Methods and compositions for selective modulation of protein expression

Abstract

The present invention provides novel recombinant DNA, compositions and methods for selectively regulating expression of transcribable polynucleotides or recombinant proteins in transgenic plant pollen. The invention also provides transgenic plants, plant cells, plant parts, seeds and commercial products comprising such recombinant DNA polynucleotides and compositions.

Description

[0001] Citation of Related Applications

[0002] This application claims the benefit of U.S. Provisional Application No. 63 / 375,681, filed on September 14, 2022, which is incorporated herein by reference in its entirety.

[0003] Incorporation of Sequence Listing

[0004] The file named "MONS537WO_ST26.xml" containing the sequence listing in computer readable form was created on August 17, 2023. This file is 9,811 bytes (in MS- ), filed simultaneously by electronic filing (using the U.S. Patent Office Patent Center), and incorporated by reference in its entirety. Technical Field

[0005] The present invention relates to the field of plant molecular biology and plant genetic engineering. More specifically, the present invention relates to methods and compositions for selectively regulating protein expression in male reproductive tissues of transgenic plants. Background Art

[0006] Male tissue-specific small interfering RNA (mts-siRNA) is an siRNA that selectively reduces the expression of messenger RNA (mRNA) in male tissues by directing the ability of sequence-dependent endonucleoside cleavage of mRNA. Mts-siRNA target element (mts-siRNA_TE) is a sequence that, when operably linked to a transcribable DNA polynucleotide, reduces the expression of transgenic mRNA by sequence-dependent endonucleoside cleavage of mRNA caused by hybridization of mts-siRNA complementary to the sequence in mts-siRNA_TE, thereby reducing the protein expressed in male tissues. Summary of the invention

[0007] Several embodiments relate to male tissue-specific small interfering RNA target elements or mts-siRNA target elements (mts-siRNA_TE). Also provided are recombinant DNA polynucleotides comprising mts-siRNA target elements. In some embodiments, transgenic plant cells, plants and seeds comprising mts-siRNA target elements are provided. In one embodiment, the mts-siRNA target element is operably connected to a transcribable DNA polynucleotide. In certain embodiments, the transcribable DNA polynucleotide can be heterologous relative to the mts-siRNA target element. Therefore, in a specific embodiment, the mts-siRNA target element sequence can be defined as being operably connected to a heterologous transcribable DNA polynucleotide. Several embodiments relate to using mts-siRNA target elements and preparing and using recombinant DNA polynucleotides comprising mts-siRNA target elements and comprising transgenic plant cells, plants and seeds of mts-siRNA target elements operably connected to transcribable DNA polynucleotides.

[0008] Thus, in one aspect, the present invention provides a recombinant DNA polynucleotide comprising an mts-siRNA target element, the mts-siRNA target element comprising a DNA sequence selected from the group consisting of: (a) a sequence having at least 90% sequence identity to SEQ ID NO: 1; and (b) a sequence comprising SEQ ID NO: 1; wherein the mts-siRNA target element is operably linked to a heterologous transcribable DNA polynucleotide. "Heterologous transcribable DNA polynucleotide" refers to a transcribable DNA polynucleotide that is heterologous relative to the polynucleotide sequence to which it is operably linked. In a specific embodiment, the recombinant DNA polynucleotide comprises an mts-siRNA target element sequence that has at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the DNA sequence of SEQ ID NO: 1. In some embodiments, the recombinant DNA polynucleotide comprises an mts-siRNA target element sequence comprising SEQ ID NO: 1 or a fragment thereof capable of binding to mts-siRNA.

[0009] In some embodiments, the heterologous transcribable DNA polynucleotide comprises a gene of agronomic value. In one embodiment, the gene of agronomic value confers resistance to plant pests. In another embodiment, the gene of agronomic value confers tolerance to plants using herbicides.

[0010] Several embodiments described herein relate to a transgenic plant cell comprising an mts-siRNA target element comprising a DNA sequence selected from the group consisting of: (a) a sequence having at least 90% sequence identity to SEQ ID NO: 1; and (b) a sequence comprising SEQ ID NO: 1; wherein the mts-siRNA target element is operably linked to a heterologous transcribable DNA polynucleotide. In certain embodiments, the transgenic plant cell is a corn plant cell.

[0011] In another aspect, the present invention also provides a transgenic plant or part thereof comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of: (a) a sequence having at least 90% sequence identity with SEQ ID NO: 1; and (b) a sequence comprising SEQ ID NO: 1; wherein the mts-siRNA target element is operably linked to a heterologous transcribable DNA polynucleotide. In a specific embodiment, the transgenic plant is a progeny plant of any generation comprising a recombinant DNA polynucleotide. A transgenic seed comprising a recombinant DNA polynucleotide is also provided, which produces such a transgenic plant when grown.

[0012] Several embodiments described herein relate to a method of producing a commercial product, comprising obtaining a transgenic plant or part thereof containing a recombinant DNA polynucleotide as described herein, and producing a commercial product therefrom. In one embodiment, the commercial product is selected from the group consisting of: seeds, processed seeds, protein concentrates, protein isolates, starch, grains, plant parts, seed oils, biomass, flour, and meal.

[0013] Several embodiments provide a method for producing a transgenic plant comprising a recombinant DNA polynucleotide comprising one or more mts-siRNA target elements as described herein, the method comprising transforming a plant cell with the recombinant DNA polynucleotide to produce a transformed plant cell and regenerating a transgenic plant from the transformed plant cell.

[0014] Several embodiments provide a method for reducing the expression of a transcribable DNA polynucleotide in male tissue of a plant, comprising: (a) operably linking an mts-siRNA target element to the transcribable DNA polynucleotide; and (b) transforming the plant with an expression cassette comprising the transcribable DNA polynucleotide operably linked to the mts-siRNA target element; wherein the mts-siRNA target element has at least about 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity with the DNA sequence of SEQ ID NO:1. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 is a schematic diagram showing an expression cassette consisting of a promoter and a leader sequence, the expression cassette being 5' operably linked to an intron, 5' operably linked to a gene of interest (GOI), 5' operably linked to an mts-siRNA target element, 5' operably linked to a 3'

[0016] UTR. Transcription of the expression cassette produces an mRNA that contains the mts-siRNA target element. A single strand of the double-stranded mts-siRNA can bind to a region within the mts-siRNA target element, thereby triggering sequence-dependent endonucleolytic cleavage of the mRNA.

[0017] Figure 2 is a graphical representation of the mts-siRNA expression levels of mts-siRNA_TE_2 (SEQ ID NOs: 3, 6, 2, 7, 5, 8 and 4) used to prepare Cy5-labeled probes for probing transcriptional profiling microarrays containing cDNA from specific tissues of maize variety LH244.

[0018] Sequence Description

[0019] SEQ ID NO: 1 is the DNA sequence of the recombinant chimeric mts-siRNA target element mts-siRNA_TE_2.

[0020] SEQ ID NO: 2 is the DNA sequence of male tissue-specific short interfering RNA (mts-siRNA), mts-siRNA_1.

[0021] SEQ ID NO:3 is the DNA sequence of mts-siRNA, mts-siRNA_2.

[0022] SEQ ID NO:4 is the DNA sequence of mts-siRNA, mts-siRNA_3.

[0023] SEQ ID NO:5 is the DNA sequence of mts-siRNA, mts-siRNA_4.

[0024] SEQ ID NO:6 is the DNA sequence of mts-siRNA, mts-siRNA_6.

[0025] SEQ ID NO:7 is the DNA sequence of mts-siRNA, mts-siRNA_7.

[0026] SEQ ID NO:8 is the DNA sequence of mts-siRNA, mts-siRNA_8. DETAILED DESCRIPTION

[0027] Several embodiments relate to recombinant DNA polynucleotides, compositions, methods and uses thereof for selectively regulating protein expression (e.g., expression of heterologous transcribable polynucleotides) in male reproductive tissues of transgenic plants. In some embodiments, a recombinant DNA polynucleotide is provided, comprising a male tissue-specific small interfering RNA target element (mts-siRNA_TE) operably linked to a heterologous transcribable polynucleotide. Such recombinant DNA polynucleotides can be used to selectively regulate the expression of heterologous transcribable polynucleotides in male reproductive tissues of transgenic plants. Nucleic acid sequences can be provided in the form of DNA or RNA as specified; as known to those of ordinary skill in the art, disclosing one sequence necessarily defines another sequence. In addition, as known to those of ordinary skill in the art, disclosing a given nucleic acid sequence necessarily defines and includes the complementary sequence of the sequence.

[0028] Small interfering RNA (siRNA) is a class of RNA molecules with a length of about 18-26 nucleotides (nt) (e.g., 18, 19, 20, 21, 22, 23, 24, 25 or 26 nt). The siRNA sequence can be represented by an RNA nucleotide sequence consisting of guanine (G), cytosine (C), adenine (A) and uracil (U), or by an equivalent DNA nucleotide sequence of guanine (G), cytosine (C), adenine (A) and thymine (T). siRNA plays a role in the RNA-induced silencing complex (RISC), triggering sequence-specific degradation of messenger RNA (mRNA), resulting in disruption of gene expression and downregulation of the protein encoded by the gene.

[0029] "Male tissue-specific siRNA" or "mts-siRNA" is an siRNA that is enriched or specifically expressed in the male reproductive tissues of a plant (e.g., male inflorescence or pollen) and thus has a male tissue-specific expression pattern. Male tissue-specific siRNAs have been identified in plants and can be detected using techniques known in the art (such as low molecular weight Northern analysis or transcriptome sequencing).

[0030] "Male tissue" or "male reproductive tissue" refers to the components of the male reproductive system of a plant. For example, the male tissue of a corn plant may include tassels, male inflorescences, and pollen.

[0031] The DNA sequence complementary to the mts-siRNA sequence is referred to herein as an "mts-siRNA target". An "mts-siRNA target element" comprises a plurality of sequences complementary to one or more mts-siRNA sequences. The mts-siRNA target element is contained in the DNA sequence of the target gene and is transcribed into the RNA sequence of the corresponding mRNA molecule. Then, a single strand of the double-stranded mts-siRNA molecule can bind or hybridize to the corresponding mts-siRNA target in the mRNA molecule under typical physiological conditions ( Figure 1 ). If the alignment of the two nucleic acid sequences produces a perfect match (no mismatches, i.e., complete complementarity), one mismatch, two mismatches, or three mismatches over the length of the mts-siRNA sequence, then the nucleic acid sequence is complementary to the mts-siRNA sequence. Complementary sequences can base pair with each other according to the standard Watson-Crick complementarity rules (e.g., guanine pairs with cytosine (G:C), and adenine pairs with thymine (A:T) or uracil (A:U)).

[0032] More than one mts-siRNA target can be gathered together, or even overlapped in a single DNA polynucleotide. The DNA polynucleotide comprising more than one mts-siRNA target is referred to herein as "mts-siRNA target element". The mts-siRNA target element comprises at least two or more mts-siRNA targets within a sequence window of 500 nucleotides. The mts-siRNA target element can be any length, such as about 30 nucleotides (nt), about 40nt, about 50nt, about 60nt, about 70nt, about 80nt, about 90nt, about 100nt, about 150nt, about 200nt, about 250nt, about 300nt, about 350nt, about 400nt, about 450nt or about 500nt. "mts-siRNA target sequence" is the nucleic acid sequence of the mts-siRNA target. "mts-siRNA target element sequence" is the nucleic acid sequence of the mts-siRNA target element. An example of an mts-siRNA target element sequence is provided herein as SEQ ID NO: 1.

[0033] Figure 1 The effect of operably linking the mts-siRNA target element to a transcribable DNA polynucleotide in an expression cassette for transforming plants is shown. The mts-siRNA target element in this diagram is operably linked to a transcribable DNA polynucleotide represented as "GOI" with 3', and operably linked to 3'UTR with 5'. When expressed in plants, the si-RNA (mts-siRNA) expressed only in the male tissues of the plant is complementary to the region of the mts-siRNA target element and combines with the target element in the resulting transcript. The double-stranded RNA segment of the resulting transcript now triggers sequence-dependent endonucleoside cleavage and degradation of the mRNA, thereby reducing expression in the male tissues (e.g., pollen and tassels) of corn plants.

[0034] As used herein, a "recombinant" DNA polynucleotide, polypeptide, protein, cell or organism may be non-naturally occurring, or artificially created using genetic engineering tools, and is therefore a product of human activity, and would not normally occur in nature. A "recombinant DNA polynucleotide" refers to a DNA polynucleotide comprising a DNA sequence or polynucleotide that would not naturally occur together without human intervention. For example, a recombinant DNA polynucleotide may be a DNA polynucleotide composed of at least two DNA polynucleotides that are heterologous to each other, a DNA polynucleotide comprising a DNA sequence that deviates from a DNA sequence that occurs in nature, or a DNA polynucleotide that has been incorporated into the DNA of a host cell by genetic transformation. In one embodiment, a recombinant DNA polynucleotide as described herein is a DNA polynucleotide comprising an mts-siRNA target element operably linked to at least one transcribable polynucleotide, for example, wherein the transcribable polynucleotide is heterologous to the mts-siRNA target element.

[0035] As used herein, the term "heterologous" refers to a combination of two or more DNA sequences, RNA sequences, amino acid sequences or protein domains, which combination does not usually exist in nature, or which combination is provided in an orientation or order different from that existing in nature. For example, the two DNA sequences may be derived from different species or artificially synthesized, and / or the two DNA sequences may be derived from different genes, for example, different genes from the same species or the same gene from different species. In one example, if such a combination does not usually exist in nature, for example, a transcribable polynucleotide sequence does not occur naturally and operably linked to a regulatory element or mts-siRNA target element, then the regulatory element or mts-siRNA target element is heterologous relative to the transcribable polynucleotide sequence that is operably linked. In one embodiment, such a heterologous combination may include an mts-siRNA target element, which may be plant-derived or chemically synthesized, and may be operably linked to a transcribable polynucleotide, such as a transgene encoding a protein that confers insect resistance. Furthermore, a particular sequence may be "heterologous" with respect to the cell or organism into which it is introduced (eg, a sequence that does not naturally occur in the particular cell or organism).

[0036] As used herein, the term "transcribable DNA polynucleotide" refers to any DNA polynucleotide that can be transcribed into an RNA polynucleotide, including but not limited to those having protein coding sequences, those encoding guide RNA (gRNA), and those producing RNA molecules (e.g., siRNA, miRNA, and dsRNA) having sequences that can be used for gene inhibition. The types of DNA polynucleotides may include but are not limited to DNA polynucleotides from the same plant, DNA polynucleotides from another plant, DNA polynucleotides from different organisms, or synthetic DNA polynucleotides (such as DNA polynucleotides containing antisense information of a gene) or DNA polynucleotides encoding artificial, synthetic, or otherwise modified forms of transgenics. Examples of transcribable DNA polynucleotides for incorporation into constructs as described herein include, for example, DNA polynucleotides or genes from species different from the species into which the DNA polynucleotide is incorporated, or genes derived from or present in the same species, but incorporated into recipient cells by genetic engineering methods rather than classical breeding techniques.

[0037] Transcribable DNA polynucleotide can comprise the gene with agronomic value.As used herein, term " gene with agronomic value " refers to the transcribable DNA polynucleotide that gives desired characteristic when expressed in specific plant tissue, cell or cell type.The product of the gene with agronomic value can play a role in plant, so that plant morphology, physiology, growth, development, yield, grain composition, nutritional status, disease or pest resistance and / or environment or chemical tolerance are affected, or can serve as the pesticide in the diet of the insect that feeds on plants.In one embodiment, regulatory element is incorporated into construct so that regulatory element is operably connected to transcribable DNA polynucleotide as the gene with agronomic value.In the transgenic plant containing this construct, the expression of the gene with agronomic value can give useful agronomic traits. Beneficial agronomic traits may include, for example, but not limited to, insect protection, herbicide tolerance, improved yield, disease resistance, pathogen resistance, improved plant growth and development, improved starch content, improved oil content, improved fatty acid content, improved protein content, improved fruit maturity, enhanced animal and human nutrition, biopolymer production, environmental stress resistance, pharmaceutical peptides, improved processing quality, improved flavor, hybrid seed production efficiency, improved fiber production, enhanced carbon sequestration and / or desired biofuel production. The mts-siRNA target element may be operably linked to a gene with agronomic value to reduce gene expression in less male tissues (such as tassels and pollen). In one embodiment, such a gene with agronomic value may include a transgene encoding a protein that confers insect resistance.

[0038] Examples of genes known in the art to have agronomic value include genes for herbicide resistance (U.S. Pat. Nos. 6,803,501; 6,448,476; 6,248,876; 6,225,114; 6,107,549; 5,866,775; 5,804,425; 5,633,435; and 5,463,175), increased yield (U.S. Pat. Nos. USRE38,446; 6,716 ,474; 6,663,906; 6,476,295; 6,441,277; 6,423,828; 6,399,330; 6,372,211; 6,235,971; 6,222,098; and 5,716,837), insect control (U.S. Pat. Nos. 6,809,078; 6,713,063; 6,686,452; 6,657,046; 6,645,497;

[0039] 6,642,030; 6,639,054; 6,620,988; 6,593,293; 6,555,655; 6,538,109;

[0040] 6,537,756; 6,521,442; 6,501,009; 6,468,523; 6,326,351; 6,313,378;

[0041] 6,284,949; 6,281,016; 6,248,536; 6,242,241; 6,221,649; 6,177,615;

[0042] 6,156,573; 6,153,814; 6,110,464; 6,093,695; 6,063,756; 6,063,597;

[0043] 6,023,013; 5,959,091; 5,942,664; 5,942,658; 5,880,275; 5,763,245; and 5,763,241), fungal disease resistance (U.S. Pat. Nos. 6,653,280; 6,573,361; 6,506,962; 6,316,407; 6,215,048; 5,516,671; 5,773,696; 6,121,436; 6,316,407; and 6,506,962), viral resistance (U.S. Pat. Nos. 6,617,496; 6,60 8,241; 6,015,940; 6,013,864; 5,850,023; and 5,304,730), nematode resistance (U.S. Pat. No. 6,228,992), bacterial disease resistance (U.S. Pat. No. 5,516,671), plant growth and development (U.S. Pat. Nos. 6,723,897 and 6,518,488), starch production (U.S. Pat. Nos. 6,538,181; 6,538,179; 6,538,178; 5,750,876; 6,476,295), improved oil production (U.S. Pat. Nos. 6,444,876; 6,518,488). , 426,447; and 6,380,462), high oil production (U.S. Pat. Nos. 6,495,739; 5,608,149; 6,483,008; and 6,476,295), improved fatty acid content (U.S. Pat. Nos. 6,828,475; 6,822,141; 6,770,465; 6,706,950; 6,660,849; 6,596,538; 6,589,767; 6,537,750; 6,489,461; and 6,459,018), high protein production (U.S. Pat. No. 6,380,466) , fruit ripening (U.S. Patent No. 5,512,466), enhanced animal and human nutrition (U.S. Patent Nos. 6,723,837; 6,653,530; 6,5412,59; 5,985,605; and 6,171,640), biopolymers (U.S. Patent Nos. USRE37,543; 6,228,623; and 5,958,745 and 6,946,588), environmental stress resistance (U.S. Patent No. 6,072,103), pharmaceutical peptides and secretable peptides (U.S. Patent Nos. 6,812,379; 6,774,283; 6,140,075;and 6,080,560), improved processing traits (U.S. Pat. No. 6,476,295), improved digestibility (U.S. Pat. No. 6,531,648), low raffinose (U.S. Pat. No. 6,166,292), industrial enzyme production (U.S. Pat. No. 5,543,576), improved flavor (U.S. Pat. No. 6,011,199), nitrogen fixation (U.S. Pat. No. 5,229,114), hybrid seed production (U.S. Pat. No. 5,689,041), fiber production (U.S. Pat. Nos. 6,576,818; 6,271,443; 5,981,834; and 5,869,720), and biofuel production (U.S. Pat. No. 5,998,700).

[0044] As used herein, the term "heterologous transcribable DNA polynucleotide" refers to a transcribable DNA polynucleotide that is heterologous to the mts-siRNA target element.

[0045] As used herein, the term "isolated" means to be separated from other elements that are usually associated with it in its natural state. For example, an isolated DNA polynucleotide is a DNA polynucleotide that exists alone or in combination with other compositions but is not in its natural genomic position or state. In one embodiment, the term "isolated" refers to the separation of a DNA polynucleotide from a nucleic acid that is usually flanked by a DNA polynucleotide in a natural state. For example, an isolated DNA polynucleotide can be a DNA polynucleotide composed of at least two DNA sequences that are heterologous to each other. In another example, an isolated DNA polynucleotide can be a DNA polynucleotide that is incorporated into a new genomic position in a host cell by genetic transformation. Therefore, a DNA polynucleotide that is fused or operably connected to one or more other DNA polynucleotides that would not be associated with it in nature, such as as a result of recombinant DNA or plant transformation technology, is considered to be isolated herein. Such polynucleotides are considered to be isolated even when they are integrated into the chromosome of a host cell together with other DNA polynucleotides or are present in a nucleic acid solution.

[0046] The term "operably linked" means that at least two nucleotide sequences are arranged or linked in a manner such that one can affect the function of the other. The two nucleotide sequences can be part of a single continuous nucleotide molecule and can be adjacent or separated. For example, an mts-siRNA targeting element can be operably linked to a transcribable polynucleotide, such as Figure 1As shown. In one embodiment, the mts-siRNA target element that can be operably connected can affect the transcription, translation or expression of transcribable polynucleotides. For example, if after transcription in male reproductive tissue cells, the presence of the mts-siRNA target element in the mRNA molecule causes the regulation of transcribable polynucleotide expression in the cell induced by endogenous mts-siRNA and RISC pathway, then the mts-siRNA target element can be operably connected to the transcribable polynucleotides. For example, the operable connection of the mts-siRNA target element and the transcribable polynucleotides can be realized by incorporating the mts-siRNA target element, and the mts-siRNA target element is located at the adjacent position of the transcribable polynucleotides (such as being located at the 5' or 3' position of the transcribable polynucleotides, but not necessarily in continuous connection), the untranslated region (UTR) of the polynucleotides or the adjacent position (such as being located at 5'UTR or 3'UTR or next to) and / or the 3' position of the transcribable polynucleotides and the 5' position of the polyadenylation signal. In one embodiment, the mts-siRNA target element is located between the transcribable polynucleotide and the polyadenylation sequence, i.e., located at the 3' position of the transcribable polynucleotide and adjacent to it. In another embodiment, the mts-siRNA target element is located between the stop codon of the transcribable polynucleotide and the polyadenylation sequence. In another embodiment, the mts-siRNA target element is located within the 3'UTR sequence adjacent to the transcribable polynucleotide.

[0047] Examples of identification of mts-siRNA sequences, mts-siRNA targets, and mts-siRNA target elements are provided herein and can be identified by methods known to those skilled in the art, such as by bioinformatics analysis of plant small RNA (sRNA) and complementary DNA (cDNA) libraries. Specifically, mts-siRNAs can be identified from sRNA libraries and sequenced. The identified mts-siRNA sequences can be compared to cDNA and / or genomic sequence collections to identify mts-siRNA targets and mts-siRNA target elements that can be used to develop recombinant DNA polynucleotides and constructs as described herein.

[0048] As used herein, the term "construct" means any recombinant DNA polynucleotide, such as a plasmid, a cosmid, a virus, a phage, or a linear or circular DNA or RNA polynucleotide, which is derived from any source, capable of genome integration or autonomous replication, comprising a DNA polynucleotide, wherein at least one DNA polynucleotide has been connected (i.e., operably connected) to another DNA polynucleotide in a functionally operable manner. As used herein, the term "vector" means any construct that can be used for transformation purposes (i.e., introducing heterologous DNA or RNA into a host cell). Constructs typically include one or more expression cassettes. As used herein, "expression cassette" refers to a recombinant DNA polynucleotide comprising at least a transcribable DNA polynucleotide operably connected to one or more regulatory elements (usually at least a promoter and 3'UTR).

[0049] In some embodiments, the mts-siRNA target element is created, synthesized or modified in vitro. For example, the mts-siRNA target element can be modified to contain more, less or different mts-siRNA target sequences, or the relative position of one or more mts-siRNA target sequences can be rearranged. In some embodiments, such modification may be beneficial to increase or reduce the effect of the mts-siRNA target element. Methods for creating, synthesizing or modifying mts-siRNA target elements in vitro and methods for determining the optimal variation of the desired regulation level are known to those skilled in the art. For example, a recombinant mts-siRNA target element can be created by combining the DNA sequence of SEQ ID NO: 1 or a fragment thereof, or one or more mts-siRNA sequences provided herein as SEQ ID NO: 2-8.

[0050] The DNA sequence of the mts-siRNA target element can also be altered by incorporating 1-3 nucleotide mismatches into the mts-siRNA target sequence (relative to a given mts-siRNA sequence). In another embodiment, the present invention includes variant recombinant DNA polynucleotides or mts-siRNA target elements having at least about 80% (percent) sequence identity, about 90% sequence identity, about 91% sequence identity, about 92% sequence identity, about 93% sequence identity, about 94% sequence identity, about 95% sequence identity, about 96% sequence identity, about 97% sequence identity, about 98% sequence identity, and about 99% sequence identity with any recombinant mts-siRNA target element (such as SEQ ID NO: 1-9). In certain embodiments, the variant recombinant DNA polynucleotides or mts-siRNA target elements have the activity of the base sequence from which they are derived.

[0051] Several embodiments relate to fragments of the DNA polynucleotides disclosed herein. Such fragments can be used as mts-siRNA target elements, or can be combined with other mts-siRNA targets, mts-siRNA target elements, mts-siRNA sequences, or fragments thereof, to construct recombinant mts-siRNA target elements, as described above. In specific embodiments, such fragments can include at least about 5, at least about 7, at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 25, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 175, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at 0, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500 consecutive nucleotides or longer, such as the mts-siRNA target element or cDNA sequence disclosed herein. Methods for generating such fragments from starting DNA polynucleotides are well known in the art. Fragments of the recombinant DNA polynucleotides or mts-siRNA target elements disclosed herein can have the activity of the base sequences from which they are derived.

[0052] The efficacy of the modifications, duplications, deletions or rearrangements described herein on the desired expression of a particular transcribable polynucleotide can be tested empirically in stable and transient plant assays (such as those described in the working examples herein) to verify the results, which may vary depending on the changes made in the starting DNA polynucleotide and the target of the changes.

[0053] The mts-siRNA target and mts-siRNA targeting element can function in either orientation, meaning that it is non-directional and can therefore be used in either the 5' to 3' orientation or the 3' to 5' orientation in a recombinant DNA polynucleotide or DNA construct.

[0054] As used herein, "expression of a transcribable polynucleotide" or "expression of a protein" refers to the production of a protein encoded by a transcribable polynucleotide and the resulting transcript (mRNA) in a cell. Therefore, the term "protein expression" refers to any pattern of translation of a transcribed RNA polynucleotide into a protein. Protein expression can be characterized by its temporal, spatial, developmental or morphological properties, as well as by quantitative or qualitative indications. In one embodiment, a recombinant DNA polynucleotide as described herein can be used to selectively regulate the expression of a protein or transcribable polynucleotide in the male reproductive tissue of a transgenic plant. In such an embodiment, the expression of a recombinant DNA polynucleotide in a transgenic plant can result in the expression of an operably linked transcribable polynucleotide at least in a vegetative tissue, but not in a male reproductive tissue. In certain embodiments, such regulation of protein expression refers to inhibition or reduction; for example, inhibition or reduction of the level of a protein produced in a cell, such as post-transcriptional gene regulation mediated by RNAi.

[0055] As used herein, selective regulation of protein expression refers to a reduction in protein production in a cell or tissue by at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% (i.e., complete reduction) compared to a reference cell or tissue. The reference cell or tissue may be, for example, a vegetative cell or tissue from the same or similar transgenic plant expressing the protein, or a cell or tissue from a transgenic plant comprising a similar transgene (or similar transcribable DNA polynucleotide) encoding the protein but lacking an operably linked mts-siRNA target element. Regulation of protein expression may be determined using any technique known to those skilled in the art, such as by directly measuring protein accumulation in a cell or tissue sample using techniques such as ELISA or Western blot analysis, by measuring the enzymatic activity of the protein, or by phenotypically determining protein expression. In one embodiment, selective regulation of protein expression refers to a substantial reduction in the expression of a protein capable of conferring insect pest resistance in the male tissue of a transgenic plant. Thus, a reduction in protein in male tissues such as pollen measured by methods known in the art such as ELISA will indicate selective regulation of protein expression.

[0056] As used herein, the term "transgene encoding a recombinant protein" or "transcribable polynucleotide" refers to any polynucleotide that can be transcribed into an RNA molecule, including but not limited to a polynucleotide having a nucleotide sequence encoding a polypeptide sequence. Depending on the conditions, the nucleotide sequence may or may not actually be translated into a polypeptide in the cell. The boundaries of the transgene or transcribable polynucleotide are usually demarcated by a translation start codon at the 5' end and a translation stop codon at the 3' end.

[0057] The term "transgenic" refers to a DNA polynucleotide that is artificially incorporated into the genome of an organism or host cell (the current or any previous generation of the organism or cell) due to human intervention, such as by a plant transformation method. As used herein, the term "transgenic" means comprising a transgene, for example, a "transgenic plant" refers to a plant that comprises a transgene in its genome, and a "transgenic trait" refers to a characteristic or phenotype brought about or conferred by the presence of a transgene incorporated into the plant genome. Due to such genomic changes, transgenic plants are plants that are significantly different from related wild-type plants and transgenic traits are traits that do not naturally occur in wild-type plants. In some embodiments, the transgenic plant comprises a recombinant DNA polynucleotide comprising one or more mts-siRNA targets as described herein.

[0058] In some embodiments, transgenic or transcribable polynucleotides include, but are not limited to, transgenic or transcribable polynucleotides that provide desirable characteristics associated with plant morphology, physiology, growth, development, yield, nutritional characteristics, disease resistance, pest resistance, herbicide tolerance, stress tolerance, environmental stress tolerance, or chemical tolerance. In one embodiment, the transcribable polynucleotide encodes a protein that, when expressed in a transgenic plant, confers insect pest resistance at least in the cells and / or tissues in which the expressed protein is present; selective regulation of insect pest toxin proteins in male reproductive tissues of transgenic plants results in at least reduced expression of insect toxin proteins in pollen, thereby protecting non-target insects that do not feed on plants but may come into contact with plant pollen from damage caused by toxin proteins.

[0059] In some embodiments, the recombinant DNA constructs as described herein can be prepared by techniques known in the art, and in various embodiments are included in plant transformation vectors, plasmids or plastid DNA. Such recombinant DNA constructs can be used to produce transgenic plants and / or cells, and therefore can also be included in the genomic DNA of transgenic plants, seeds, cells or plant parts. In some embodiments, the recombinant DNA construct is located in a plant transformation vector, or on a gene gun particle used to transform a plant cell, or in a chromosome or plastid of a transgenic plant cell, or in a transgenic cell, transgenic plant tissue, transgenic plant seed, transgenic pollen grain, or transgenic or partially transgenic (e.g., grafted) plant. A vector is any DNA polynucleotide that can be used for plant transformation (i.e., introducing DNA into a plant cell). For example, a recombinant DNA construct can be inserted into a plant transformation vector and used for plant transformation to produce transgenic plants, seeds and cells. Methods for constructing plant transformation vectors are well known in the art, and plant transformation vectors generally include, but are not limited to, a suitable promoter for expressing operably linked DNA, an operably linked recombinant DNA polynucleotide and a polyadenylation signal (which can be included in a 3'UTR sequence). Useful promoters in DNA constructs as described herein are included in promoters that play a role in plants to express operably connected polynucleotides. Such promoters vary and are well known in the art and include those promoters that are inducible, viral, synthetic, compositional, time-regulated, spatially regulated and / or space-time regulated. Additional optional components include but are not limited to one or more of the following targets: 5'UTR, enhancer, cis-acting target, intron, signal sequence, transit peptide sequence and one or more selectable marker genes. In one embodiment, the plant transformation vector comprises a recombinant DNA construct.

[0060] The recombinant DNA constructs and plant transformation vectors described herein can be prepared by any method suitable for the intended application, taking into account, for example, the desired expression type, the desired transgenic or transcribable polynucleotides, and the convenience of use in the plant to be expressed by the recombinant DNA construct. General methods that can be used to manipulate DNA polynucleotides to prepare and use recombinant DNA constructs and plant transformation vectors are well known in the art and are described in detail, for example, including Michael R. Green and Joseph Sambrook, "Molecular Cloning: A Laboratory Manual" (Fourth Edition) ISBN: 978-1-936113-42-2, Cold Spring Harbor Laboratory Press, NY (2012) manuals and experimental procedures.

[0061] Recombinant DNA polynucleotides, constructs and plant transformation vectors as described herein may be modified in whole or in part by methods known in the art, for example, to increase the convenience of DNA manipulation (such as restriction endonuclease recognition sites or recombination-based cloning sites), or to include plant-preferred sequences (such as plant-codon usage or Kozak consensus sequences), or to include sequences that can be used for recombinant DNA polynucleotide and construct design (such as spacers or linker sequences). In certain embodiments, the DNA sequence of the recombinant DNA polynucleotide and construct includes a DNA sequence that has been codon-optimized for the plant to be expressed recombinant DNA polynucleotide or construct. For example, the recombinant DNA polynucleotide or construct to be expressed in a plant may have all or part of its sequence codon-optimized by methods known in the art so as to be expressed in the plant. Recombinant DNA polynucleotides or constructs as described herein may be stacked with other recombinant DNA polynucleotides or transgenic events to confer additional traits (e.g., in the case of transformed plants, traits include herbicide resistance, pest resistance, cold germination tolerance, water deficit tolerance) by, for example, expressing or regulating other genes.

[0062] Several embodiments relate to transgenic plant cells, transgenic plant tissues and transgenic plants or seeds comprising recombinant DNA polynucleotides as described herein. On the other hand, artificial or recombinant plant chromosomes comprising recombinant DNA polynucleotides as described herein are included. Suitable methods for transforming host plant cells using recombinant DNA polynucleotides as described herein include almost any method that can introduce DNA into cells (e.g., recombinant DNA polynucleotides are stably integrated into plant chromosomes), and are well known in the art. An exemplary and widely used method for introducing recombinant DNA polynucleotides into plants is the Agrobacterium (Agrobacterium) transformation system, which is well known to those skilled in the art. Another exemplary method for introducing recombinant DNA polynucleotides into plants is to insert the recombinant DNA polynucleotides into a predetermined site in the plant genome by a site-directed integration method. Site-directed integration can be achieved by any method known in the art, such as by using zinc finger nucleases, engineered or natural meganucleases, TALE endonucleases, or RNA-guided endonucleases (e.g., CRISPR / Cas12a systems) to achieve. Transgenic plants can be regenerated from transformed plant cells by plant cell culture methods. R can be produced by sexually mating (selfing) an independent segregating transgenic plant (e.g., an R0 or F0 plant) containing a single exogenous gene sequence with itself. l or F l seeds to obtain transgenic plants homozygous for the transgene. l or F l One quarter of the seeds will be homozygous for the transgene.l or F l Seed-grown plants are subjected to heterozygosity assays, typically using SNP assays or thermal amplification assays to allow differentiation of heterozygotes from homozygotes (ie, zygosity assays).

[0063] Several embodiments relate to transgenic plants having recombinant DNA polynucleotides as described herein in their genomes, including but not limited to alfalfa, cotton, corn (also known as maize), rapeseed, rice, soybean, and wheat, etc. In one embodiment, the transgenic plant having recombinant DNA polynucleotides as described herein in its genome can be corn. Several embodiments relate to transgenic plant cells, plant parts, and offspring of such transgenic plants. As used herein, "offspring" includes any plant, seed, plant cell, and / or plant part produced or regenerated by a plant, seed, plant cell, and / or plant part comprising a recombinant DNA polynucleotide as described herein. Transgenic plants, cells, parts, progeny plants, and seeds produced by such plants can be homozygous or heterozygous for recombinant DNA polynucleotides as described herein. In some embodiments, plant parts can include but are not limited to leaves, stems, roots, seeds, endosperms, ovules, and pollen. Plant parts can be viable, non-viable, regenerable, or non-regenerable. Several embodiments relate to transformed plant cells comprising DNA polynucleotides as described herein. In some embodiments, transformed or transgenic plant cells include both regenerable and non-regenerable plant cells.

[0064] In several embodiments, the recombinant DNA polynucleotides as described herein are present in commercial products produced from transgenic plants, seeds, or plant parts; such commercial products include, but are not limited to, harvested parts of plants, crushed or whole grains or seeds of plants, or any food or non-food product comprising a recombinant DNA polynucleotide as described herein.

[0065] Several embodiments relate to recombinant DNA polynucleotides comprising mts-siRNA target elements, the mts-siRNA target elements comprising a sequence having at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or more sequence identity to SEQ ID NO: 1 operably linked to a heterologous transcribable DNA polynucleotide. The mts-siRNA target element can be operably linked to a heterologous transcribable DNA polynucleotide during the cloning of an expression cassette to be transformed into a plant. Alternatively, the mts-siRNA target element can also be introduced into a transgenic plant by site-specific genome editing and operably linked to a heterologous transcribable DNA polynucleotide therein. Several editing methods are known in the art, which involve different sequence-specific genome modification enzymes (or complexes of proteins and / or guide RNAs) that modify genomic DNA. In some embodiments, the site-specific genome modification enzyme modifies the genome by inducing double-strand breaks (DSBs) or nicks at a desired genome site or locus. In some embodiments, the site-specific genome modification enzyme modifies the genome by inducing one or more nucleotide deaminations at a desired genome site or locus. In some embodiments, during the process of repairing the DSB or nicks introduced by the genome modification enzyme, a donor template DNA (such as a donor template DNA comprising an mts-siRNA target element) can be integrated into the genome at the site of the DSB or nicks. In some embodiments, the site-specific genome modification enzyme comprises a cytidine deaminase. In some embodiments, the site-specific genome modification enzyme comprises an adenine deaminase. In the present disclosure, the site-specific genome modification enzyme includes an endonuclease, a recombinase, a transposase, a deaminase, a helicase, a reverse transcriptase, and any combination thereof. In certain embodiments, a CRISPR system (e.g., a CRISPR / Cas9 system, a CRISPR / Cas12a system, etc.) can be used to target the insertion of a blunt-ended double-stranded DNA fragment comprising an mts-siRNA target element into a genomic target site comprising a heterologous transcribable DNA polynucleotide. In some embodiments, the CRISPR-Cas system is selected from a type I CRISPR-Cas system, a type II CRISPR-Cas system, a type III CRISPR-Cas system, a type IV CRISPR-Cas system, a type V CRISPR-Cas system, or a type VI CRISPR-Cas system.The CRISPR-Cas effector proteins of the CRISPR-Cas system include but are not limited to Cas9, C2c1, C2c3, C2c4, C2c5, C2c8, C2c9, C2c10, Cas12a (also known as Cpf1), Cas12b, Cas12c, Cas12d, Cas12e, Cas12h, Cas12i, Cas12g, Cas13a, Cas13b, Cas13c, Cas13d, Cas1, Cas1B, Cas2, Cas3, Cas3', Cas3", Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as , Csf2, Csf3, Csf4 (dinG), Csf5, Cas14a, Cas14b, and Cas14c effector proteins.

[0066] The definitions and methods provided define the present disclosure and guide those of ordinary skill in the art to practice the present disclosure. Unless otherwise stated, the terms should be understood according to the conventional usage of those of ordinary skill in the relevant field. The definitions of commonly used terms and methods in molecular biology can also be found in Alberts et al., Molecular Biology, Third Edition, Academic Press, Elsevier Inc., 2019; Alberts et al., Molecular Biology of The Cell, Fifth Edition, Garland Science Publishing, Inc.: New York, 2007; Rieger et al., Glossary of Genetics: Classical and Molecular, Fifth Edition, Springer-Verlag: New York, 1991; King et al., A Dictionary of Genetics, Sixth Edition, Oxford University Press: New York, 15 2247; and Lewin, Genes IX, Oxford University Press: New York, 2007.

[0067] Implementation

[0068] For further illustration, additional exemplary non-limiting embodiments of the present disclosure are set forth below.

[0069] The first embodiment relates to a recombinant DNA polynucleotide comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of: a.) a sequence having at least 90% sequence identity to SEQ ID NO: 1; b.) a sequence comprising SEQ ID NO: 1; and c.) a fragment of SEQ ID NO: 1 that is capable of binding to its corresponding mts-siRNA; wherein the mts-siRNA target element is operably linked to a heterologous transcribable DNA polynucleotide.

[0070] A second embodiment relates to the recombinant DNA polynucleotide of embodiment 1, wherein said sequence has at least 95% sequence identity with the DNA sequence of SEQ ID NO:1.

[0071] A third embodiment is directed to the recombinant DNA polynucleotide of embodiment 1, wherein the heterologous transcribable DNA polynucleotide comprises a gene of agronomic value.

[0072] A fourth embodiment is directed to the recombinant DNA polynucleotide of embodiment 3, wherein the gene of agronomic value confers resistance to plant pests.

[0073] A fifth embodiment is directed to the recombinant DNA polynucleotide of embodiment 3, wherein the gene of agronomic value confers herbicide tolerance to the plant.

[0074] A sixth embodiment is directed to the recombinant DNA polynucleotide of embodiment 3, wherein the gene of agronomic value confers a change in plant architecture.

[0075] A seventh embodiment is directed to the recombinant DNA polynucleotide of embodiment 3, wherein the gene of agronomic value confers an increase in plant yield.

[0076] The eighth embodiment relates to a transgenic plant cell comprising a recombinant DNA polynucleotide containing an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of: a.) a sequence having at least 90% sequence identity with SEQ ID NO: 1; b.) a sequence comprising SEQ ID NO: 1; and c.) a fragment of SEQ ID NO: 1 that is capable of binding to its corresponding mts-siRNA; wherein the mts-siRNA target element is operably linked to a heterologous transcribable DNA polynucleotide.

[0077] A ninth embodiment is directed to the transgenic plant cell of embodiment 8, wherein the transgenic plant cell is a corn plant cell.

[0078] The tenth embodiment relates to a transgenic plant or a part thereof, comprising the recombinant DNA polynucleotide of embodiment 1.

[0079] An eleventh embodiment relates to a progeny plant or part thereof of the transgenic plant of embodiment 10, wherein said progeny plant or part thereof comprises the recombinant DNA polynucleotide of embodiment 1.

[0080] The twelfth embodiment relates to a transgenic seed, wherein the seed comprises the recombinant DNA polynucleotide of embodiment 1.

[0081] The thirteenth embodiment relates to a method for producing a commercial product, which comprises obtaining the transgenic plant or part thereof according to embodiment 10, and producing a commercial product therefrom.

[0082] A fourteenth embodiment is directed to the method of embodiment 13, wherein the commercial product is seed, processed seed, protein concentrate, protein isolate, starch, grain, plant part, seed oil, biomass, flour and meal.

[0083] The fifteenth embodiment relates to a method for expressing a transcribable DNA polynucleotide, comprising obtaining a transgenic plant according to embodiment 10 and cultivating the plant, wherein the transcribable polynucleotide is expressed.

[0084] The sixteenth embodiment relates to a method for reducing the expression of a transcribable DNA polynucleotide in male tissue of a plant, comprising: a.) operably linking an mts-siRNA target element to the transcribable DNA polynucleotide; and b.) transforming the plant with an expression cassette comprising the transcribable DNA polynucleotide operably linked to the mts-siRNA target element; wherein the mts-siRNA target element has at least 90% sequence identity with SEQ ID NO: 1 or a fragment thereof.

[0085] A seventeenth embodiment is directed to the method of embodiment 16, wherein the mts-siRNA is 100% identical to the DNA sequence of SEQ ID NO:1.

[0086] An eighteenth embodiment is directed to the method of embodiment 16, wherein the mts-siRNA has at least 95% sequence identity to the DNA sequence of SEQ ID NO:1.

[0087] Embodiment 19 is a recombinant DNA polynucleotide comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of:

[0088] a. a sequence having at least 90% sequence identity with SEQ ID NO: 1; and

[0089] b. a sequence comprising SEQ ID NO: 1,

[0090] The mts-siRNA targeting element is operably linked to a heterologous transcribable DNA polynucleotide.

[0091] Embodiment 20 is the recombinant DNA polynucleotide of embodiment 19, wherein the DNA sequence of the mts-siRNA target element has at least 95% sequence identity with the DNA sequence of SEQ ID NO:1.

[0092] Embodiment 21 is the recombinant DNA polynucleotide of any one of embodiments 19 or 20, wherein the DNA sequence of the mts-siRNA target element has at least 98% sequence identity with the DNA sequence of SEQ ID NO:1.

[0093] Embodiment 22 is the recombinant DNA polynucleotide of any one of embodiments 19 to 21, wherein the DNA sequence of the mts-siRNA target element has at least 99% sequence identity with the DNA sequence of SEQ ID NO:1.

[0094] Embodiment 23 is the recombinant DNA polynucleotide of any one of embodiments 19 to 22, wherein the heterologous transcribable DNA polynucleotide comprises a gene of agronomic value.

[0095] Embodiment 24 is the recombinant DNA polynucleotide of embodiment 23, wherein the gene of agronomic value confers resistance to plant pests.

[0096] Embodiment 25 is the recombinant DNA polynucleotide of embodiment 23, wherein the gene of agronomic value confers herbicide tolerance to the plant.

[0097] Embodiment 26 is the recombinant DNA polynucleotide of embodiment 23, wherein the gene of agronomic value confers a change in plant architecture.

[0098] Embodiment 27 is the recombinant DNA polynucleotide of embodiment 23, wherein the gene of agronomic value confers an increase in plant yield.

[0099] Embodiment 28 is a transgenic plant cell comprising a recombinant DNA polynucleotide comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of:

[0100] a. a sequence having at least 90%, or at least 95%, or at least 98% or at least 99% sequence identity with SEQ ID NO: 1; and

[0101] b. a sequence comprising SEQ ID NO: 1;

[0102] The mts-siRNA targeting element is operably linked to a heterologous transcribable DNA polynucleotide.

[0103] Embodiment 29 is the transgenic plant cell of embodiment 28, wherein the transgenic plant cell is a corn plant cell.

[0104] Embodiment 30 is a transgenic plant or part thereof comprising the recombinant DNA polynucleotide of any one of embodiments 19 to 27.

[0105] Embodiment 31 is a progeny plant or part thereof of the transgenic plant of embodiment 30, wherein the progeny plant or part thereof comprises the recombinant DNA polynucleotide of any one of embodiments 19 to 27.

[0106] Embodiment 32 is the transgenic plant or part thereof of embodiment 30 or the progeny plant or part thereof of embodiment 31, wherein the plant is a corn plant.

[0107] Embodiment 33 is a transgenic seed, wherein the seed comprises the recombinant DNA polynucleotide of any one of embodiments 19 to 27.

[0108] Embodiment 34 is the transgenic seed of embodiment 33, wherein the seed is a corn seed.

[0109] Embodiment 35 is a method for producing a commercial product, which comprises obtaining a transgenic plant or a part thereof according to embodiment 30, and producing a commercial product therefrom.

[0110] Embodiment 36 is the method of embodiment 35, wherein the commercial product is selected from the group consisting of seeds, processed seeds, protein concentrates, protein isolates, starches, grains, plant parts, seed oils, biomass, flours and / or meals.

[0111] Embodiment 37 is a method of expressing a transcribable DNA polynucleotide, comprising obtaining a transgenic plant according to embodiment 30 and cultivating the plant, wherein the transcribable polynucleotide is expressed.

[0112] Embodiment 38 is a method for reducing the expression of transcribable DNA polynucleotides in male reproductive tissues of plants, comprising the following steps:

[0113] a. operably linking an mts-siRNA target element to the transcribable DNA polynucleotide, wherein the mts-siRNA target element is heterologous to the transcribable DNA polynucleotide; and wherein the mts-siRNA target element has at least 90% sequence identity to SEQ ID NO: 1; and

[0114] b. Transforming plants with an expression cassette comprising a transcribable DNA polynucleotide operably linked to an mts-siRNA targeting element.

[0115] Embodiment 39 is the method of embodiment 38, further comprising the steps of

[0116] c. expressing a transcribable DNA polynucleotide, comprising obtaining a transgenic plant from step b. and cultivating said plant, wherein said transcribable polynucleotide is expressed.

[0117] Embodiment 40 is the method of embodiment 39, further comprising the steps of

[0118] d. Determining the reduced expression of transcribable DNA polynucleotides in male reproductive tissues of plants, including

[0119] (i) determining the expression level of a protein encoded by a transcribable DNA polynucleotide in the male reproductive tissue of the plant obtained in step c., and

[0120] (ii) determining the expression level of a protein encoded by a transcribable DNA polynucleotide in a male reproductive tissue of a reference cell or tissue,

[0121] wherein the reference cell or tissue is from the same or similar transgenic plant expressing the protein but lacking an operably linked mts-siRNA targeting element; or

[0122] Wherein the reference cell or tissue is from a transgenic plant comprising a similar transcribable DNA polynucleotide encoding the protein but lacking an operably linked mts-siRNA targeting element.

[0123] Embodiment 41 is the method of any one of embodiments 38 to 40, wherein the mts-siRNA target element has at least 95% sequence identity to the DNA sequence of SEQ ID NO:1.

[0124] Embodiment 42 is the method of any one of embodiments 38 to 41, wherein the mts-siRNA target element has at least 98% sequence identity to the DNA sequence of SEQ ID NO:1.

[0125] Embodiment 43 is the method of any one of embodiments 38 to 42, wherein the mts-siRNA target element has at least 99% sequence identity to the DNA sequence of SEQ ID NO:1.

[0126] Embodiment 44 is the method of any one of embodiments 38 to 43, wherein the mts-siRNA target element comprises a DNA sequence comprising SEQ ID NO:1.

[0127] Embodiment 45 is the method of any one of embodiments 38 to 44, wherein the plant is a corn plant.

[0128] Embodiment 46 is the method of any one of embodiments 38 to 45, wherein the male reproductive tissue is pollen.

[0129] Embodiment 47 is the method of any one of embodiments 38 to 46, wherein the transcribable DNA polynucleotide comprises an agronomically valuable gene encoding a protein that confers resistance to plant pests or confers tolerance to plants to herbicides.

[0130] Embodiment 48 is an isolated recombinant DNA molecule characterized by comprising a DNA sequence of SEQ ID NO: 1, wherein the DNA sequence is operably linked to a heterologous transcribable DNA molecule.

[0131] Embodiment 49 is the isolated recombinant DNA molecule of embodiment 48, characterized in that the heterologous transcribable polynucleotide molecule comprises a gene of agronomic value.

[0132] Embodiment 50 is the isolated recombinant DNA molecule of embodiment 49, characterized in that the gene of agronomic value confers herbicide tolerance to the plant.

[0133] Embodiment 51 is the isolated recombinant DNA molecule of embodiment 49, characterized in that the gene of agronomic value confers pest resistance to plants.

[0134] Embodiment 52 is a method for producing a transgenic plant, characterized in that, in addition to the plant obtained by the method, it comprises:

[0135] a. transforming a plant cell with the isolated recombinant DNA molecule of embodiment 48 to produce a transformed plant cell; and

[0136] b. Regenerating transgenic plants from the transformed plant cells.

[0137] Embodiment 53 is a construct characterized by comprising the isolated recombinant DNA molecule of embodiment 48.

[0138] The embodiments described herein can be more easily understood by reference to the following examples, which are provided by way of illustration and are not intended to limit the present invention unless specified. It should be understood by those skilled in the art that the techniques disclosed in the following examples represent techniques that the inventors have found to work better in practicing the present invention. However, in view of this disclosure, it is understood by those skilled in the art that many changes can be made in the disclosed specific embodiments, and still obtain the same or similar results without departing from the spirit and scope of the present invention, and therefore, all matters proposed or shown in the accompanying drawings should be understood to be exemplary and not limiting.

[0139] Example

[0140] The following examples are included to illustrate embodiments of the present disclosure. It will be appreciated by those skilled in the art that many changes may be made to the disclosed specific embodiments without departing from the concept, spirit and scope of the present disclosure, and still the same or similar results may be obtained. More specifically, it will be apparent that certain agents of chemical and physiological relevance may replace agents described herein while achieving the same or similar results. All of these similar substitutions and modifications apparent to those skilled in the art are considered to be within the spirit, scope and concept of the present disclosure as defined by the appended claims.

[0141] Example 1

[0142] Identification and synthesis of mts-siRNA_TE_2

[0143] This example describes the identification of the mts-siRNA sequence used to construct the mts-siRNA target element mts-siRNA_TE_2 (SEQ ID NO: 1).

[0144] According to the manufacturer's protocol, use Small RNA libraries were prepared from leaf and pollen tissues of maize varieties B73 and LH244 using the Illumina Small RNA Library Preparation Kit (Illumina, San Diego, CA). After cDNA amplification, unique index libraries were pooled in equimolar amounts and cloned in 6% Novex TMSize separation was performed on a TBE Page gel (Novex, Fairfield, NJ). The gel was stained with 1X SYBR Gold for twenty minutes. The size-graded indexed cDNA was then separated and sequenced. At least 3 million reads were generated for each size-selected library using the NextSeq 550 platform of Illumina. Sequences between leaf and pollen libraries were compared using bioinformatics analysis to identify small RNAs (mts-siRNAs) expressed only in pollen. Table 1 shows the male tissue-specific small interfering RNAs used to synthesize mts-siRNA_TE_2 and their corresponding SEQ ID NOs.

[0145] Table 1. Male tissue-specific small interfering RNAs and corresponding SEQ ID NOs.

[0146] mts-siRNA SEQ ID NO: sequence Length (bp) mts-siRNA_1 2 ATGAAGCCGATTGTGGACATCGAT 24 mts-siRNA_2 3 TGACCTCCATGGCAGTAGGATGCA 24 mts-siRNA_3 4 TTCCACCAGGCATTTTCGTCCAAG 24 mts-siRNA_4 5 AGTCGGCACAATGTACAGGTAGT 23 mts-siRNA_6 6 TGATTGCGTAGAGAGCCCTTGGTT 24 mts-siRNA_7 7 ACTACAGTGAGAGTCTAGGAAAGC 24 mts-siRNA_8 8 CTCGGCGTCACTCACAACTAAC 22

[0147] The mts-siRNA target element is chemically synthesized. The mts-siRNA target element mts-siRNA_TE_2 (SEQ ID NO: 1) consists of the mts-siRNA sequences shown in Table 1 above; four of which are placed in a reverse complementary (RC) orientation. Table 2 below shows the order of SEQ ID NOs used to construct mts-siRNA_TE_2. The mts-siRNA sequences indicated as "(RC)" are present in a reverse complementary orientation.

[0148] Table 2. mts-siRNA sequences included in the mts-siRNA target element.

[0149] mts-siRNA target element SEQ ID NO: mts-siRNA SEQ ID NO: Length (bp) mts-siRNA_TE_2 1 3(RC); 6; 2(RC); 7; 5(RC); 8; 4(RC) 168

[0150] The mts-siRNA target element mts-siRNA_TE_2 was cloned 3' and operably linked to the insect toxin coding sequence BT_TOX. Transcription of the BT_TOX coding sequence will produce an mRNA containing the 5'UTR, the BT_TOX coding sequence, the mts-siRNA target element and the 3'UTR (see Figure 1 ).

[0151] Example 2

[0152] Effect of mts-siRNA_TE_2 on reducing pollen protein expression

[0153] Corn plants were transformed with a vector, particularly a plant expression vector comprising an expression cassette to evaluate the efficacy of mts-siRNA_TE_2 in reducing toxin gene expression, wherein the expression cassette uses a constitutive promoter, a leader sequence and an intron to drive the expression of the insect toxin gene BT_TOX, wherein the BT_TOX is operably linked to mts-siRNA_TE_2.

[0154] Corn plants were transformed using binary plasmid plant transformation vectors. Transformation vectors were constructed using standard methods known in the art. The resulting plant transformation vector contained the left border region from Agrobacterium tumefaciens, the first expression cassette, which was used to assess mts-siRNA_TE_2 (SEQ ID NO: 1) efficacy, consisting of a plant constitutive promoter, a leader sequence, and an intron, operably connected to the coding sequence of toxin BT_TOX with 5', operably connected to mts-siRNA_TE_2 with 5', and operably connected to 3'UTR with 5'; a second expression cassette, which was used to select transformed plant cells using glyphosate selection; and the right border region from Agrobacterium tumefaciens.

[0155] As is well known in the art, the above binary transformation vector constructs are used to transform corn plant cells via Agrobacterium-mediated transformation. The resulting transformed plant cells are induced to form complete corn plants.

[0156] The corn plants of single copy stable transformation are selected for determination. ELISA is used to measure the BT_TOX protein expression in pollen. The transformed corn plants comprising the BT_TOX expression cassette (without mts-siRNA target element) are used as controls. Multiple R0 transformants are detected with mts-siRNA_TE_2 and controls. ELISA is used to measure the expression level of BT_TOX in the leaf and pollen samples from mts-siRNA_TE_2 and controls. Table 3 below shows the average expression (measured in parts per million (ppm)) of BT_TOX protein in leaves and pollen and the percentage reduction relative to the expression of controls.

[0157] Table 3. Average BT_TOX protein expression in leaves and pollen and percentage reduction of expression.

[0158]

[0159] As shown in Table 3, the operable linkage of mts-siRNA_TE_2 (SEQ ID NO: 1) can reduce the expression of BT_TOX protein in pollen.

[0160] Example 3

[0161] The target element mts-siRNA_TE_2 mainly binds to siRNA expressed in male maize tissues.

[0162] This example demonstrates that the siRNA sequences used to construct the target element mts-siRNA_TE_2 are primarily expressed in male tissues of maize, such as young and old tassels, as determined using Cy5-labeled probes hybridized to siRNA microarrays.

[0163] use Small RNAs were purified from ears, leaves, roots, silks, and tassels of maize varieties LH244 and O1DKD2 using the microRNA Isolation Kit (Sigma, St. Louis, MO). Small RNA libraries were prepared using the Small RNA Library Preparation Kit (Illumina, San Diego, CA). The libraries were sequenced using Illumina's NextSeq550 platform. By comparing the library sequences from each tissue, male tissue-specific short interfering RNA (mts-siRNA) was identified from a bioinformatics perspective as RNA expressed only in the tassel. The complementary sequences of 1,216 mts-siRNAs specific to the tassel were arrayed in triplicate on a custom microarray chip produced by LC Sciences (Houston, TX). Total RNA isolated from 26 wild-type tissues collected from 31 germplasms was used to synthesize complementary DNA (cDNA). Cy5-labeled complementary RNA was then prepared from the cDNA samples and hybridized to the custom microarray chip. Use Hybridization images were collected using a 4000B laser scanner (Molecular Devices, Sunnyvale, CA) and analyzed using Array- Analyzer image analysis software (Media Cybernetics, Rockville, MD) was used for digitization. Relative signal values ​​were obtained by background subtraction and normalization. Differential expression signals were determined by t-test, p < 0.05.

[0164] Figure 2 The figure shows the average Cy5 signal of 7 mts-siRNA sequences (SEQ ID NO: 3, 6, 2, 7, 5, 8 and 4) used to construct mts-siRNA_TE_2 detected in various tissues of corn variety LH244. Figure 2As shown, the expression of mts-siRNA used to construct mts-siRNA_TE_2 (SEQ ID NO: 1) was mainly expressed in young and old tassels. Very low expression of SEQ ID NOs: 7, 5 and 6 was observed in V4 roots.

[0165] Having shown and described the principles of the invention, it will be apparent to those skilled in the art that the invention may be modified in arrangement and detail without departing from such principles. We claim protection for all modifications within the spirit and scope of the claims. All publications and published patent documents herein are incorporated herein by reference to the same extent as if each individual publication or patent application was expressly and individually indicated to be incorporated by reference.

Claims

1. A recombinant DNA polynucleotide comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of: i. a sequence having at least 90% sequence identity to SEQ ID NO: 1; and ii. a sequence comprising SEQ ID NO: 1; The mts-siRNA targeting element is operably linked to a heterologous transcribable DNA polynucleotide.

2. The recombinant DNA polynucleotide of claim 1, wherein the DNA sequence of the mts-siRNA target element has at least 95% sequence identity with the DNA sequence of SEQ ID NO:

1.

3. The recombinant DNA polynucleotide of claim 1, wherein the heterologous transcribable DNA polynucleotide comprises a gene of agronomic value.

4. The recombinant DNA polynucleotide of claim 3, wherein the gene of agronomic value confers resistance to plant pests.

5. The recombinant DNA polynucleotide of claim 3, wherein the gene of agronomic value confers herbicide tolerance to a plant.

6. The recombinant DNA polynucleotide of claim 3, wherein the gene of agronomic value confers a change in plant architecture.

7. The recombinant DNA polynucleotide of claim 3, wherein the gene of agronomic value confers an increase in plant yield.

8. A transgenic plant cell comprising a recombinant DNA polynucleotide comprising an mts-siRNA target element, wherein the mts-siRNA target element comprises a DNA sequence selected from the group consisting of: i. a sequence having at least 90% sequence identity to SEQ ID NO: 1; and ii. a sequence comprising SEQ ID NO: 1; The mts-siRNA targeting element is operably linked to a heterologous transcribable DNA polynucleotide.

9. The transgenic plant cell of claim 8, wherein the transgenic plant cell is a corn plant cell.

10. A transgenic plant or part thereof, comprising the recombinant DNA polynucleotide of claim 1.

11. A progeny plant or part thereof of the transgenic plant of claim 10, wherein the progeny plant or part thereof comprises the recombinant DNA polynucleotide of claim 1.

12. A transgenic seed, wherein the seed comprises the recombinant DNA polynucleotide of claim 1.

13. A method for producing a commercial product, comprising obtaining the transgenic plant or part thereof according to claim 10, and producing the commercial product therefrom.

14. The method of claim 13, wherein the commercial product is selected from the group consisting of seeds, processed seeds, protein concentrates, protein isolates, starches, grains, plant parts, seed oils, biomass, flours, and meals.

15. A method for expressing a transcribable DNA polynucleotide, comprising obtaining the transgenic plant according to claim 10 and culturing the plant, wherein the transcribable DNA polynucleotide is expressed.

16. A method for reducing the expression of a transcribable DNA polynucleotide in a plant male reproductive tissue, comprising the following steps: i. operably linking an mts-siRNA target element to the transcribable DNA polynucleotide; wherein the mts-siRNA target element is heterologous to the transcribable DNA polynucleotide; and wherein the mts-siRNA target element has at least 90% sequence identity to SEQ ID NO: 1; ii. transforming a plant with an expression cassette comprising the transcribable DNA polynucleotide operably linked to the mts-siRNA targeting element.

17. The method of claim 16, wherein the mts-siRNA target element comprises a DNA sequence comprising SEQ ID NO:

1.

18. The method of claim 16, wherein the mts-siRNA target element has at least 95% sequence identity to the DNA sequence of SEQ ID NO:

1.

19. The method of claim 16, further comprising the step of c. expressing the transcribable DNA polynucleotide, comprising obtaining a transgenic plant from step b. and cultivating the plant, wherein the transcribable DNA polynucleotide operably linked to the mts-siRNA target element is expressed.

20. The method of claim 16, wherein i. the plant is a corn plant; ii. the male reproductive tissue is pollen; and / or iii. The transcribable DNA polynucleotide comprises a gene with agronomic value, wherein the gene with agronomic value encodes a protein that confers plant pest resistance or confers plant herbicide tolerance.

Images