Specific DNA markers for detecting high grain weight alleles on rice grain weight QTL qTGW2-35.7 and their applications

By developing the specific DNA marker Tw35754, the problems of low efficiency and insufficient accuracy in rice grain weight improvement were solved, enabling a rapid and accurate breeding process and improving the efficiency of rice grain weight and grain shape improvement.

CN119876457BActive Publication Date: 2025-10-28CROP RES INST OF FUJIAN ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510085164.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-20
Publication Date
2025-10-28
Estimated Expiration
2045-01-20

AI Technical Summary

Technical Problem

Existing methods for improving rice grain weight suffer from low efficiency and insufficient accuracy. In particular, traditional hybridization breeding methods are time-consuming, and existing molecular marker-assisted selection methods lack effective single markers, resulting in slow breeding processes and low accuracy.

Method used

A specific DNA marker, Tw35754, was developed to detect the high grain weight allele of IRBB52 on the rice grain weight QTL qTGW2-35.7. High-accuracy identification was achieved by PCR amplification and electrophoresis detection, simplifying the complexity of multiple marker combination.

Benefits of technology

This technology enables rapid and accurate identification of rice varieties carrying the IRBB52 high grain weight allele, simplifying the breeding process and improving the efficiency of rice grain weight and shape improvement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119876457B_ABST
    Figure CN119876457B_ABST
Patent Text Reader

Abstract

This invention provides a specific DNA marker for detecting the high grain weight allele on the rice grain weight QTL qTGW2-35.7 and its application. The DNA marker is named Tw35754, and the upstream primer sequence of the DNA marker Tw35754 is shown in SEQ ID No:1, and the downstream primer sequence is shown in SEQ ID No:2. Using this specific DNA marker Tw35754 to detect rice DNA can rapidly and accurately identify whether the test material carries the IRBB52 high grain weight allele on QTL qTGW2-35.7, i.e., whether it can increase rice grain weight, grain length, grain width, and length-to-width ratio. The marker provided by this invention has good specificity and high accuracy, and has promising applications in the improvement of rice grain weight and grain shape varieties.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] This invention belongs to the field of genetic breeding for rice grain weight and shape improvement, specifically involving the detection and application of specific DNA markers for high grain weight alleles on rice grain weight QTL qTGW2-35.7, particularly the identification of QTLs controlling rice grain weight and shape, the detection of high grain weight alleles, and their breeding applications for improving grain weight and shape. [Background Technology]

[0002] In recent years, research on quantitative trait loci (QTLs) has played an increasingly important role in agricultural biotechnology. By studying these QTLs that control important agronomic traits such as disease and pest resistance and seed size, scientists can more accurately locate beneficial variations and apply them to breeding practices, thereby cultivating higher-quality and more efficient crop varieties.

[0003] Grain weight is one of the key yield traits in rice, mainly determined by grain length, width, and thickness. Grain length and width are not only important indicators for evaluating the appearance quality of rice, but also significantly influence its milling quality and cooking taste, greatly affecting its market value. Therefore, identifying more novel QTLs controlling grain weight and shape and developing closely linked DNA markers will be beneficial for the improvement of rice varieties in terms of grain weight and shape.

[0004] Currently, there are two main strategies commonly used to improve rice yield: one is the traditional hybridization breeding method, which involves repeatedly experimenting with combinations of different parents to screen for new lines with superior growth performance; this method is low-cost but time-consuming and inefficient. The other is marker-assisted selection (MAS), which can quickly identify individuals carrying the desired phenotype at an early stage, greatly shortening the breeding cycle and increasing the success rate. However, the traditional MAS method relies on the simultaneous use of multiple polymorphic markers within linkage disequilibrium regions, which not only increases experimental complexity but also limits its practicality and accuracy.

[0005] While the methods described above can improve rice quality to some extent, they still have some limitations. For example, traditional hybridization breeding methods are difficult to meet market demand for new varieties due to their long time span; and while the existing MAS method can significantly accelerate the breeding process, its accuracy in practical applications needs to be improved due to the lack of an effective single marker.

[0006] The patent holder identified a novel QTL, qTGW2-35.7, controlling grain weight from the indica rice varieties Teqing and IRBB52. Alleles from IRBB52 significantly increased thousand-grain weight, grain length, grain width, and length-to-width ratio. Subsequently, based on the whole-genome resequencing results of Teqing and IRBB52, the patent holder developed a molecular marker for detecting the high-grain-weight IRBB52 allele on qTGW2-35.7. This marker can be widely used for improving grain weight and grain shape traits in rice varieties. [Summary of the Invention]

[0007] The technical problem to be solved by the present invention is to provide a specific DNA marker for detecting high grain weight alleles in rice grain weight QTL qTGW2-35.7 and its application. This marker can specifically identify high grain weight alleles located in the qTGW2-35.7 region of rice with high accuracy and can be used for molecular marker-assisted selection breeding of high grain weight rice varieties.

[0008] This invention is implemented as follows:

[0009] A specific DNA marker for detecting the high grain weight allele on the rice grain weight QTL qTGW2-35.7, the DNA marker being named Tw35754, and the primer sequence for the DNA marker Tw35754 is as follows:

[0010] The upstream primer sequence for Tw35754 is: GGTACATATAAGAAATGATGCCTG; as shown in the nucleotide sequence of SEQ ID No:1;

[0011] The downstream primer sequence for Tw35754 is: GCCTCCTCAATTTATACTAGATGA; as shown in SEQ ID No:2.

[0012] Furthermore, the DNA marker is used in detecting the IRBB52 high grain weight allele in rice grain weight QTL qTGW2-35.7.

[0013] Furthermore, a method for detecting specific DNA markers of the high grain weight allele on the rice grain weight QTL qTGW2-35.7 includes the following steps:

[0014] (1) Using the DNA of control IRBB52 and the rice material to be tested as templates, the DNA marker Tw35754 and Taq DNA polymerase described in claim 1 were added for PCR amplification. The PCR reaction conditions were: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 15 seconds, 32 cycles, and extension at 72°C for 3 minutes.

[0015] (2) The PCR products were detected by 6% non-denaturing polyacrylamide gel electrophoresis. If the size of the PCR product fragment of the sample to be tested is consistent with that of IRBB52, it indicates that the sample to be tested carries the IRBB52 high-grain weight allele on qTGW2-35.7.

[0016] The present invention has the following advantages:

[0017] This invention provides a specific PCR marker for detecting the IRBB52 high-grain-weight allele at the rice grain weight QTL qTGW2-35.7. This marker can accurately identify whether the test material carries the IRBB52 high-grain-weight allele at this locus. Based on the detection results, it can be determined whether the rice variety can increase grain weight, grain length, grain width, and length-to-width ratio. The marker provided by this invention has good specificity and high accuracy, which helps to quickly identify valuable sources of genetic variation. At the same time, it simplifies the complex multiplex marker combination mode, requiring only a set of primers with good specificity to achieve ideal typing results. It has good application prospects in the improvement of rice grain weight and grain shape varieties. [Attached Image Description]

[0018] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0019] Figure 1 This is an electrophoretic detection image of 22 strains of Teqing and IRBB52 and their derivative populations after PCR amplification using the DNA marker Tw35754 in this embodiment of the invention; where M: molecular weight control; P1: Teqing; P2: IRBB52; 1-22: test strains. [Specific implementation method]

[0020] The following will be combined with the appendix Figure 1 The technical solution of the present invention will be clearly and completely described in detail with specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0021] Example: Detection of IRBB52 high grain weight allele-specific DNA molecular markers on rice grain shape QTL qTGW2-35.7

[0022] For the QTL qTGW2-35.7 region, based on the whole-genome resequencing results of Teqing and IRBB52, sequence alignment was performed to screen for differentially expressed sites. Using Oligo7 primers, an InDel marker, Tw35754, was developed to detect a specific fragment of the IRBB52 high-grain weight allele at qTGW2-35.7. The primer sequence for the DNA marker Tw35754 is as follows:

[0023] The upstream primer sequence for Tw35754 is: GGTACATATAAGAAATGATGCCTG; as shown in the nucleotide sequence of SEQ ID No:1;

[0024] The downstream primer sequence for Tw35754 is: GCCTCCTCAATTTATACTAGATGA; as shown in SEQ ID No:2.

[0025] To determine whether the DNA marker Tw35754 is specific between Teqing and IRBB52, and whether the near-isogenic lines derived from the Teqing / IRBB52 combination and segregated in qTGW2-35.7 can accurately identify alleles carrying the high grain weight IRBB52 allele, the following specific methods were used for detection:

[0026] (1) Rice material planting: Based on the previous positioning results, near-isogenic lines that segregated at the qTGW2-35.7 locus were screened from the Teqing / IRBB52 derivative population and planted at the Shaxian Experimental Base of Fujian Academy of Agricultural Sciences in 2019. A randomized block design was adopted, with 2 replicates and 8 plants per line in 1 row.

[0027] (2) Trait evaluation: At maturity, the middle 6 plants of each line were harvested together, dried, and threshed. The grains were then poured into a 5 mol / L sodium chloride solution, and empty and unfilled grains floating on the surface were removed using a strainer. Full grains were then removed and rinsed with clean water. The full grains were then dried in a 37℃ oven until the moisture content reached approximately 10%-11% (approximately 16 hours). 600 full grains were selected and divided into two technical replicates. The weights were measured, and the thousand-grain weight, grain length, grain width, and length-to-width ratio were determined using a Wanshen SC-G automatic seed analyzer. The data error between the two technical replicates was no higher than 2.0%.

[0028] (3) DNA marker detection: Genomic DNA was extracted from 22 strains using a micro-method. The extraction method is as follows: Take leaves from the middle 6 individual plants of each strain, and pick 0.5 cm long leaves from each plant. Mix them together and place them in a 2 mL centrifuge tube. Add 400 μL of DNA extraction buffer to the centrifuge tube, add a small steel ball, tighten the cap, and grind both sides of the tube for 30 seconds each at a frequency of 25 Hz using a tissue grinder. Add 400 μL of chloroform extraction buffer in a fume hood, tighten the cap, invert and mix well, and centrifuge at 11,000 rpm for 1 minute. Slowly aspirate 300 μL of the supernatant into a 1.5 mL centrifuge tube, add 600 μL of pre-cooled anhydrous ethanol to the centrifuge tube, tighten the cap, and invert and mix well. Centrifuge at 11,000 rpm for 3 minutes. Discard the supernatant, wash the precipitate twice with 70% ethanol, discard the supernatant, invert the 1.5 mL centrifuge tube onto clean paper, and let it air dry. Add 100 μL of 1 / 10×TE buffer. PCR amplification was then performed on Teqing, IRBB52, and 26 test lines using the specific marker Tw35754. The amplification program was as follows: pre-denaturation at 94℃ for 2 minutes, denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 15 seconds, 32 cycles, followed by a final extension at 72℃ for 3 minutes. Finally, the PCR products were detected by 6% non-denaturing polyacrylamide gel electrophoresis.

[0029] like Figure 1 As shown, at locus Tw35754, samples 1, 3, 4, 6, 9, 11, 14, 15, 17, 18, 21, and 22 were homozygous for IRBB52, indicating that these lines carry the IRBB52 high-grain-weight allele on qTGW2-35.7. Samples 2, 5, 7, 8, 10, 12, 13, 16, 19, and 20 were homozygous for extra-green grains, meaning these lines do not carry the IRBB52 allele. Analysis of variance showed highly significant differences in thousand-grain weight, grain length, grain width, and length-to-width ratio between the two allele types (P values ​​less than 0.0001). Lines carrying the IRBB52 allele on qTGW2-35.7 increased thousand-grain weight, grain length, grain width, and length-to-width ratio by 0.30 g, 0.027 mm, 0.025 mm, and 0.011, respectively. As shown in Tables 1 and 2, Tables 1 and 2 below present the SAS calculation results for near-isogenic lines:

[0030] Table 1

[0031] genotype 1000 grains weight Particle length Particle width Aspect Ratio 1 (Special Qing homozygous type) 25.56g 5.320mm 5.352mm 2.786 2 (IRBB52 homozygous) 26.17g 5.375mm 5.401mm 2.809

[0032] Table 2

[0033] 1000 grains weight Particle length Particle width Aspect Ratio A 0.30g 0.027mm 0.025mm 0.011 P <.0001 <.0001 <.0001 <.0001 SSg 12.84 0.10 0.07 0.018 SSl(g) 12.27 0.12 0.07 0.05 SSe 16.01 0.07 0.09 0.03 SSp 41.12 0.30 0.23 0.10 <![CDATA[R 2 ]]> 31.21% 35.22% 30.24% 17.89%

[0034] The above results indicate that the DNA marker Tw35754 provided by this invention has high reliability in detecting the IRBB52 high grain weight allele on rice grain shape qTGW2-35.7, and it can be applied to molecular marker-assisted selection breeding of the IRBB52 high grain weight allele on rice grain shape QTL qTGW2-35.7.

[0035] While specific embodiments of the present invention have been described above, those skilled in the art should understand that the specific embodiments described are merely illustrative and not intended to limit the scope of the present invention. Equivalent modifications and variations made by those skilled in the art in accordance with the spirit of the present invention should be covered within the scope of protection of the claims of the present invention.

Claims

1. A method for detecting the QTL of rice grain weight qTGW2-35.7 A method for detecting specific DNA markers of high-grain-weight alleles, characterized in that: The detection method steps are as follows: (1) Using the DNA of the control IRBB52 and the rice material to be tested as templates, primers and... Taq DNA polymerase was used for PCR amplification. PCR reaction conditions: pre-denaturation at 94℃ for 2 minutes, denaturation at 94℃ for 30 seconds, annealing at 55℃ for 30 seconds, extension at 72℃ for 15 seconds, 32 cycles, followed by a final extension at 72℃ for 3 minutes; primer sequences are as follows: The upstream primer sequence for Tw35754 is: GGTACATATAAGAAATGATGCCTG; as shown in the nucleotide sequence of SEQ ID No:1; The downstream primer sequence for Tw35754 is: GCCTCCTCAATTTATACTAGATGA; as shown in the nucleotide sequence of SEQ ID No:2; (2) The PCR products were detected by 6% non-denaturing polyacrylamide gel electrophoresis. If the size of the PCR product fragment of the sample was consistent with that of IRBB52, it indicated that the sample carried IRBB52. qTGW2-35.7 The IRBB52 high-grain weight allele.