Capsid protein-antibody conjugates, modified viruses, pharmaceutical compositions and uses

Abstract

The invention belongs to the field of biological medicine, and relates to a capsid protein-antibody conjugate, a modified virus, a medicine composition and application. Specifically, the invention relates to a capsid protein-antibody conjugate, a non-natural amino acid is inserted into the capsid protein, and a target head molecule such as an antibody is connected to the non-natural amino acid. The modified virus provided by the invention has a good application prospect.

Description

Capsid protein-antibody conjugates, modified viruses, drug combinations and uses Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a capsid protein-antibody conjugate, a modified virus, a drug combination and uses. Background Art

[0002] Gene therapy involves transferring genetic material into a patient's cells to treat a disease. Gene therapy strategies can be categorized by their mode of action: ① gene expression, ② gene silencing, and ③ gene editing. To date, viral vectors have been the primary vectors used in clinical gene therapy, primarily adenovirus, lentivirus, and recombinant adeno-associated virus (rAAV). rAAV, with its advantages of non-genomic integration, prolonged gene expression, and weak immunogenicity, is currently the most commonly used viral vector.

[0003] The main problems in the current research field of rAAV viral vectors are: rAAV has poor selectivity for infection of specific tissues, so the application range of rAAV vectors is narrow.

[0004] To address this issue, current efforts to modify rAAV vectors focus on the following four areas: 1) discovering new serotypes from nature to identify targeted viral vectors; 2) discovering targeted viral capsids through multiple rounds of screening using directed evolution; 3) predicting and modifying viral capsids through computational methods such as genetic algorithms; and 4) targeting viral vectors through capsid modification strategies.

[0005] AAV is composed of three capsid proteins, VP1 / VP2 / VP3, with a ratio close to 1:1:10, and the icosahedron has a total of 60 protein units. That is, the number of capsid proteins is close to 5:5:10. In addition, the VP1, VP2 and VP3 proteins are produced from the same DNA reading frame through mRNA splicing, resulting in translation from different start codons. Therefore, the C-terminal 533 amino acids (i.e., the full length of VP3) of these three proteins are the same. VP1 is 735 amino acids in length and has a molecular weight of approximately 87KDa; VP2 is 598 amino acids in length, which is the same as the 138-735 amino acid sequence of the VP1 protein, with a molecular weight of approximately 72KDa; and the VP3 protein is 533 amino acids in length, which is partially identical to the 203-735 amino acid sequence of the VP1 protein, with a molecular weight of approximately 62KDa.

[0006] A study has disclosed a method of fusing a single-chain antibody to the N-terminus of the VP2 protein to change the virus targeting (Development of novel cell surface CD34-targeted recombinant adenoassociated virus vectors for gene therapy, Yang Q, Mamounas M, Yu G, Kennedy S, Leaker B, Merson J, Wong-Staal F, Yu M, Barber JR. Hum Gene Ther. 1998 Sep 1; 9(13): 1929-37. doi: 10.1089 / hum.1998.9.13-1929. PMID: 9741431.). There are also studies that have disclosed methods for altering viral targeting by fusing a protein with a targeted ankyrin repeat sequence to the N-terminus of the VP2 protein (Off-target-free gene delivery by affinity-purified receptor-targeted viral vectors, Münch RC, Muth A, Muik A, Friedel T, Schmatz J, Dreier B, Trkola A, Plückthun A, Büning H, Buchholz CJ. Nat Commun. 2015 Feb 10; 6:6246. doi: 10.1038 / ncomms7246. PMID: 25665714.). The methods described in these two documents both directly modify the expression sequence of the capsid protein, that is, fusing an antibody or targeting sequence to the AAV capsid protein. This approach is likely to seriously affect the stability of the capsid protein, resulting in a sharp decrease in packaging titer and infectivity.

[0007] There is a need to develop new methods to modify the targeting of AAV and new methods of drug delivery.

[0008] Summary of the Invention

[0009] After in-depth research and creative work, the inventors have produced a capsid protein-antibody conjugate and a modified adeno-associated virus. The inventors surprisingly discovered that the capsid protein-antibody conjugate or modified adeno-associated virus has altered targeting and has the potential to be used in the preparation of targeted drugs. This provides the following invention:

[0010] One aspect of the present invention relates to a capsid protein-antibody conjugate, wherein the capsid protein is inserted with a non-natural amino acid, and the non-natural amino acid is linked to a target head molecule;

[0011] Preferably, the targeting head molecule is an antibody.

[0012] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is a capsid protein of an adeno-associated virus, for example, one or more selected from VP1 protein, VP2 protein and VP3 protein.

[0013] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP1 protein.

[0014] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP2 protein.

[0015] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP3 protein.

[0016] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP1 protein and VP2 protein.

[0017] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP1 protein and VP3 protein.

[0018] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP2 protein and VP3 protein.

[0019] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the capsid protein is VP1 protein, VP2 protein and VP3 protein.

[0020] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the non-natural amino acids are one or more, for example, 1-60, 1-50, 1-40, 1-30, 1-20 or 1-10.

[0021] Without being bound by theory, since VP1, VP2 and VP3 are transcribed from the same gene DNA to obtain mRNA and then translated from different positions, the corresponding amino acids between 138-207 in the genome are modified, which is reflected in the capsid as modifications to VP1 and VP2. Amino acid modifications between positions 208-735 will be reflected in VP1, VP2 and VP3.

[0022] Without being bound by theory, since a virus has 60 capsid proteins, if the mutation site is selected on VP3, the VP1, VP2 and VP3 capsid proteins will all carry NAEK inserted at the mutation site. Therefore, under normal circumstances, there are 60 NAEK molecules on one virus molecule.

[0023] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the non-natural amino acid is a non-natural amino acid with an azide group, preferably NAEK.

[0024] The structure of NAEK is shown in Formula I below:

[0025] In some embodiments of the present invention, in the capsid protein-antibody conjugate, each non-natural amino acid is connected to a target head molecule, such as an antibody.

[0026] In some embodiments of the present invention, in the capsid protein-antibody conjugate, each unnatural amino acid NAEK is connected to a target head molecule, such as an antibody.

[0027] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the insertion of the unnatural amino acid causes the virus to lose at least 80%, at least 90% of its ability to infect cells;

[0028] Preferably, the ability to infect cells is completely or substantially lost;

[0029] Preferably, the cells are A431 cells.

[0030] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the position at which the non-natural amino acid is inserted is S264+1, D327, or N587+1. Here, the first amino acid at the N-terminus of the VP1 protein is counted as 1; S264+1 indicates insertion at the adjacent site following S264, i.e., between amino acids 264 and 265; D327 indicates mutation of the amino acid at position 327 to a non-natural amino acid; and N587+1 indicates insertion at the adjacent site following N587, i.e., between amino acids 587 and 588.

[0031] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the antibody is a nanobody or a single-chain antibody.

[0032] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the antibody is an anti-tumor antibody.

[0033] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the antibody is a nanobody or a single-chain antibody targeting a target selected from the following:

[0034] EGFR, HER2, TfR, PD-1, PD-L1, CTLA-4 and VEGFR.

[0035] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the amino acids of the antibody are as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4.

[0036] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the antibody is directly linked to the non-natural amino acid, or is linked through a coupling pair or a bifunctional linker.

[0037] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the conjugated pair is selected from: Spycatcher and DBCO-spy peptide, Biotin-DBCO and mono Streptavidin, Vidal-N-DBCO and Vidal-C;

[0038] DBCO is linked by reacting with the N3 group on the unnatural amino acid.

[0039] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the amino acid sequence of Spycatcher is as shown in SEQ ID NO: 5; and / or the amino acid sequence of the spy peptide is as shown in SEQ ID NO: 17.

[0040] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the coupling pair is Spycatcher and DBCO-VC-spy peptide, wherein DBCO is connected by reacting with the N3 group on NAEK.

[0041] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the amino acid sequence of Spycatcher is as shown in SEQ ID NO: 5; and / or the amino acid sequence of the DBCO-VC-spy peptide is as shown in SEQ ID NO: 19.

[0042] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the antibody is directly connected to the Spycatcher or connected through a linker; preferably, the amino acid sequence of the linker is as shown in SEQ ID NO:15.

[0043] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the bifunctional linker is DBCO-PEG (n) -TCO, wherein n is a positive integer selected from 4 to 20, preferably n is 4; and

[0044] One or more amino acids in the antibody are substituted with a non-natural amino acid containing a tetrazine group; preferably, glutamine (Q) at position 82 and / or asparagine (N) at position 84 of the antibody shown in SEQ ID NO: 1 are substituted with a non-natural amino acid containing a tetrazine group;

[0045] Preferably, the non-natural amino acid containing a tetrazine group is represented by the following formula II:

[0046] The present invention also relates to a capsid protein-antibody conjugate, wherein the capsid protein is inserted with an unnatural amino acid (e.g., NAEK), and the unnatural amino acid is linked to an antibody, wherein:

[0047] The capsid protein is the capsid protein of adeno-associated virus;

[0048] The unnatural amino acid is NAEK, and the insertion position is S264+1, D327 or N587+1;

[0049] The antibody is a nanobody or single-chain antibody targeting a target selected from the following targets:

[0050] EGFR, HER2, TfR, PD-1, PD-L1, CTLA-4 and VEGFR;

[0051] The antibody and the non-natural amino acid are connected via a coupling pair or a bifunctional linker.

[0052] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the amino acids of the antibody are as shown in any one of SEQ ID NO: 1 to SEQ ID NO: 4.

[0053] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the coupling pair is Spycatcher and DBCO-spy peptide, wherein DBCO is connected by reacting with the N3 group on NAEK.

[0054] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the amino acid sequence of Spycatcher is as shown in SEQ ID NO: 5; and / or the amino acid sequence of the spy peptide is as shown in SEQ ID NO: 17.

[0055] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the coupling pair is Spycatcher and DBCO-VC-spy peptide, wherein DBCO is connected by reacting with the N3 group on NAEK.

[0056] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein the amino acid sequence of Spycatcher is as shown in SEQ ID NO: 5; and / or the amino acid sequence of the DBCO-VC-spy peptide is as shown in SEQ ID NO: 19.

[0057] In some embodiments of the present invention, in the capsid protein-antibody conjugate, the antibody is directly connected to the Spycatcher or connected through a linker; preferably, the amino acid sequence of the linker is as shown in SEQ ID NO:15.

[0058] In some embodiments of the present invention, the capsid protein-antibody conjugate, wherein,

[0059] The bifunctional linker is DBCO-PEG (n) -TCO, wherein n is a positive integer selected from 4 to 20, preferably n is 4; and

[0060] One or more amino acids in the antibody are substituted with a non-natural amino acid containing a tetrazine group; preferably, glutamine (Q) at position 82 and / or asparagine (N) at position 84 of the antibody shown in SEQ ID NO: 1 are substituted with a non-natural amino acid containing a tetrazine group;

[0061] Preferably, the non-natural amino acid containing a tetrazine group is represented by the following formula II:

[0062] Another aspect of the present invention relates to a modified virus comprising the capsid protein-antibody conjugate according to any one of the present invention.

[0063] In some embodiments of the present invention, the modified virus comprises an expression plasmid; preferably, the expression plasmid comprises a multiple cloning site or is inserted with a target gene;

[0064] Preferably, the target gene is the herpes simplex virus thymidine kinase gene or a reporter gene, such as the green fluorescent protein reporter gene GFP or the firefly luciferase reporter gene Luciferase.

[0065] In some embodiments of the present invention, the modified virus comprises pAAV-MCS plasmid, pAAV-RC plasmid and pHelper plasmid, wherein,

[0066] The pAAV-RC plasmid contains the following mutation sites:

[0067] The codons corresponding to S264+1, D327, or N587+1 are mutated to the stop codon TAG. The S264+1 site indicates the insertion of a TAG codon between amino acids 264 and 265; the D327 site indicates the mutation of the codon corresponding to amino acid 327 to TAG; and the N587+1 site indicates the insertion of a TAG codon between amino acids 587 and 588.

[0068] In some embodiments of the present invention, the modified virus is further loaded with a target gene; preferably, the target gene is the herpes simplex virus thymidine kinase gene or a reporter gene, such as the green fluorescent protein reporter gene GFP or the firefly luciferase reporter gene Luciferase.

[0069] Another aspect of the present invention relates to a pharmaceutical combination comprising an effective amount of the capsid protein-antibody conjugate according to any one of the present invention or the modified virus according to any one of the present invention, and an effective amount of ganciclovir;

[0070] The pharmaceutical combination is a fixed combination, for example in the form of a solid pharmaceutical composition or a liquid pharmaceutical composition; or

[0071] The drug combination is a non-fixed combination, for example, the capsid protein-antibody conjugate or the modified virus and ganciclovir are each in the form of a pharmaceutical composition.

[0072] Another aspect of the present invention relates to a method for preparing a targeted drug, comprising the steps of loading a target gene (e.g., a therapeutic gene) onto the modified virus described in any one of the present invention;

[0073] Preferably, the targeted drug is a drug for treating or preventing tumors;

[0074] Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma;

[0075] Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR;

[0076] Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR;

[0077] Preferably, the targeted drug is a drug targeting diseased tissue;

[0078] Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

[0079] Another aspect of the present invention relates to use of the capsid protein-antibody conjugate according to any one of the present invention or the modified virus according to any one of the present invention in the preparation of targeted drugs;

[0080] Preferably, the targeted drug is a drug for treating or preventing tumors;

[0081] Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma;

[0082] Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR;

[0083] Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR;

[0084] Preferably, the targeted drug is a drug targeting diseased tissue;

[0085] Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

[0086] The capsid protein-antibody conjugate or the modified virus according to the present invention is used as a vector for delivering drugs, such as therapeutic genes.

[0087] The capsid protein-antibody conjugate according to any one of the present invention or the modified virus according to any one of the present invention, which is used for preparing a targeted drug;

[0088] Preferably, the targeted drug is a drug for treating or preventing tumors;

[0089] Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma;

[0090] Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR;

[0091] Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR;

[0092] Preferably, the targeted drug is a drug targeting diseased tissue;

[0093] Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

[0094] Another aspect of the present invention relates to a method for treating or preventing a disease using a targeted drug, comprising the step of administering an effective amount of the targeted drug to a subject in need thereof, wherein the targeted drug comprises a modified virus of the present invention loaded with a target gene (e.g., a therapeutic gene) as an active ingredient;

[0095] Preferably, the targeted drug is a drug for treating or preventing tumors;

[0096] Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma;

[0097] Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR;

[0098] Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR;

[0099] Preferably, the targeted drug is a drug targeting diseased tissue;

[0100] Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears

[0101] In the present invention, unless otherwise specified, the adeno-associated virus is a recombinant adeno-associated virus (rAAV).

[0102] In some embodiments of the present invention, the adeno-associated virus is adeno-associated virus type 2 (AAV2 or rAAV2).

[0103] In the present invention, the term "retargeting" refers to destroying the affinity of the viral vector for its original receptor and conferring new tissue targeting, organ targeting, or cell targeting to the virus by coupling a new target head molecule. In some embodiments of the present invention, "destroying the affinity of the viral vector for its original receptor" refers to destroying the electrostatic interaction between AAV and its initial adhesion receptor HSPG by inserting unnatural amino acids, causing it to lose its adhesion to cells, thereby facilitating the coupling of antibodies (such as nanobodies or single-chain antibodies) at this site to achieve retargeting.

[0104] In the present invention, the term "targeting ligand" refers to a ligand molecule with targeting properties. In biochemistry and pharmacology, a ligand refers to a substance that can bind to a receptor to produce a certain physiological effect. In a protein-ligand complex, the ligand is usually a signal triggering molecule connected to a specific binding site of the target protein. In a DNA-ligand complex, the ligand connected to the DNA double strand can generally be any small molecule or ion or even a protein (Teif VB, Rippe K. Statistical-mechanical lattice models for protein-DNA binding in chromatin. Journal of Physics: Condensed Matter. 2010, 22(41): 414105.). In some embodiments of the present invention, the target molecule is an antibody, such as a nanobody or a single-chain antibody.

[0105] Advantageous Effects of the Invention

[0106] The present invention achieves one or more of the following technical effects (1) to (8):

[0107] (1) The modified virus of the present invention achieves a good retargeting effect;

[0108] (2) The unnatural amino acid-based method used in the present invention can avoid major changes to the capsid protein;

[0109] (3) The platform constructed by the present invention can facilitate the replacement of target molecules;

[0110] (4) The modified virus retargeting of the present invention is achieved independently of the target gene delivered by AAV;

[0111] (5) The modified viruses of the present invention can effectively achieve tumor-specific gene delivery in vivo;

[0112] (6) The modified virus of the present invention better maintains the affinity between the target head molecule and its receptor;

[0113] (7) The modified virus of the present invention has higher infection activity;

[0114] (8) The modified virus of the present invention has a higher packaging efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0115] Figure 1A: Schematic diagram of the AAV2 VP3 protein capsid and non-natural amino acid insertion sites.

[0116] Figure 1B: Statistical graph of the infectious activity of wild-type and various mutant AAV2s in A431 cells at equal genome titers.

[0117] Figure 2A: Graph showing affinity of 10E8-spycatcher for EGFR detected by SPR. Figure 2B: Graph showing affinity of HB21-spycatcher for hTFR detected by SPR. Figure 2C: Graph showing affinity of 5F7-spycatcher for HER2 detected by SPR.

[0118] Figure 2D: Graph showing the affinity of 2RS-spycatcher to HER2 detected by SPR.

[0119] Figure 2E: Flow cytometry analysis of the affinity of 10E8-spycatcher to A431 cells that highly express EGFR.

[0120] Figure 2F: Flow cytometry analysis of the affinity of HB21-spycatcher to U87 cells that highly express hTFR.

[0121] Figure 2G: Flow cytometry analysis of the affinity of 2RS-spycatcher to SKBr3 cells that highly express HER2.

[0122] Figure 2H: Flow cytometry analysis of the affinity of 5F7-spycatcher to SKBr3 cells that highly express HER2.

[0123] Figure 3A: Western validation of the degree of nanobody coupling under different conditions for AAV2 N587+1.

[0124] Figure 3B: Statistical graph of the proportion of capsids successfully conjugated to nanobodies analyzed by Image J in AAV2 N587+1 in Figure 3A.

[0125] Figure 3C: Immunoelectron microscopy results of AAV2 N587+1 unconjugated / conjugated nanobodies.

[0126] Figure 4A: Confocal immunofluorescence characterization of AAV WT and N587+1 unconjugated / conjugated nanobodies.

[0127] Figure 4B: Statistical graph of changes in infection activity of AAV2 coupled with 10E8-spycatcher at the S264+1 / D327 / N587+1 mutation site at the cellular level.

[0128] Figure 4C: Microscopic observation of the expression of GFP in A431 cells specifically infected with the conjugated nanobody N587+1-GFP.

[0129] Figure 4D: The results of Figure 4C were analyzed by fluorescence quantification using Image J.

[0130] Figure 4E: N587+1 spy / HB21 The expression of luciferase was detected to characterize the statistical changes in the infection activity of U87 cells.

[0131] Figure 4F: N587+1 spy / 5F7 and N587+1 spy / HB21 The expression of luciferase was detected to characterize the statistical changes in the infection activity of SKBr3 cells.

[0132] Figure 5A: Western validation of AAV2 N587+1 for the extent of nanobody coupling through vcspy linker under different conditions.

[0133] Figure 5B: N587+1 spy / 10E8 Statistical graph showing the changes in infection activity of A431 cells by detecting luciferase expression of N587+1vcspy / 10E8.

[0134] Figure 6A: Luciferase imaging detection results of N587+1vcspy / 10E8 in mice.

[0135] FIG6B : Statistical results of in vivo luciferase expression detection in FIG5A .

[0136] Figure 7A: Effect of N587+1vcspy / 10E8-tk on GCV ECs by cell viability assay 50 Impact graph.

[0137] FIG7B : Flow cytometry analysis of the effect of N587+1vcspy / 10E8-HSV-tk on cell apoptosis. ...

[0138] FIG7C is a graph showing the tumor size of mice after administration of N587+1vcspy / 10E8-HSV-tk.

[0139] FIG8A is a graph showing the results of Western blotting to verify the coupling degree between AAV2 N587+1 and different concentrations of nanobody-DBCO.

[0140] Figure 8B: N587+1 under different coupling conditions 10E8Q82 The expression of luciferase was detected to characterize the statistical changes in the infection activity of A431 cells.

[0141] The partial sequences involved in the present invention are as follows: DETAILED DESCRIPTION

[0142] The embodiments of the present invention will be described in detail below with reference to the examples, but it will be understood by those skilled in the art that the following examples are merely illustrative of the present invention and should not be construed as limiting the scope of the invention. Where specific conditions are not specified in the examples, the methods were performed according to conventional conditions or the conditions recommended by the manufacturer. Where the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be obtained commercially.

[0143] Example 1: Construction of single-point mutant pAAV-RC plasmid, virus packaging and purification

[0144] 1.1 Selection of mutation sites and construction of single-point mutant pAAV-RC plasmids

[0145] The AAV Helper-Free System is a mature three-plasmid recombinant AAV-2 packaging system developed by Stratagene, USA. In this system:

[0146] The pAAV-MCS plasmid is a master plasmid in the AAV Helper Free system. It provides the ITR sequences necessary for AAV packaging and an MCS region with multiple restriction sites (multiple cloning sites for target gene insertion).

[0147] The pAAV-RC plasmid provides the cap gene for packaging capsid proteins and the rep gene for expressing life cycle-related proteins;

[0148] The pHelper plasmid provides the auxiliary genes necessary for the AAV packaging process, namely the adenovirus VA, E4, and E2A genes.

[0149] The AAV293 cells used for packaging in this system are modified from HEK293 and stably express another auxiliary gene - the adenovirus E1 gene.

[0150] The present invention inserts the non-natural amino acid NAEK on the surface of the AAV-2 capsid protein and subsequently modifies it. First, a point mutation is performed at the corresponding site of the cap gene containing the pAAV-RC plasmid to introduce the stop codon TAG, so as to construct a series of pAAV-RC plasmids capable of expressing different mutant capsid proteins.

[0151] Based on the reported AAV-2 (viral AAV-2 produced by the three-plasmid recombinant AAV-2 packaging system) and crystal structure, the inventors comprehensively considered factors such as subsequent modification and packaging efficiency, and screened, designed and selected 20 sites, namely: S264, S264+1, A266, Q325, Q325+1, D327, G328, R447, S452, S452+1, G453, G453+1, R459, E548, E548+1, S578, R585+1, N587, N587+1 and S662 (the first amino acid at the N-terminus of the VP1 protein is counted as 1). The codons corresponding to the above sites were mutated to the stop codon TAG, where the site X+1 indicates that a TAG is inserted after the codon corresponding to the amino acid at position X. The schematic positions of the original natural amino acid residues of the above sites in the VP1 protein structure are shown in Figure 1A.

[0152] The mutant pAAV-RC plasmids corresponding to the above mutation sites were named pS264, pS264+1, pA266, pQ325, pQ325+1, pD327, pG328, pR447, pS452, pS452+1, pG453, pG453+1, pR459, pE548, pE548+1, pS578, pR585+1, pN587, pN587+1 and pS662, respectively.

[0153] 1.2 Packaging and purification of wild-type AAV2 (without NAEK insertion) and single-point mutant AAV2 with NAEK insertion

[0154] 1.2.1 Packaging of wild-type AAV2 virus and mutant AAV2 virus

[0155] To facilitate the subsequent titer and infection activity detection of virus packaging, the inventors used the pAAV-GFP and pAAV-luc plasmids previously constructed in the laboratory (the green fluorescent protein reporter gene GFP or the firefly luciferase reporter gene Luciferase was inserted into the multiple cloning site of pAAV-MCS, respectively).

[0156] Two days before transfection, AAV293 cells (Agilent) were cultured at 2.8*10 6Plate the cells at a density of 100 μL / dish; change half of the medium before transfection. For each set of 10 dishes of the desired transfection system, add 4 ml of Opti-MEM (400 μL / dish x 10 dishes) to a 15 ml centrifuge tube. Add the desired plasmids and mix thoroughly. The ratio of pSUPAR-YAV (expressing the enzyme / tRNA system required for unnatural amino acid insertion): pAAV-luc: pAAV-RC: phelper should be 10 μg: 5 μg: 5 μg: 5 μg. For the wild-type plasmid, omit the pSUPAR-YAV plasmid. For the mutant pAAV-RC plasmid, use the plasmid corresponding to the mutation site (the 20 mutant pAAV-RC plasmids constructed in step 1.1), such as pN587+1. In another 4 ml of Opti-MEM, add PEI (polyethyleneimine, a transfection reagent) (1 mg / ml) at a ratio of 1 μg plasmid to 3 μL transfection reagent and mix thoroughly. Quickly add the PEI solution to the plasmid solution, mix quickly, and incubate for 15 minutes. Then, add the plasmid / PEI mixed solution evenly to 10 dishes and gently shake to mix. After 6-8 hours, discard the original culture medium and replace it with fresh culture medium (10ml / dish):

[0157] Mutant AAV2 virus: DMEM + 10% FBS + 1% L-G + 1% P-S + 1 mM NAEK;

[0158] Wild-type AAV2 virus: DMEM + 10% FBS + 1% L-G + 1% PS;

[0159] PS stands for penicillin-streptomycin dual antibody.

[0160] Continue culturing in a 37°C, 5% CO2 incubator and harvest the virus between 68-72 hours (when harvesting, remove the supernatant from each dish of cells and collect them together). After repeated freeze-thawing four times, centrifuge at 10,000 g for 20 minutes to remove cell debris, and collect the supernatant for further AKTA purification.

[0161] 1.2.2 Ion exchange column purification based on the AKTA protein purification system

[0162] The AKTA purification system is based on a phosphate buffer system, and a 0.2 μm filter membrane is used to remove insoluble impurities.

[0163] Buffer A: 20 mM phosphate, 100 mM NaCl.

[0164] Buffer B: 20 ​​mM phosphate, 1 M NaCl.

[0165] Buffer C: 20 mM phosphate.

[0166] Dilute the sample halfway with Buffer C for loading, retaining the flowthrough for analysis. Equilibrate the column with Buffer A (low-salt phosphate buffer) for 10 column volumes. Elute with 27% Buffer B (approximately 370 mM NaCl) and collect the sample peak. After the entire sample peak has been collected, elute the remaining components from the purification column with 100% Buffer B until the UV absorbance peak approaches baseline. The column is then cleaned and stored.

[0167] 1.2.3 CsCl gradient centrifugation purification

[0168] CsCl was added at a ratio of 10 g / 20 ml of virus solution, followed by ultracentrifugation at 263,000 g at 20°C for 24 hours in a swing-out rotor. After centrifugation, the region containing the virus band was aspirated using a syringe and a long, blunt-blade needle. The collected virus solution was then filtered through a 100 kDa ultrafiltration tube at 4000 g for 30 minutes at 4°C to remove residual CsCl. The ultrafiltration solution was PBS + 0.001% F-68 to minimize viral aggregation.

[0169] The purified viruses were wild-type AAV2 and 20 mutant AAV2 viruses, among which the mutant AAV2 viruses were named: S264 mutant AAV2, S264+1 mutant AAV2, A266 mutant AAV2, Q325 mutant AAV2, Q325+1 mutant AAV2, D327 mutant AAV2, G328 mutant AAV2, R447 mutant AAV2, S452 mutant AAV2, S452+1 mutant AAV2, G453 mutant AAV2, G453+1 mutant AAV2, R459 mutant AAV2, E548 mutant AAV2, E548+1 mutant AAV2, S578 mutant AAV2, R585+1 mutant AAV2, N587 mutant AAV2, N587+1 mutant AAV2 and S662 mutant AAV2.

[0170] Example 2: Determination of cell infection activity of mutant AAV

[0171] 2.1 Viral genome titer determination

[0172] AAV virus is a DNA virus. When measuring the genome titer, DNase I is first used to remove excess DNA in the virus sample, while the genomic DNA in the virus is protected by the capsid protein and is not enzymatically hydrolyzed. Furthermore, in the qPCR process, the high temperature conditions in the first step can cause the viral capsid protein to cleave, thereby releasing the internal DNA, which can then be quantified by qPCR. The inventors used an absolute quantitative method, using the luciferase gene in the AAV genome as a quantitative standard to calculate the number of genome copies successfully encapsidated with the capsid protein. The luciferase primer sequence used in this experiment was designed as follows:

[0173] Forward Primer:GTGTTGTCCATTCCATCACGG(SEQ ID NO:13)

[0174] Reverse Primer:CCAGCAGCGCACTTTGAATC(SEQ ID NO:14)

[0175] 2.2 Virus infection activity assay

[0176] In this example, A431 cells (obtained from the National Cell Resource Platform Concord Cell Bank) were used as an example to perform AAV screening of mutation sites.

[0177] A431 cells are human skin squamous cell carcinoma cells that highly express epidermal growth factor receptor (EGFR) on their cell surface. AAV has good infection activity in them and can be used for preliminary screening and evaluation of changes in AAV infection activity at different mutation sites.

[0178] Press 1*10 4 A431 cells were seeded at a density of 100 μL / well in a 96-well plate with 100 μL of culture medium per well. After 24 hours, the culture medium was discarded, and the wild-type and mutant virus solutions (prepared in step 1.2.3 of Example 1 above) were added to 280 μL of serum-free DMEM at an MOI of 10K. After mixing, 100 μL / well of the virus solution was added to the 96-well plate in duplicate and incubated for 2 hours. Subsequently, the virus solution was discarded and replaced with fresh culture medium. After 48 hours of incubation, the culture medium was discarded, and 50 μL of the luminescent substrate prepared in the Bright-Glo™ Luciferase Assay System (Promega) was added to each well. The chemiluminescence value was immediately measured under a chemiluminescence instrument.

[0179] The results are shown in Figure 1B. The results show that compared with wild-type AAV2, the infection activity of different mutation sites changes differently. Among them, after the insertion of non-natural amino acids near sites such as S264+1, D327, and N587+1 (for example, there are also G328, R585+1 and N587, but considering factors such as packaging efficiency, these three sites were not selected), the infection activity of A431 cells was basically lost. From the perspective of retargeting, these sites can be used as alternative sites for further modification and coupling.

[0180] Example 3: Construction and activity characterization of antibody-spycatcher fusion protein

[0181] 3.1 Construction, expression and purification of antibody-spycatcher fusion protein

[0182] In this example, a total of four nanobodies or single-chain antibodies targeting different receptors were selected, namely, nanobody 10E8 targeting EGFR, nanobody 2RS targeting HER2, nanobody 5F7 targeting HER2, and single-chain antibody HB21 targeting TfR. At the same time, the spycatcher sequence was fused to its C-terminus through a linker (GGSGGT, SEQ ID NO: 15) to obtain four fusion proteins, named 10E8-spycatcher, 2RS-spycatcher, 5F7-spycatcher and HB21-spycatcher.

[0183] Spycatcher acts as a bridge, forming a direct covalent interaction with the spy peptide, a DBCO-spy peptide that can click onto the azide-containing AAV surface, thereby coupling the nanobody to the AAV surface. Due to the large molecular weight of nanobodies, direct coupling to the AAV surface is not easy. For example, conjugated pairs such as Biotin-DBCO and mono Streptavidin; Vidal-N-DBCO and Vidal-C should achieve similar coupling purposes. DBCO, as mentioned above, represents dibenzocyclooctyne.

[0184] The nucleic acid sequences encoding the above-mentioned fusion proteins (SEQ ID NO: 9 to SEQ ID NO: 12) were synthesized separately and cloned into the pET-21a (+) (laboratory preservation) Escherichia coli plasmid expression vector and transfected into the TransB (DE3) expression competent medium (CD811-02, Beijing Quanshijin Biotechnology Co., Ltd.). The transformed strain was inoculated into 2 ml LB medium containing 100 μg / ml ampicillin and then activated overnight at 37 ° C and 220 rpm. The activated bacterial solution was inoculated into 2 × YT medium for expansion culture until A600nm reached between 0.6 and 1.0. Isopropyl β-d-thiogalactopyranoside (IPTG) was added at a final concentration of 0.5 mM for induction and expressed at 20 ° C and 220 rpm for 18 hours. Subsequently, the bacterial pellet was collected by centrifugation and re-selected with His-Binding buffer (20 mM phosphate, pH 7.8, 500 mM NaCl, 20 mM imidazole) to evenly disperse the bacterial pellet. The resuspended bacterial solution was then passed through a microfluidizer and homogenized at 1200 bar and 4°C to extract soluble proteins. The supernatant was then centrifuged at 10,000 g and 4°C for 30 minutes, and Ni-NTA His-Bind Resin (Invitrogen) was added. The supernatant was shaken at 4°C for 2 hours to enrich the His-tagged fusion protein. Finally, after washing 3 times with wash buffer (20mM phosphate, pH 7.8, 500mM NaCl, 50mM imidazole), the target protein was eluted from His-Bind Resin with elution buffer (20mM phosphate, pH 7.8, 500mM NaCl, 500mM imidazole) and collected to obtain a crude product of the fusion protein. To further purify the fusion protein, cation exchange chromatography (Resource S, GE Healthcare) was used to further remove contaminants. The main elution peak was collected using a 10KDa centrifugal filter unit (Millipore), concentrated, and the buffer was replaced with PBS.

[0185] 3.2 Antibody-spycatcher fusion protein binding test to target receptor

[0186] In this example, the affinity of the spycatcher-fused antibody to its receptor was evaluated by surface plasmon resonance (SPR). Human EGFR, human HER2, and human TfR receptors were respectively fixed on a CM5 chip (Biacore) for analysis on a Biacore 8K system (GE Healthcare). The extracellular domains of the three receptors were purchased from Yiqiao Shenzhou. The experiment was performed at 25°C using 1×PBS-P buffer. The data were analyzed using Biacore 8K evaluation software, and the groups in which the injection segments could reach a steady state were analyzed using a 1:1 stable affinity model. For groups that exhibited sufficient curvature in both the binding and dissociation stages (slow binding and slow dissociation), a kinetic model was used to fit the data to determine K D The protein concentrations of all proteins were measured using the BCA assay (Pierce).

[0187] The results are shown in Figures 2A to 2D. The results show that the spycatcher-fused antibody retains a high affinity for its receptor, both in the nanomolar range. Therefore, spycatcher modification does not affect antibody-receptor binding.

[0188] 3.3 Determination of the binding activity of antibody-spycatcher fusion protein to receptor at the cellular level

[0189] In this example, the affinity of the antibody-spycatcher fusion protein to its receptor at the cellular level was evaluated by flow cytometry (cytoflow).

[0190] A431 cells overexpress EGFR, the target of 10E8-spycatcher; U87 cells overexpress TfR, the target of HB21-spycatcher; and SKBr3 cells overexpress HER2, the target of 2RS-spycatcher and 5F7-spycatcher (National Cell Resource Center, or ATCC). Therefore, these three cell lines were used for affinity testing of the corresponding antibody-spycatcher fusion proteins.

[0191] Antibody-spycatcher was diluted in series and the corresponding 1×10 5Cells were incubated at room temperature for 30 minutes in 100 μl PBS. Unbound proteins were then washed with PBS and centrifuged at 400 g for 3 minutes, twice. The cells were then resuspended in staining buffer and 1 μl of primary antibody (PE, biolegend) against DYKDDDDK (SEQ ID NO: 16) was added. The primary antibody was labeled with phycoerythrin (the antibody-spycatcher has a FLAG tag, which is fused to the C-terminus of the nanobody-spycatcher, making it convenient to examine the functions of the nanobody-spycatcher by flow cytometry or WB; the base sequence encoding the FLAG tag is GATTATAAAGATGATGATGATAAA, SEQ ID NO: 18). The cells were incubated at 4°C for 45 minutes, washed twice with PBS, and the proportion of cells that effectively bound to the antibody-spycatcher fusion protein was detected on a CytoFLEX flow cytometer (Beckman-Counlter) to characterize the affinity of the antibody-spycatcher to the receptor at the cellular level.

[0192] The experimental results are shown in Figures 2E to 2H. The results show that all antibody-spycatcher fusion proteins have good affinity with cells. As the antibody-spycatcher incubation concentration increases, the proportion of FLAG-positive cells gradually increases, and most of them can achieve 100% labeling efficiency at the μM level. At the same time, consistent with the SPR results, 5F7-spycatcher has a higher affinity for HER2 than 2RS-spycatcher. Specifically, when the incubation concentration of both proteins is 5 μM, the binding efficiency of 2RS-spycatcher is only about 15.7%, while 5F7-spycatcher can achieve complete labeling, as high as 92.6%. This shows that the fusion of spycatcher to the C-terminus of the antibody does not affect its affinity for the receptor.

[0193] Example 4: Conjugation and verification of mutant AAV-2 and antibody-spycatcher

[0194] 4.1 Western Validation of AAV-2 and Antibody-Spycatcher Conjugation

[0195] This experiment preliminarily verified through western blot that the mutant AAV2 can be covalently coupled to antibodies through spy-spycatcher.

[0196] First, the mutant AAV2 has been inserted with the non-natural amino acid NAEK with an azide group through gene codon expansion technology. 8Copies of mutant AAV2 (20 mutant AAV2s prepared in Example 1, with N587+1 mutant AAV2 used as an example) were coupled with DBCO-spy (20 μM or 200 μM) peptide via a click reaction of an azide group at 4°C overnight, thereby attaching a spy tag to the mutant AAV2.

[0197] The reactants were N587+1 mutant AAV2, DBCO-spy peptide, PBS buffer solution, and shaking at 4°C overnight at 60 rpm. After the reaction, the mixture was ultrafiltered through a 100 KDa ultrafiltration tube to remove impurities. The ultrafiltration conditions were 4000 rpm, 4°C, and 30 min / time, and a total of 4 ultrafiltrations were performed.

[0198] The DBCO-spy peptide is site-specifically coupled to the non-natural amino acid insertion site on the AAV2 capsid, such as N587+1. The DBCO at the C-terminus of the peptide reacts with the N3 group on the AAV, thereby linking to the AAV2. DBCO-spy can be more accurately written as spy-DBCO.

[0199] The amino acid sequence of the spy peptide is AHIVMVDAYKPTKGGGGK (SEQ ID NO: 17). Its function is to click on the surface of the AAV2 capsid as a "handle" or anchor point so that the antibody-spycatcher can be covalently coupled to it.

[0200] The solution was then ultrafiltered through a 100 kDa centrifugal filter unit (Millipore) to remove unconjugated small peptides. Antibody-spycatchers (C-terminal spycatchers) were then added at varying concentrations (5 μM and 100 μM) (using 10E8-spycatcher as an example) and reacted in a 25°C water bath for 1 hour. After completion, the solution was filtered through a 100 kDa ultrafiltration unit to remove impurities, and the buffer was replaced with PBS.

[0201] The spy-spycatcher covalent reaction works as follows: lysine on the spycathcer protein, with the assistance of Glu at a nearby site, attacks Asp on the spy tag, thereby forming a covalent bond.

[0202] Take AAV after the reaction is completed spy / 10E8The samples were electrophoresed by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions and then transferred to a 0.45 μM PVDF membrane (Millipore). Blocked with 5% skim milk at room temperature for 1 hour. Subsequently, incubated with rabbit polyclonal anti-AAV2VP1 / VP2 / VP3 antibodies at 4°C overnight. The membrane was washed three times with TBST buffer and then incubated with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP) at room temperature for 1 hour at 80 rpm. After washing the membrane three times, imaging analysis was performed in a high-sensitivity chemiluminescence gel imaging analysis system (ChemiDoc XRS System, Bio-rad). The coupling ratio was calculated by grayscale analysis using ImageJ software and then quantified.

[0203] The experimental results are shown in Figures 3A and 3B. The results show that the antibody can be successfully coupled to the AAV capsid surface through the spy-spycatcher covalent binding pair. Specifically, compared with the wild-type AAV2 capsid VP3 / VP2 / VP1 (60kDa / 67kDa / 82kDa), the coupling group showed three protein bands corresponding to 30kDa migration (corresponding to the molecular weight of 10E8-spycatcher), indicating that AAV was successfully coupled to the nanobody 10E8. At the same time, by calculating the coupling percentage = migration band grayscale / (migration + non-migration) band grayscale × 100%, it can be seen that when the 10E8-spycatcher concentration reaches a certain value, by regulating the concentration of the DBCO-spy peptide, different degrees of coupling modification of the nanoantibody can be effectively achieved, such as only about 15% unsaturated modification (unsaturated) and up to 75% or more saturated modification (saturated) state.

[0204] 4.2 Immunoelectron microscopy characterization of mutant AAV successfully conjugated to nanobodies

[0205] This example uses immunoelectron microscopy to characterize the successful coupling of mutant AAV2 to nanobodies.

[0206] Purified AAV2 N587+1 and N587+1 spy / 10E8The virus sample (prepared in 4.1 above) was added dropwise to a copper grid and incubated at room temperature for 20 minutes to allow the virus particles to adsorb to the copper grid. 1% BSA was then added dropwise and blocked at room temperature for 10 minutes. After washing three times with PBS, a rabbit monoclonal anti-DYKDDDDK (SEQ ID NO: 16) tag antibody (cat No. 14793, CST) was added and incubated at room temperature for 1 hour. The grid was then washed twice with PBS, followed by the addition of a goat anti-rabbit secondary antibody conjugated to 10 nm gold particles (G3779, Sigma) and incubated at room temperature for 30 minutes. After washing six times with PBS, 2% uranyl acetate was added and negatively stained for 1 minute. The sample was then air-dried and observed using a transmission electron microscope (JEM1400PLUS, Leica).

[0207] The experimental results are shown in Figure 3C. The results showed that AAV particles with successful negative staining were observed in both groups, with a spherical shape of about 20-30 nm in diameter. spy / 10E8 In the experimental group, gold nanoparticles were observed to be immunoadsorbed around AAV virus particles, demonstrating that the spy-spycatcher strategy effectively couples antibodies to the virus surface. The overall connection relationship is as follows: antibody-spycatcher—spy peptide—DBCO—capsid protein.

[0208] Example 5: Immunofluorescence experiments characterizing AAV-antibody conjugation and cellular retargeting

[0209] 5.1 Immunofluorescence characterization of AAV-antibody conjugates

[0210] This example uses immunofluorescence experiments to characterize the successful coupling of AAV and antibodies and to test cell-level retargeting.

[0211] N587+1 spy / 10E8 As an example, A431 cells were collected at 1×10 5 After 24 hours, the purified AAV2WT, WT+10E8, N587+1 and N587+1 spy / 10E8The virus solution was added dropwise to a confocal microplate and incubated at 4°C for 1 hour. After the virus bound to the cell membrane surface, unbound virus was washed with PBS. The cells were then fixed with 4% paraformaldehyde for 20 minutes at room temperature and permeabilized with PBST (PBS + 0.5% Triton) for 20 minutes. The cells were then washed twice with PBS and blocked with 5% goat serum for 1 hour at room temperature. After washing three times with PBST, the cells were added with a 1:80 dilution of the mouse monoclonal anti-AAV complete virus particle A20 antibody (03-61055, ARP) and a 1:100 dilution of the rabbit monoclonal anti-DYKDDDDK (SEQ ID NO: 16) antibody and incubated overnight at 4°C. After three washes with PBST, fluorescent secondary antibodies (goat anti-mouse antibody conjugated with Alexa 488 and goat anti-rabbit antibody conjugated with Alexa 555 (CST)) were added at 1:500 dilution and incubated at room temperature in the dark for 1 hour. After three washes with PBST, the cells were incubated with DAPI at 1:1000 for 15 minutes. After washing three times with PBST, the cells were observed using a super-resolution laser confocal microscope (Zeiss LSM880).

[0212] The results are shown in Figure 4A. The results showed that both wild-type AAV groups could be effectively adsorbed to the cell membrane surface and recognized by the A20 antibody (green), and after ultrafiltration of the mixed 10E8-spycatcher nanoantibody, the virus surface could not be coupled to the nanoantibody, so the nanoantibody was not observed on the cell membrane surface (red). For N587+1, the uncoupled group could not be effectively adsorbed to the cell surface, so it could not be recognized by the A20 antibody, and thus the complete virus particles could not be detected (no green). For N587+1 spy / 10E8 In terms of the virus, it can effectively detect the virus adsorbed on the cell surface (green), and the nanobody is also on the cell membrane (red), and the two show obvious co-localization (merge, yellow). This shows that the nanobody 10E8 is successfully coupled to the surface of the virus particle N587+1 and can achieve good re-targeting effect.

[0213] 5.2 Detection of AAV-Nanoantibody Cell-Level Retargeting Infection Activity

[0214] This example evaluates the retargeting ability of the AAV-spy platform by detecting the infection activity of AAV-nanoantibodies on target cells.

[0215] After preliminary screening, AAV2 mutants: S264+1 / D327 / N587+1 can block the initial infection activity to varying degrees. Subsequently, these three mutant AAVs expressing luciferase were coupled to the nanobody 10E8 through the spy-spycatcher platform. Referring to the experimental steps for measuring viral infection activity, A431 cells were inoculated with 1×10 4The cells were plated at a density of 1000 / well in a 96-well black plate. Virus particles of S264+1 / D327 / N587+1 without or with nanobodies were added to the cells at an MOI of 10K, and the expression of luciferase was measured 48 hours after infection.

[0216] The experimental results are shown in Figure 4B. The results showed that the S264+1 and D327 mutants could not effectively increase the cell infection activity after being coupled with nanoantibodies. On the contrary, for the D327 mutant AAV, the infection activity decreased significantly. It is possible that there is a steric hindrance between the coupling of nanoantibodies at this site and the entry of AAV into the cell. For the N587+1 mutant, coupling with nanoantibody 10E8 can significantly increase its infection activity by nearly 2 orders of magnitude. Based on this, N587+1 was selected as the core vector for the construction of the AAV-spy platform.

[0217] On the other hand, the GFP-expressing N587+1 virus was conjugated to the nanobody 10E8 and used to infect A431 cells. After 48 hours, the cells were observed and photographed under a fluorescence microscope. Subsequent quantitative analysis using Image J revealed (Figures 4C and 4D) that the AAV-spy platform was still able to effectively achieve retargeting, indicating that the achievement of AAV-spy retargeting is independent of the target gene delivered by AAV.

[0218] Subsequently, the AAV-spy retargeting platform strategy was further verified. The expressed and purified HB21-spycatcher, 2RS-spycatcher and 5F7-spycatcher were coupled to N587+1 virus particles using the same strategy, and then the corresponding target cells U87 (TfR high expression) and SKBr3 (HER2 high expression) were infected. After 48 hours, the expression of luciferase was measured to characterize the cell infection activity. The experimental results are shown in Figures 4E to 4F. The results showed that whether it is a single-chain antibody targeting TfR or a nanobody targeting HER2, it can be coupled to N587+1 virus particles using the AAV-spy platform strategy, which can restore the infection activity to about 70% of the wild type. At the same time, from the experimental results of N587+1spy / 2RS and N587+1spy / 5F7, it can be seen that the retargeting effect is positively correlated with the affinity of the coupled nanoantibody to the receptor, which further enriches the AAV-spy retargeting platform.

[0219] Example 6: Linker Optimization of AAV-spy Retargeting Platform

[0220] During the process of AAV infecting cells to express target proteins, the endosomal-lysosomal and proteasomal degradation steps are key limiting factors in its transduction efficiency. Ultimately, only about 1 / 4 of AAV successfully enters the cell nucleus and completes the uncoating step. Therefore, this example increases the lysosomal escape rate of the AAV-spy retargeting platform by adding a Val-Cit dipeptide (Valine-Citrulline, abbreviated as VC) linker, which is cleavable in lysosomes, to the DBCO-spy linker, thereby improving its transduction efficiency.

[0221] 6.1 VC-spy linker can successfully achieve site-specific conjugation of AAV-NAEK to nanoantibodies

[0222] This experiment verified by western blot that the mutant AAV2 could be coupled to the nanobody via the DBCO-VC-spy linker. The amino acid sequence of VC-spy is shown as AHIVMVDAYKPTKGGGGVXK (SEQ ID NO: 19), where X represents citrulline (Cit).

[0223] The mutant AAV2 has been inserted with the non-natural amino acid NAEK with an azide group by gene codon insertion technology. 8 Copies of mutant AAV2 (20 mutant AAV2s prepared in Example 1, here taking N587+1 mutant AAV2 as an example) were coupled with DBCO-VC-spy through a click reaction of an azide group. The reactants were N587+1 mutant AAV2, different concentrations of DBCO-VC-spy, and a reaction system of PBS buffer. The reaction conditions were shaking at 4°C overnight, 60rpm. After the reaction, ultrafiltration was performed through a 100KDa ultrafiltration tube to remove impurities. The ultrafiltration conditions were 4000rpm, 4°C, 30min / time, and a total of 4 ultrafiltrations. Then, different concentrations (5μM and 100μM) of antibody-spycatcher (the spycatcher at the C-terminus participated in the reaction, taking 10E8-spycatcher as an example) were added and reacted in a 25°C water bath for 1h. After the reaction, 100KDa ultrafiltration was used to remove impurities, and the buffer system was replaced with PBS.

[0224] Take AAV after the reaction is completed vcspy / 10E8 Western blotting was performed on the samples in the same manner as in Example 4.1.

[0225] The experimental results are shown in Figure 5A. The results showed that the nanobody was successfully coupled to the AAV capsid surface (named N587+1vcspy / 10E8) through the DBCO-VC-spy covalent binding pair. Specifically, compared with the capsid VP3 / VP2 / VP1 (60kDa / 67kDa / 82kDa) of the uncoupled group AAV2, the coupled group mainly showed a protein band with a migration amount of VP3 at 30kDa (corresponding to the molecular weight of vcspy-spycather-10E8), indicating that AAV was successfully coupled to the nanobody 10E8. At the same time, by regulating the concentration of DBCO-vcspy, different degrees of coupling modification of nanoantibodies can be effectively achieved.

[0226] 6.2 Verification of AAV-vcspy-nanobody cellular retargeting function

[0227] In this example, we tested whether the infection activity of N587+1vcspy / 10E8 on target cells was better than that of N587+1 spy / 10E8 improve.

[0228] After preliminary screening, still taking the N587+1 mutant as an example, referring to the previous experimental steps for testing viral infection activity, A431 cells were inoculated at 1×10 4 The density of cells / well was plated in a 96-well black plate. spy / 10E8 The virus particles of N587+1vcspy / 10E8 were added to the cells at an MOI of 10K, and the expression level of luciferase was measured 48 hours after infection.

[0229] The experimental results are shown in Figure 5B. They show that for the N587+1 mutant, conjugation with the nanobody 10E8 significantly increased its infectivity by nearly two orders of magnitude. Furthermore, conjugation with the vcspy linker further increased its infectivity by approximately fourfold.

[0230] Example 7: Detection of AAV-Nanobody Retargeting Function at the Animal Level

[0231] This example uses small animal imaging to test the feasibility of the AAV-vcspy retargeting platform strategy at the animal level.

[0232] Balb / C nude mice (6-8 weeks old) were subcutaneously implanted with A431 cells (1×10 cells per animal) in the right flank. 5 When the tumor reaches 100 mm 3 When the size of the mouse was 100 μg / mL, the mice were injected intratumorally with luciferase-expressing N587+1 or N587+1vcspy / 10E8 (2×10 10Animal imaging was performed on days 5, 7, and 10 after injection. Mice were intraperitoneally injected with 100 μl of luciferase substrate (Promega) and imaged 10 minutes later using an IVIS SPECTRUM small animal in vivo imager (PerkinElmer).

[0233] The results are shown in FIG6A and FIG6B .

[0234] The experimental results show that compared to the control group, N587+1vcspy / 10E8 significantly enhanced tumor cell targeting, with expression levels increasing by approximately an order of magnitude and slightly increasing over time. This demonstrates that the application of the AAV-vcspy strategy platform can effectively achieve tumor-specific gene delivery in vivo.

[0235] Example 8: Functional Application of AAV-vcspy Retargeting Platform

[0236] Herpes simplex virus thymidine kinase / ganciclovir (HSV-tk / GCV) is currently the most commonly used and effective method of suicide gene therapy. The expression of the suicide gene HSV-tk (tk for short) produces thymidine kinase, which can monophosphorylate the prodrug GCV, converting the non-toxic GCV into the toxic GCV triphosphate, a deoxyguanosine triphosphate analog. This inhibits DNA polymerase, disrupting DNA synthesis and inducing apoptosis in host cells. In addition to inducing apoptosis, it also triggers a bystander effect, whereby toxic metabolites produced by cells expressing the tk gene are transferred to neighboring cells, leading to cell death.

[0237] In this example, N587+1vcspy / 10E8 was used to deliver the suicide gene tk into tumor cells, and then GCV was administered systemically (intraperitoneal injection, 100 mg / kg) to achieve tumor treatment and expand the functional application of the AAV-vcspy retargeting platform.

[0238] 8.1 N587+1vcspy / 10E8-tk can effectively reduce the IC of the prodrug GCV 50

[0239] A431 cells were cultured at 1×10 4Cells were plated at 100 μg / well in a 96-well plate and infected with either N587+1-tk or N587+1vcspy / 10E8-tk (when packaging the N587+1 mutant AAV, the main plasmid pAAV-luc was replaced with pAAV-tk, allowing tk to be used as the target gene for AAV delivery) at an MOI of 20K. After 2 hours, the cells were replaced with fresh medium containing a gradient of GCV concentrations (0-100 μg / ml) (0 μg / ml, 0.1 μg / ml, 1 μg / ml, 10 μg / ml, 100 μg / ml). After 48 hours, cell viability was assessed using a cell titer glo kit (Promega).

[0240] The results are shown in Figure 7A. The results showed that only when N587+1-tk was coupled with 10E8 nanoantibody through vcspy-spycatcher could it effectively inhibit cell viability and enable GCV to work at low concentrations, successfully reducing the IC of GCV to 50 The delivery efficiency was reduced to around 10 μg / ml, approaching that of wild-type AAV expressing Tk. This means that the AAV-vcspy retargeting platform can effectively enable the N587+1 virus to specifically infect tumor cells, deliver the Tk gene, and, in combination with the prodrug GCV, inhibit tumor cell viability.

[0241] 8.2 N587+1vcspy / 10E8-tk can effectively promote tumor cell apoptosis

[0242] A431 cells were cultured at 3 × 10 4 Cells were plated in 24-well plates and infected with either WT-tk or N587+1vcspy / 10E8-tk at an MOI of 20K. After 2 hours, the cells were replaced with fresh medium containing or without GCV (100 μg / ml). 48 hours later, apoptosis was assessed by flow cytometry. The cell supernatant was collected and the cells were simultaneously digested with EDTA-free trypsin. After neutralization, the cells were centrifuged together with the supernatant to collect the cell pellet. The cell pellet was resuspended in PBS and centrifuged at 400 g for 3 minutes at 4°C. The pellet was then resuspended in 100 μl of the buffer from the APC Annexin V Apoptosis Detection Kit (640932, Biolegend), and 5 μl of Annexin V-APC antibody and 10 μl of PI were added. After incubation in the dark for 15 minutes, 400 μl of buffer was added and the cells were immediately analyzed.

[0243] The experimental results are shown in Figure 7B. The results showed that PI- / Annexin V+ single positivity indicated early apoptosis, while PI+ / Annexin V+ double positivity indicated late apoptosis. In the N587+1vcspy / 10E8-tk group, effective tk gene delivery was only possible after the addition of GCV, and the proportions of both early and late apoptotic cells increased significantly. This suggests that the AAV-vcspy retargeting platform can effectively enable the N587+1 virus to specifically infect tumor cells, deliver the suicide gene tk knockout, phosphorylate the prodrug GCV, and induce tumor cell apoptosis, providing a novel retargeted AAV platform for targeted gene therapy of tumors.

[0244] 8.3 N587+1vcspy / 10E8-tk can effectively inhibit tumor growth and exert therapeutic effects in vivo

[0245] A431 cells were cultured at 1.5 × 10 6 Each mouse was inoculated in the right armpit of Balb / C nude mice. 3 When 2×10 10 PBS, N587+1-tk, or N587+1vcspy / 10E8-tk were injected peritumorally at a dose of 100 copies / mouse. Two days later, mice were intraperitoneally injected with GCV at a dose of 100 mg / kg for 5 consecutive days, and tumor size was observed and measured daily.

[0246] The results are shown in Figure 7C. The results showed that only the N587+1vcspy / 10E8-tk group could effectively inhibit tumor growth after the addition of GCV. This indicates that the AAV-vcspy retargeting platform can effectively enable the N587+1 virus to specifically infect tumor cells, deliver the suicide gene tk knockout, phosphorylate the prodrug GCV, specifically kill tumor tissue, and slow tumor growth, providing a new retargeted AAV platform for targeted gene therapy of tumors.

[0247] Example 9: Upgrading and Optimizing the AAV-spy Retargeting Platform to AAV-PEG-nanobody

[0248] Since the spy-spycatcher protein covalent coupling pair was introduced into the AAV-spy retargeting platform, considering that its possible immunogenicity is not conducive to the systemic administration of AAV, the coupling mode of AAV and nanobody was further optimized and modified. Another non-natural amino acid with tetrazine (Formula II) was inserted into the nanobody, and then DBCO-PEG was used to bind the nanobody. (n)The bifunctional linker, α-TCO (n can be selected from a positive integer between 4 and 20, and n is 4 in this experiment), is coupled to the AAV site-specifically inserted into NAEK, thereby enhancing the practicality and flexibility of the AAV retargeting platform and reducing its immunogenicity.

[0249] 9.1 Site Screening, Expression, and Purification of Tetrazine-Inserted Nanobodies

[0250] (1) This example uses the EGFR-targeting Nanobody 10E8 as an example. The modification methods and conditions for other Nanobodies or single-chain antibodies are the same or similar. Mutation sites are selected in the structurally conserved region of the 10E8 protein (SEQ ID NO: 1), as shown in Table 1 below, where the amino acid positions are those in SEQ ID NO: 1.

[0251] Table 1: Mutation sites

[0252] (2) Expression of site-directed mutant proteins containing the unnatural amino acid tetrazine

[0253] The synthesized nucleic acid sequence containing the codon substitution was linked to a His-tag encoding nucleic acid sequence and cloned into the pET-21a(+) (Addgene: #69740-3) Escherichia coli plasmid expression vector. This vector was co-transfected with the pUltra-MfpylRS plasmid into the TransB(DE3) strain (purchased from Quanshijin, catalog number: CD811-02). The pUltra-MfpylRS plasmid encodes an amber codon suppressor tRNA and a tetrazine aminoacyl-tRNA synthetase. Co-transfection with a nucleic acid sequence containing a TAG codon allows for the introduction of the unnatural amino acid tetrazine at a specific site. The transformed strain was inoculated into 2 ml of LB medium containing 100 μg / ml ampicillin and 100 μg / ml spectinomycin and cultured at 37°C and 220 rpm. The overnight culture was diluted to an optical density in 2×YT medium and incubated at 37°C until the A600 nm reached approximately 1.5. UAA (tetrazine, synthesized in the laboratory) was added to a final concentration of 1 mM, and protein expression was induced by adding isopropyl β-d-thiogalactopyranoside (IPTG) to a final concentration of 0.5 mM. After half an hour, the temperature was lowered to 20°C. After approximately 18 hours of expression, the cells were harvested by centrifugation and resuspended in His-Bind buffer (20 mM phosphate, pH 8.0, 500 mM NaCl, 20 mM imidazole). Protein was extracted by passing the cells through a micofluidizer twice under cooling conditions at 1200 bar. The cells were then centrifuged at 20,000 g for 20 minutes, the supernatant was collected and frozen at -80°C until further processing. Site-directed mutant 10E8 proteins in which positions Q82 or N84 were replaced with non-natural amino acids were thus obtained. To further purify the protein, cation exchange chromatography (Resource S, GE Healthcare) was used to further remove contaminants. The main elution peak was collected using a 3 KDa centrifugal filter Unit (Millipore), concentrated, and the buffer was exchanged into PBS.

[0254] 9.2 Conjugation and Validation of Tetrazine-Carrying Nanobodies to AAV-NAEK

[0255] This experiment verified through western blot that the mutant AAV2 can be coupled to the nanobody through the DBCO-PEG4-TCO linker (the structural formula is shown in Formula II below).

[0256] First, consider the unnatural amino acid 10E8-Q82, which has been modified with a tetrazine group through genetic codon insertion. 200 μl of 50 μM protein was added to a DBCO-PEG4-TCO linker at a final concentration of 400 μM and allowed to react overnight at 4°C. After completion of the reaction, the protein was ultrafiltered through a 100 kDa ultrafiltration tube at 4000 rpm, 4°C, and 30 min per filter for a total of four cycles. The protein was then quantified using BCA.

[0257] The mutant AAV2 has been inserted with the non-natural amino acid NAEK with an azide group by gene codon insertion technology. 8 Copies of mutant AAV2 (20 mutant AAV2s prepared in Example 1, with the N587+1 mutant AAV2 used as an example) were coupled to 10E8-Q82-DBCO via an azide click reaction at 4°C overnight. The reactants were the N587+1 mutant AAV2 and different concentrations of 10E8-Q82-DBCO in PBS buffer. The reaction was shaken overnight at 4°C at 60 rpm. After the reaction, the cells were ultrafiltered through a 100 kDa ultrafiltration tube at 4000 rpm, 4°C, and 30 min / pass, for a total of four ultrafiltration cycles.

[0258] Take AAV after the reaction is completed 10E8Q82 The samples were electrophoresed by 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions and then transferred to a 0.45 μM PVDF membrane (Millipore). Blocked with 5% skim milk at room temperature for 1 hour. Subsequently, incubated with rabbit polyclonal anti-AAV2VP1 / VP2 / VP3 antibodies at 4°C overnight. The membrane was washed three times with TBST buffer and then incubated with a goat anti-rabbit secondary antibody conjugated to horseradish peroxidase (HRP) at room temperature for 1 hour at 80 rpm. After washing the membrane three times, imaging analysis was performed in a high-sensitivity chemiluminescence gel imaging analysis system (ChemiDoc XRS System, Bio-rad). The coupling ratio was calculated by grayscale analysis using ImageJ software and then quantified.

[0259] The experimental results are shown in Figure 8A. The results show that the antibody can be successfully coupled to the surface of AAV capsid (named N587+1) through the DBCO-PEG4-TCO covalent binding pair. 10E8Q82Specifically, compared to the unconjugated AAV2 capsid VP3 / VP2 / VP1 (60kDa / 67kDa / 82kDa), the conjugated group mainly showed a VP3 protein band with a migration distance of 15kDa (corresponding to the molecular weight of 10E8-Q82), indicating that AAV was successfully conjugated to the nanobody 10E8. At the same time, by adjusting the concentration of 10E8-Q82-DBCO, different degrees of conjugation modification of the nanobody can be effectively achieved.

[0260] 9.3 Verification of AAV-PEG-nanobody Cell-Level Retargeting Function

[0261] In this example, AAV-nanobody (N587+1 prepared in 9.2 above) was detected. 10E8Q82 ) on target cells to evaluate the retargeting ability of the AAV-PEG-nanobody platform.

[0262] After preliminary screening, still taking the N587+1 mutant as an example, referring to the previous experimental steps for testing viral infection activity, A431 cells were inoculated at 1×10 4 The cells were plated at a density of 1000 / well in a 96-well black plate. Virus particles of N587+1 without or with different concentrations of nanoantibodies were added to the cells at an MOI of 10K, and the expression of luciferase was measured 48 hours after infection.

[0263] The experimental results are shown in Figure 8B. The results show that for the N587+1 mutant, conjugation with the nanobody 10E8 significantly increased its infectious activity by nearly two orders of magnitude. Furthermore, as the degree of conjugation increased, its infectious activity initially increased and then decreased, consistent with the aforementioned AAV-spy platform modification pattern, which indicates that oversaturated AAV capsid surface modification is associated with a lysosomal escape risk.

[0264] Although specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and substitutions may be made to those details in light of all the teachings disclosed herein, and such modifications are within the scope of the present invention. The full scope of the present invention is given by the appended claims and any equivalents thereof.

Claims

1. A capsid protein-antibody conjugate, wherein the capsid protein is inserted with a non-natural amino acid, and the non-natural amino acid is connected to a target head molecule; Preferably, the targeting head molecule is an antibody.

2. The capsid protein-antibody conjugate according to claim 1, wherein The capsid protein is a capsid protein of an adeno-associated virus, for example, one or more selected from VP1 protein, VP2 protein and VP3 protein.

3. The capsid protein-antibody conjugate according to any one of claims 1 to 2, wherein: The number of the unnatural amino acids is one or more, for example, 1-60.

4. The capsid protein-antibody conjugate according to any one of claims 1 to 3, wherein: The non-natural amino acid is a non-natural amino acid with an azide group, preferably NAEK.

5. The capsid protein-antibody conjugate according to any one of claims 1 to 4, wherein: Insertion of unnatural amino acids causes the virus to lose at least 80% or at least 90% of its ability to infect cells; Preferably, the ability to infect cells is completely or substantially lost; Preferably, the cells are A431 cells.

6. The capsid protein-antibody conjugate according to any one of claims 1 to 5, wherein: The insertion position of the non-natural amino acid is S264+1, D327 or N587+1.

7. The capsid protein-antibody conjugate according to any one of claims 1 to 6, wherein: The antibody is a nanobody or a single-chain antibody; Preferably, the antibody is an anti-tumor antibody; Preferably, the antibody is a nanobody or a single-chain antibody targeting a target selected from the following: EGFR, HER2, TfR, PD-1, PD-L1, CTLA-4 and VEGFR; Preferably, the amino acids of the antibody are as shown in any one of SEQ ID NO: 1 to SEQ ID NO:

4.

8. The capsid protein-antibody conjugate according to any one of claims 1 to 7, wherein: The antibody is linked to the unnatural amino acid directly, or through a coupling pair or a bifunctional linker.

9. The capsid protein-antibody conjugate according to claim 8, wherein The coupling pair is selected from: Spycatcher and DBCO-spy peptide, Spycatcher and DBCO-VC-spy peptide, Biotin-DBCO and mono Streptavidin, Vidal-N-DBCO and Vidal-C; wherein DBCO is connected by reacting with the N3 group on the non-natural amino acid.

10. A capsid protein-antibody conjugate, wherein the capsid protein is inserted with an unnatural amino acid NAEK, and an antibody is linked to the unnatural amino acid, wherein: The capsid protein is the capsid protein of adeno-associated virus; The unnatural amino acid is NAEK, and the insertion position is S264+1, D327 or N587+1; The antibody is a nanobody or a single-chain antibody, and the antibody targets a target selected from the following: EGFR, HER2, TfR, PD-1, PD-L1, CTLA-4 and VEGFR; The antibody and the non-natural amino acid are connected via a coupling pair or a bifunctional linker; Preferably, the amino acids of the antibody are as shown in any one of SEQ ID NO: 1 to SEQ ID NO:

4.

11. The capsid protein-antibody conjugate according to any one of claims 8 to 10, wherein: The coupling pair is Spycatcher and DBCO-spy peptide, wherein DBCO is connected by reacting with the N3 group on NAEK; Preferably, the amino acid sequence of Spycatcher is as shown in SEQ ID NO: 5; and / or the amino acid sequence of spy peptide is as shown in SEQ ID NO: 17; Preferably, the antibody is directly connected to the Spycatcher or connected through a linker; preferably, the amino acid sequence of the linker is shown in SEQ ID NO:

15.

12. The capsid protein-antibody conjugate according to any one of claims 8 to 10, wherein: The coupling pair is Spycatcher and DBCO-VC-spy peptide, wherein DBCO is connected by reacting with the N3 group on NAEK; Preferably, the amino acid sequence of Spycatcher is shown in SEQ ID NO: 5; and / or the amino acid sequence of DBCO-VC-spy peptide is shown in SEQ ID NO: 19; Preferably, the antibody is directly connected to the Spycatcher or connected through a linker; preferably, the amino acid sequence of the linker is shown in SEQ ID NO:

15.

13. The capsid protein-antibody conjugate according to any one of claims 8 to 10, wherein: The bifunctional linker is DBCO-PEG (n) -TCO, wherein n is a positive integer selected from 4 to 20, preferably n is 4; and One or more amino acids in the antibody are substituted with a non-natural amino acid containing a tetrazine group; preferably, glutamine at position 82 and / or asparagine at position 84 of the antibody shown in SEQ ID NO: 1 are substituted with a non-natural amino acid containing a tetrazine group; Preferably, the non-natural amino acid containing a tetrazine group is represented by the following formula II:

14. A modified virus comprising the capsid protein-antibody conjugate according to any one of claims 1 to 13.

15. The modified virus according to claim 14, comprising an expression plasmid; preferably, the expression plasmid comprises a multiple cloning site or is inserted with a target gene; Preferably, the target gene is the herpes simplex virus thymidine kinase gene or a reporter gene.

16. The modified virus according to any one of claims 14 to 15, comprising: pAAV-MCS plasmid, pAAV-RC plasmid and pHelper plasmid, among which, The pAAV-RC plasmid contains the following mutation sites: The codons corresponding to S264+1, D327, or N587+1 were mutated to the stop codon TAG.

17. The modified virus according to any one of claims 14 to 16, which carries a target gene; preferably, the target gene is the herpes simplex virus thymidine kinase gene or a reporter gene.

18. A pharmaceutical combination comprising an effective amount of the capsid protein-antibody conjugate according to any one of claims 1 to 13 or the modified virus according to any one of claims 14 to 17, and an effective amount of ganciclovir; The pharmaceutical combination is a fixed combination, for example in the form of a solid pharmaceutical composition or a liquid pharmaceutical composition; or The drug combination is a non-fixed combination, for example, the capsid protein-antibody conjugate or the modified virus and ganciclovir are each in the form of a pharmaceutical composition.

19. A method for preparing a targeted drug, comprising the step of loading a target gene into the modified virus according to any one of claims 14 to 17; Preferably, the targeted drug is a drug for treating or preventing tumors; Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma; Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting diseased tissue; Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

20. Use of the capsid protein-antibody conjugate according to any one of claims 1 to 13 or the modified virus according to any one of claims 14 to 17 in the preparation of targeted drugs; Preferably, the targeted drug is a drug for treating or preventing tumors; Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma; Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting diseased tissue; Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

21. The capsid protein-antibody conjugate according to any one of claims 1 to 13 or the modified virus according to any one of claims 14 to 17, for use in the preparation of targeted drugs; Preferably, the targeted drug is a drug for treating or preventing tumors; Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma; Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting diseased tissue; Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

22. A method for treating or preventing a disease using a targeted drug, comprising the step of administering an effective amount of the targeted drug to a subject in need thereof, wherein: The targeted drug uses the modified virus according to any one of claims 14 to 17 loaded with the target gene as an active ingredient; Preferably, the targeted drug is a drug for treating or preventing tumors; Preferably, the tumor is one or more selected from mesothelioma, breast cancer, sarcoma, lung cancer, liver cancer, head and neck squamous cell carcinoma, ovarian cancer, gastric cancer, renal cell carcinoma, colon cancer, rectal cancer, melanoma, prostate cancer, bladder cancer, leukemia, cervical cancer, endometrial cancer, lymphoma and nasopharyngeal carcinoma; Preferably, the tumor is a tumor that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting tumor tissue; preferably, the tumor tissue is a tumor tissue that highly expresses EGFR, HER2 or TfR; Preferably, the targeted drug is a drug targeting diseased tissue; Preferably, the targeted drug is a drug targeting nerves, muscles, lungs, eyes or ears.

Images