kit can be used to detect RHD positive, DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01), and other common D-negative phenotypes in Chinese population, RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC). Each reaction well of the kit further contains an internal standard CY5 for internal quality control, monitoring false negative results caused by instrument failure, reagent factors, polymerase activity, or inhibitors in the sample.

[0033] Preferably, the kit further comprises a PCR reaction mixture, Taq enzyme, and an optical seal.

[0034] Preferably, the PCR reaction mixture comprises: 0.18 mM deoxynucleotide dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide are used as PCR reaction enhancer and stabilizer at the same time.

[0035] Preferably, the kit comprises a 96-well plate, which can simultaneously detect 12 samples of RHD genotyping, and the PCR amplification primer group and Taqman probe are dried at the bottom of the 96-well plate.

[0036] The technical effects of the present application are as follows: the present application adopts RHD gene variation site-specific primers and probes designed by ARMS combined with the homologous sequence-specific base method, which has higher specificity and accuracy; all high-frequency RHD gene variations in Chinese population can be detected by one experiment, including DEL type (RHD*DEL1, c.1227G>A), weak D15 type (RHD*15), partial RHD*DVI.3 type (RHD*DVI.3), RHD deletion type D negative (RHD*01N.01), and other common D negative phenotypes RHD*D-CE(2-9)-D (RHD*01N.03) and RHD*01N.16 (c.711delC) in Chinese population, and normal RHD positive types (RHD*01) can also be detected. Moreover, the deletion of each exon of the RHD variation sample can be detected; the multiplex fluorescence PCR combined with Taqman probe technology is used for qualitative genotyping detection of human red blood cell RHD gene, which has higher sensitivity, faster experimental speed, higher accuracy and wider applicability compared with traditional methods, and has wide application prospect and clinical reference value. BRIEF DESCRIPTION OF DRAWINGS

[0037] Fig. 1-1 to Fig. 1-8 The amplification curves of No. 1 to No. 8 holes are shown.

[0038] Fig. 2 It is a S1 sequencing map.

[0039] Fig. 3 It is a S2 sequencing map.

[0040] Fig. 4 It is a S3 sequencing map.

[0041] Fig. 5 It is a S4 sequencing map.

[0042] Fig. 6 It is a S5 sequencing map.

[0043] Fig. 7 It is a S6 sequencing map.

[0044] Fig. 8 Sequencing map for S7.

[0045] Fig. 9 Sequencing map for S8. DETAILED DESCRIPTION

[0046] In order to make the purposes, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in combination with the drawings and examples. Obviously, the described examples are only some of the embodiments of the present application, but not all the embodiments. The raw materials used in the present application are commercially available, unless otherwise specified.

[0047] Example 1

[0048] 1. Raw materials and equipment

[0049] 1.1 Preparation of PCR reaction mixture: 0.18 mM deoxynucleotides (dNTP), 1.8 mM magnesium chloride (MgCl2), 60.3 mM potassium chloride (KCl), 18.9 mM Tris-HCl, 0.6% (v / v) glycerol, 5% (v / v) dimethyl sulfoxide (DMSO) and 2.5% (v / v) formamide. Prepare 6* PCR reaction mixture 50 mL according to the above proportions, store at -20°C for long-term storage, and store at 4°C for temporary storage.

[0050] Taq enzyme: The Taq enzyme used in this kit is purchased from Aikangrui Biological. It is used for the synthesis of 5' to 3' direction DNA strand guided by specific primer pairing of target sequence, and 5'→3' exonuclease activity. It can cut the fluorescent probe bound to the target DNA during PCR amplification, so that the fluorescent probe emits fluorescent molecules to emit fluorescence.

[0051] 1.2 Preparation of reaction plate:

[0052] 1.2.1 Preparation of primer probe mixture: primer 0.54 OD / mL, probe 1.05 μM, prepared into 6* primer probe mixture.

[0053] 1.2.2 According to the following table, point the plate:

[0054]

[0055]

[0056] The above table contains 19 pairs of specific primers and corresponding probes, their nucleotide sequences, and the 19 amplification sites targeted by the 19 pairs of specific primers and corresponding probes, which are shown in the following table:

[0057]

[0058]

[0059] In each of the 8 reaction wells, a pair of internal control primers and a corresponding probe are also contained, respectively, and the nucleotide sequences are shown in SEQ ID Nos. 44-46:

[0060] SEQ ID No Sequence 5'→ 3' 44 GCATCTGGACATGCTTGCT 45 ACACACATGGAAGACCACAGA 46 CY5 5'-CTGTGTTAAAGCTCTGAATAATGGTA-3'BHQ2

[0061] 1.2.3 Reaction plate drying: The reaction plate is centrifuged and concentrated to dryness according to the following procedure. Concentration centrifuge conditions: 30°C, vacuum degree below -100 kpa, rotation speed above 1400 rpm, time 60 minutes. Subsequently, it is packaged into a light-proof tin foil bag. Packaged in a light-proof tin foil bag and stored at -20°C.

[0062] 1.3 Source of samples

[0063] 1) Blood sample collection

[0064] When collecting blood samples, blood collection tubes containing anticoagulants such as sodium citrate, EDTA or heparin should be used. In order to ensure the accuracy and reliability of the experimental results, it is recommended to use fresh or frozen whole blood samples that have not been repeatedly frozen and thawed as experimental samples.

[0065] 2) Nucleic acid sample extraction

[0066] Whole blood or nucleated cell-containing samples such as white blood cell layer can be used for nucleic acid extraction by precipitation method, column method or magnetic bead method to obtain sufficient and qualified nucleic acid for polymerase chain reaction.

[0067] 3) Nucleic acid sample quantification

[0068] The extracted nucleic acid sample needs to use sterile water or other appropriate solution (such as TE Buffer) as the dissolution medium, and the concentration should be controlled within the range of 10-40 ng / μl.

[0069] 4) Nucleic acid sample quality specification

[0070] The A260 / A280 ratio of the nucleic acid sample should be between 1.6 and 2.1.

[0071] 1.4 Required experimental equipment

[0072] Fluorescent quantitative PCR instrument, pipettor of different scales, small desktop centrifuge, 96-well plate centrifuge.

[0073] 2. Genotyping process

[0074] 2.1 Reaction system configuration: each sample needs to carry out 8 independent real-time fluorescent PCR reactions at the same time, and one reaction plate carries out 12 sample detection. The mixed mother liquor is prepared according to the following table:

[0075] Table 1: PCR reaction system

[0076] Component Name Addition μL / well Formulate 9 wells μL PCR reaction solution 3 27 Taq enzyme 0.4 3.6 DNA to be tested 2 18 Sterilized water 12.6 113.4 Total volume 18 162

[0077] Take 18 μL of the prepared mixed solution and distribute it to each well of the reaction plate, and then paste the optical sealing film, centrifuge briefly, and then put it into the fluorescent PCR instrument.

[0078] 2.2 PCR reaction program: as shown in Table 2:

[0079] Table 2: PCR reaction program

[0080]

[0081]

[0082] Please refer to the operation manual of each type of automatic cycle thermostat for program setting, and set the fluorescence signal collection point at 65°C; the fluorescence signal collection wavelength is set to FAM, HEX, ROX, CY5.

[0083] 2.3 Experimental result analysis:

[0084] When the Ct value of the internal standard gene CY5 in all wells of the detection sample is less than 35 and the amplification curve is normal, the result interpretation can be continued. The ABI 7500 raw result file is output as an Excel file, and it is imported into the interpretation software, which can directly analyze the RHD genotype of the sample to be tested. The results are as follows:

[0085]

[0086] Conclusion: The entire experimental process only takes about 2 hours, and the experimental results are accurate. Through the kit of the application, the RHD genotype of the experimental sample can be accurately judged.

[0087] Fig. 1-1 to Fig. 1-8 The amplification curves of No. 1 to No. 8 wells, respectively. The marker probe amplification curve is normal and Ct < 35, and it is judged that the marker probe is a positive reaction; there is no amplification curve rising or Ct ≥ 35, and it is judged that the marker probe is a negative reaction.

[0088] Fig. 2 S1 sequencing map, the sequencing result is consistent with the detection result of the method.

[0089] Fig. 3 S2 sequencing map, the sequencing result is consistent with the detection result of the method.

[0090] Fig. 4 Figure 8 is a sequencing chromatogram of S3, and the sequencing result is consistent with the detection result of the method.

[0091] Fig. 5 Figure 9 is a sequencing chromatogram of S4, and the sequencing result is consistent with the detection result of the method.

[0092] Fig. 6 Figure 10 is a sequencing chromatogram of S5, and the sequencing result is consistent with the detection result of the method.

[0093] Fig. 7 Figure 11 is a sequencing chromatogram of S6, and the sequencing result is consistent with the detection result of the method.

[0094] Fig. 8 Figure 12 is a sequencing chromatogram of S7, and the sequencing result is consistent with the detection result of the method.

[0095] Fig. 9 Figure 13 is a sequencing chromatogram of S8, and the sequencing result is consistent with the detection result of the method.

[0096] The above examples are only for illustrating the technical concept and characteristics of the present application, and the purpose is to enable the person skilled in the art to understand the content of the present application and to implement it, and cannot limit the protection scope of the present application. Any equivalent modification or change made according to the spirit of the present application should be covered within the protection scope of the present application.

Claims

1. A multiplex PCR primer probe combination for human red blood cell RHD genotyping detection, characterized in that, The combination contains 19 pairs of specific primers and corresponding probes, and the 19 pairs of specific primers and corresponding probes are distributed in 8 reaction wells, each reaction well contains a pair of primers and corresponding probes with nucleotide sequences as shown in the following table: The nucleotide sequences of the 19 pairs of specific primers and corresponding probes, and the 19 amplification sites targeted by the 19 pairs of specific primers and corresponding probes are specifically shown in the following table: In the 8 reaction wells, each well further contains a pair of internal control primers and a corresponding probe, and the nucleotide sequences are shown as SEQ ID No. 44-46, which are used to monitor false negative results caused by instrument failure, reagent factors, polymerase activity or inhibitors in the sample; The nucleotide sequences of SEQ ID No. 44-46 are as follows:

2. The kit containing the multiplex PCR primer probe combination for human red blood cell RHD gene typing detection according to claim 1.

3. The kit of claim 2, wherein The kit further comprises a PCR reaction mixture, Taq enzyme and an optical film.

4. The kit of claim 3, wherein The PCR reaction mixture comprises 0.18 mM deoxynucleotides dNTP, 1.8 mM magnesium chloride, 60.3 mM potassium chloride, 18.9 mM Tris-HCl, 0.6% v / v glycerol, 5% v / v dimethyl sulfoxide and 2.5% v / v formamide, wherein DMSO and formamide are used as PCR reaction enhancer and stabilizer at the same time.

5. The kit of claim 2, wherein The kit contains a 96-well plate for simultaneously detecting the RHD genotyping of 12 samples, and the PCR amplification primer group and Taqman probe of the 12 samples are dried at the bottom of the 96-well plate.

Images