Antioxidative peptide of nanorana pleskei and application of antioxidant peptide

Abstract

The invention discloses a nanorana alpine antioxidative peptide and application thereof. The antioxidative peptide is a cyclic peptide composed of 29 amino acids, the amino acid sequence of the antioxidative peptide is as shown in SEQ ID NO.1, and cysteine at the seventh position and cysteine at the twelfth position form an intramolecular disulfide bond. The invention further discloses nucleotide for coding the antioxidative peptide of the nanorana pleskei. The antioxidative peptide has good anti-inflammatory and anti-oxidation effects, can protect plasmid DNA damaged by H2O2, inhibits accumulation of CuSO4 induced zebrafish larva active oxygen and migration of neutrophil, and relieves mouse skin injury induced by UVB radiation.

Description

Technical Field

[0001] The invention relates to the field of medicine, and in particular to an alpine pygmy frog antioxidant peptide and application thereof. Background Art

[0002] Skin aging is a phenomenon caused by natural or unnatural factors, and can be divided into endogenous aging and exogenous aging according to the cause. The causes of exogenous skin aging include long-term ultraviolet radiation (UV), adverse climate and environment, bad living habits and excessive work pressure, among which UV radiation is the most common and main cause of skin aging.

[0003] Ultraviolet rays are part of the electromagnetic radiation spectrum emitted by the sun, with a wavelength range of 100 to 400nm. According to the wavelength of the radiation spectrum, ultraviolet rays can be divided into three parts: UVC (100-280nm), UVB (280-315nm) and UVA (315-400nm). The ozone layer can completely absorb UVC and absorb most of UVB. Therefore, of the ultraviolet rays entering the earth's atmosphere, 95% are UVA wavelengths and the remaining 5% are UVB. UVA is the longest form of ultraviolet wavelength and is the wavelength that mainly causes skin aging and wrinkles. Compared with UVA, UVB penetrates less light in the earth's ozone layer, but the biological activity of UVB is 1000 times that of UVA. A large number of studies have shown that long-term or excessive exposure of the skin to UVB radiation can lead to the formation of free radicals, which can lead to damage to lipids, proteins, and proteins in the skin and changes in gene expression levels. Once this damage exceeds the repair capacity of the skin's antioxidant system, it will lead to the occurrence of skin diseases such as acute inflammation, photoaging and skin cancer. Therefore, it is necessary to develop repair drugs or cosmetics that have the ability to protect against UV radiation-induced skin damage.

[0004] The antioxidant measures currently developed for skin photoaging mainly include the following aspects: (1) Application of antioxidants: Use topical antioxidants to neutralize free radicals and reduce oxidative damage, such as vitamin C, vitamin E, selenium, green tea polyphenols, etc. Promote the synthesis of endogenous antioxidants in the skin, such as glutathione, superoxide dismutase (SOD) and catalase (CAT). (2) Enhancement of DNA repair mechanism: Promote DNA repair pathways such as nucleotide excision repair (NER), base excision repair (BER) and mismatch repair (MMR) to repair DNA damage caused by UV. Use ingredients such as niacinamide (vitamin B3) to activate DNA repair enzymes and improve cell repair capacity. (3) Anti-inflammatory effect: Use nonsteroidal anti-inflammatory drugs (NSAIDs), steroids and other drugs to reduce UV-induced inflammatory reactions. Apply topical anti-inflammatory ingredients such as salicylic acid and hyaluronic acid to reduce the release of inflammatory mediators. (4) Protection and regeneration of collagen and elastin: Use retinol (vitamin A derivative), peptide growth factors, etc. to promote the synthesis of collagen and elastin and improve skin elasticity. Inhibit the activity of metalloproteinases (MMPs) and reduce the degradation of collagen and elastin.

[0005] Amphibians (especially frogs) are natural reservoirs of bioactive peptides. Their exposed skin is directly exposed to ultraviolet radiation, and they have a more powerful intrinsic antioxidant system than other vertebrates with physical shielding (such as feathers and scales). However, only a few studies on antioxidant peptides in amphibians have been reported. In addition, it is worth noting that the biological activities of antioxidant peptides are diverse, such as GL-21 (from Odorrana andersonii), cathelicidin-OA1 (from Odorrana andersonii) and Gj-CATH3 (Gekkojaponicus) have free radical scavenging activity and wound healing activity. PN-CATH1 and PN-CATH2 (from Pelophylax nigromaculata) have free radical scavenging activity and antibacterial activity. However, most of the research on these antioxidant peptides remains on free radical scavenging ability, and there is little research on their potential medicinal value and mechanism of action. At present. Only a few frog-derived antioxidant peptides have been reported to have the effect of resisting UV radiation damage, such as FW-1 and FW-2 (from Hylaannectans), which show potential antioxidant effects by inhibiting UVB-induced reactive oxygen species (ROS) production. OM-G15 (from Odorranamargaretae) can inhibit DNA damage by downregulating Bax and upregulating Bcl-2, protecting epidermal cells from UVB-induced apoptosis. However, the discovery and research of amphibian-derived antioxidant peptides still needs to be further promoted.

[0006] The alpine dwarf frog (Nanorana parkeri), an animal of the genus Nanorana of the family Ranidae, is the most common amphibian in Tibet, mainly distributed around lakes, streams and rivers on the Qinghai-Tibet Plateau. It is distributed abroad in Pakistan and Nepal (northwest) (Chinese Amphibians: https: / / www.amphibiachina.org / search / ). Compared with plains at the same latitude, the solar radiation in Tibet is 1-3 times that of plains at the same latitude. As the frog with the highest altitude distribution in the world, the alpine dwarf frog's exposed skin makes them more sensitive to ultraviolet radiation. Compared with its relatives in low-altitude areas, the alpine dwarf frog has a stronger ability to resist ultraviolet damage. However, there is still insufficient research on whether the alpine dwarf frog resists ultraviolet damage through antioxidant peptides. In addition, only three antimicrobial peptides with antibacterial activity from the alpine dwarf frog, Japonicin-1Npa, Japonicin-1Npb and Parkerin, have been reported. Therefore, the applicant believes that there are still undiscovered bioactive substances in this species that have been identified and described, especially HDP with antioxidant and antibacterial activity. Summary of the invention

[0007] In order to solve the deficiencies in the prior art, the present invention aims to provide an alpine pygmy frog antioxidant peptide and its application.

[0008] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0009] The present invention provides an anti-oxidative peptide of Rana alpina, which is a cyclic peptide composed of 29 amino acids, the amino acid sequence of which is shown in SEQ ID NO.1, and the seventh cysteine ​​and the twelfth cysteine ​​form an intramolecular disulfide bond. The secondary structure simulation results of the anti-oxidative peptide of Rana alpina show an alpha helix, and the rest of the structure is a random coil.

[0010] Furthermore, the alpine frog antioxidant peptide is prepared by a biological method or synthesized by a chemical method.

[0011] In another aspect, the present invention provides a nucleotide encoding the alpine pygmy frog antioxidant peptide.

[0012] Furthermore, the nucleotide sequence encoding the alpine pygmy frog antioxidant peptide is shown as SEQ ID NO.2 or SEQ ID NO.9.

[0013] In another aspect, the present invention provides a reagent, which contains any one of 1) to 8):

[0014] 1) the nucleotide;

[0015] 2) an expression cassette containing the nucleotide sequence;

[0016] 3) a recombinant vector containing the nucleotide;

[0017] 4) a recombinant vector containing the expression cassette described in 2);

[0018] 5) a recombinant microorganism containing the nucleotide;

[0019] 6) A recombinant microorganism containing the expression cassette described in 2);

[0020] 7) A recombinant microorganism containing the recombinant vector described in 3);

[0021] 8) A recombinant microorganism containing the recombinant vector described in 4).

[0022] Another aspect of the present invention provides the use of the alpine frog antioxidant peptide or the nucleotide in any of the following:

[0023] 1) Preparation of antioxidant or anti-inflammatory drugs, health products, skin care products or cosmetics;

[0024] 2) Preparation of cleared ABTS + and / or DPPH free radical preparations;

[0025] 3) preparing preparations that reduce DNA damage caused by oxidative damage;

[0026] 4) Prepare a preparation that inhibits CuSO4-induced oxidative stress and neutrophil migration in zebrafish.

[0027] Another aspect of the present invention provides the use of the alpine frog antioxidant peptide or the nucleotide in any of the following:

[0028] 1) Preparation of medicines, health products, skin care products or cosmetics for preventing and / or treating skin damage or aging induced by ultraviolet radiation;

[0029] 2) Preparation of drugs, health products, skin care products or cosmetics for inhibiting ultraviolet radiation-induced degradation of skin collagen fibers;

[0030] 3) Preparation of drugs, health products, skin care products or cosmetics for inhibiting ultraviolet radiation-induced oxidative damage to skin tissue;

[0031] 4) Preparation of medicines, health products, skin care products or cosmetics for inhibiting skin inflammation induced by ultraviolet radiation.

[0032] 8. Use according to claim 7, characterized in that the ultraviolet radiation is UVB radiation.

[0033] Another aspect of the present invention provides a composition, which comprises the alpine pygmy frog antioxidant peptide or the nucleotide.

[0034] Furthermore, the composition also includes a pharmaceutically acceptable carrier

[0035] The drug provided by the present invention can be administered by injection, including intravenous injection, subcutaneous injection, intracavitary injection, etc.; mucosal administration, such as nasal administration; cavity administration, such as rectal administration, local effect or systemic effect through absorption. The above administration route is preferably intravenous administration.

[0036] The beneficial effects of the present invention are:

[0037] The present invention adopts in vitro free radical scavenging and DNA damage protection experiments, zebrafish oxidative stress tests, and mouse skin light damage experiments. The results show that the alpine black frog antioxidant peptide has good anti-inflammatory and antioxidant effects, can protect plasmid DNA damaged by H2O2, inhibit the accumulation of active oxygen in zebrafish larvae and the migration of neutrophils induced by CuSO4, and alleviate UVB radiation-induced mouse skin damage.

[0038] The alpine frog antioxidant peptide of the present invention can exert antioxidant effects in vivo and in vitro through multiple pathways. First, the alpine frog antioxidant peptide exerts antioxidant effects through free radical scavenging activity and DNA protection activity. Secondly, the alpine frog antioxidant peptide also exerts antioxidant and anti-inflammatory effects by inhibiting the chemotaxis of neutrophils. Finally, the alpine frog antioxidant peptide inhibits skin damage by inhibiting UVB-induced degradation of skin collagen fibers, inflammatory outbreaks and oxidative stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The HPLC purification and identification results of the anti-oxidative peptide of the alpine frog of the present invention;

[0040] Figure 2 The mass spectrometry identification results of the antioxidant peptides of the alpine frog of the present invention;

[0041] Figure 3 The antioxidant peptide of the alpine frog of the present invention is used to treat ABTS + Scavenging of free radicals and DPPH free radicals;

[0042] Figure 4 The protective effect of the alpine frog antioxidant peptide of the present invention on H2O2 damaging plasmid DNA;

[0043] Figure 5 The present invention is the inhibitory effect of the alpine frog antioxidant peptide on CuSO4-induced oxidative damage and inflammatory outbreak in zebrafish;

[0044] Figure 6 The protective effect of the alpine frog antioxidant peptide of the present invention on UVB-induced skin damage in mice;

[0045] Figure 7This is the effect of the alpine frog antioxidant peptide of the present invention on UVB-induced inflammatory factors in mouse skin. DETAILED DESCRIPTION

[0046] In order to understand the present invention more clearly, the present invention is further described with reference to the following examples and accompanying drawings. The examples are only used for explanation and are not intended to limit the present invention in any way. In the examples, each raw material reagent is commercially available, and the experimental methods without specifying specific conditions are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

[0047] Cathelicidin-Np (abbreviated as: Alpine dwarf frog antioxidant peptide) is a new type of antioxidant peptide identified from the skin of the alpine dwarf frog. The NCBI protein BLAST results show that the alpine dwarf frog antioxidant peptide belongs to the cathelicidin family of polypeptides. The secondary structure simulation results show that the α-helix is ​​the main feature of the structure of the alpine dwarf frog antioxidant peptide, and the rest of the structure is a random coil. The amphipathic α-helix structure can facilitate the binding of the peptide to the cell, providing a basis for the peptide to exert its biological activity.

[0048] The invention provides an antioxidant peptide derived from the skin of an alpine dwarf frog. The alpine dwarf frog antioxidant peptide is a cyclic peptide composed of 29 amino acids, has a molecular weight of 3166.70 daltons, an isoelectric point of 9.19, and an amino acid sequence of AlaGlyGlyLysLysGluCysLysAspTyrTyrCysArgLeuLeuThrLysLeuGlySerArgGlyHisIIeSerGlyValAspLeu(AGGKKECKDYYCRLLTKLGSRGHISGVDL) (as shown in SEQ ID NO.1), and the seventh cysteine ​​and the twelfth cysteine ​​of the polypeptide form an intramolecular disulfide bond.

[0049] The preparation process and application of the alpine frog antioxidant peptide and its gene of the present invention include the following aspects:

[0050] Example 1: Preparation of Antioxidant Peptides from Rana alpina

[0051] 1. Extraction of total RNA from the skin of the alpine frog: The living alpine frog was cleaned with water, frozen in liquid nitrogen for 4 hours, and about 200 mg of skin tissue was taken, and 10 mL of total RNA extraction buffer (Trizol solution, a product of GIBCOBRL, USA) was added, and homogenized in a 20 mL glass homogenizer for 30 minutes. An equal volume of phenol / chloroform solution was added, mixed vigorously, placed at room temperature for 10 minutes, centrifuged at 4°C, 12000 rpm for 10 minutes, and the precipitate was discarded. An equal volume of isopropanol was added to the supernatant, placed at room temperature for 10 minutes, centrifuged at 4°C, 12000 rpm for 10 minutes, and the precipitate was washed once with 75% ethanol and dried. The precipitate at the bottom of the tube was the total RNA of the skin.

[0052] 2. Purification of skin mRNA of Alpine dwarf frog: Skin mRNA was isolated and purified using the mRNA Isolation Systems kit of the American PROMEGA company. The details are as follows: 500μg of total RNA from the skin of Alpine dwarf frog was dissolved in 500μL DEPC water, placed in a 65℃ water bath for 10min, 3μL Oligo(dT) probe and 13μL 20×SSC solution were added, mixed, and cooled at room temperature, which is called solution A. The magnetic beads were flicked to mix, and adsorbed on the magnetic stand for 30S, the supernatant was discarded, 0.3mL of 0.5×SSC was added, and adsorbed on the magnetic stand for 30S, and finally 0.1mL of 0.5×SSC was added to suspend, which is called solution B. Add solution A to solution B, place at room temperature for 10 minutes, adsorb on the magnetic rack for 30 seconds, discard the supernatant, wash 4 times with 0.1×SSC, finally discard the supernatant, add 0.15mL DEPC water to suspend, adsorb on the magnetic rack for 30 seconds, transfer the supernatant to a new test tube, add 0.15mL DEPC water to resuspend, adsorb on the magnetic rack for 30S, transfer the supernatant to the above test tube, and the supernatant is the purified alpine pygmy frog skin mRNA. Add 1 / 10 volume of 3M sodium acetate, pH5.2, and an equal volume of isopropanol, place at -70℃ for 30 minutes, centrifuge at 4℃, 12000rpm for 10min, discard the supernatant, and dissolve the precipitate in 10μL DEPC water to obtain alpine pygmy frog skin mRNA.

[0053] 3. Construction of cDNA library of Rana alpina skin: The CreatorTM SMARTTM cDNA Library Construction Kit from CLONTECH was used.

[0054] A) First-strand cDNA synthesis (mRNA reverse transcription): Add 1 μL of Rana alpina skin mRNA, 1 μL of SMART IV oligonucleotide, 1 μL of CDS III / 3'PCR primer to a 0.5 mL sterile centrifuge tube, and add 2 μL of deionized water to make the total volume 5 μL. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 seconds, and keep at 72°C for 2 minutes. Incubate the centrifuge tube on ice for 2 minutes. Add the following reagents to the centrifuge tube: 2.0 μL of 5× first-strand buffer, 1.0 μL of 20 mM dithiothreitol, 1.0 μL of 10 mM dNTP mixture, and 1.0 μL of PowerScript reverse transcriptase. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 seconds, and keep at 42°C for 1 hour. Place the centrifuge tube on ice to terminate the synthesis of the first strand. Take 2 μL of the synthesized first-strand cDNA from the centrifuge tube for later use.

[0055] B) Amplify the second strand using the long-terminal polymerase chain reaction (LD-PCR) method: Preheat the PCR machine at 95°C. Add 2μL of the first strand of cDNA (mRNA reverse transcription), 80μL of deionized water, 10μL of 10×Advantage 2PCR buffer, 2μL of 50×dNTP mixture, 2μL of 5'PCR primer, 2μL of CDS III / 3'PCR primer, and 2μL of E. coli polymerase in a centrifuge tube for reaction. Amplify in the PCR machine according to the following program: 95°C 20sec, 95°C 5sec, 68°C 6min, 22 cycles. After the cycle is completed, extract the synthesized cDNA double strands in the centrifuge tube.

[0056] C) The PCR product was extracted and recovered using the SV Gel and PCR Clean-Up System kit from PROMEGA. The steps are as follows: Add an equal volume of membrane binding buffer to the cDNA double strand obtained by PCR and mix by inversion. Then transfer the mixture into a centrifugal purification column and let it stand at room temperature for 5 minutes to allow the DNA to fully bind to the silica gel membrane. Centrifuge at 12,000 rpm for 30 seconds and discard the waste liquid in the collection tube. Add 700 μL of eluent (containing ethanol) to the centrifugal purification column and centrifuge at 12,000 rpm for 30 seconds. Discard the waste liquid in the collection tube. Repeat the above steps. Centrifuge at 12,000 rpm for 5 minutes. Place the centrifugal purification column in a new centrifuge tube. Add 30 μL of ultrapure water and let it stand at room temperature for 5 minutes. Centrifuge at 12,000 rpm for 30 seconds. The solution at the bottom of the tube is the purified cDNA double strand.

[0057] D) Enzyme digestion, ligation, and transformation of ligation products: Add 1 μL of Takara pMD18-T vector and 4 μL of double-stranded cDNA solution of Rana alpina to a microcentrifuge tube, and the total amount is 5 μL. Add 5 μL of ligase buffer mixture. React at 16°C for 2 hours. Add the full amount (10 μL) to 100 μL DH5α competent cells and place on ice for 30 minutes. After heating at 42°C for 90 seconds, place on ice for another 1 minute. Add 890 μL of LB culture medium incubated at 37°C, and culture at 37°C with slow shaking for 60 minutes. Take 200 μL and spread it on LB culture medium containing XGal, IPTG, and Amp and culture at 37°C for 16 hours to form a single colony. Wash the colony with 5 mL of LB liquid culture medium for each LB plate and freeze it with 30% glycerol. The constructed cDNA contains approximately 1×10 6 A single clone.

[0058] 4. Screening of antimicrobial peptide gene cloning of Rana alpina: The universal nucleotide sequence-based primer 5'-WSCRCAGRYCTTCACCTCC-3' (SEQ ID NO.3) encoding the cathelin domain was used to clone and clone the cathelin domain of Rana alpina. TM The 5' PCR primer (5'-AAGCAGTGGTATCAACGCAGAGT-3') (SEQ ID NO. 4) in the cDNA library construction kit was paired to synthesize the 5' end nucleotide sequence of the antimicrobial peptide gene of Rana alpina. The PCR steps were: 95°C treatment for 4 minutes; 30 cycles: 95°C denaturation for 30 seconds, 56°C annealing for 30 seconds, and extension at 72°C for 1 minute. The final extension was at 72°C for 10 minutes. The PCR product (~300 bp) was purified by gel electrophoresis and cloned into the pMD18-T vector (Takara Biotechnology, Dalian, China) for sequencing.

[0059] After obtaining the 5' end nucleotide sequence of the antimicrobial peptide of the alpine dwarf frog, the primer sequence 5'-GGATGAAGACCTGGCAGTGTGTGTG-3' (SEQ ID NO.5) was synthesized and coupled with the 3' PCR primer CDSIII (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3') (SEQ ID NO.6). The complete gene of the antimicrobial peptide of the alpine dwarf frog was obtained by transcription with 100-fold dilution of the total cDNA. The PCR program was similar to the amplification of the 5' fragment, except that the annealing temperature was 52°C and the extension time was 45s in the cycle program. After the final extension and purification, the PCR product was finally sequenced.

[0060] 5. Sequence determination and results of the antimicrobial peptide gene of Rana alpina: The plasmid DNA was extracted and the nucleotide sequence was determined by the dideoxy method. The instrument used was the American Applied Biosystems 373A fully automatic nucleotide sequencer. The sequencing primers were BcaBESTTM Sequencing Primer RV-M and BcaBESTTM Sequencing Primer M13-47. The sequence of BcaBESTTM Sequencing Primer RV-M was: 5'GAGCGGATAACAATTTCACACAGG 3' (SEQ ID NO.7), and the sequence of BcaBESTTM Sequencing Primer M13-47 was: 5'CGCCAGGGTTTTCCCAGTCACGAC 3' (SEQ ID NO.8).

[0061] The gene sequencing results from 5' to 3' end sequence are as follows (SEQ ID NO.2):

[0062] atgaaggtctggcagtgtgcgctatggatctccgctctcacattgcaggcggctcgctctcagtctccggatcgggaagaatggatcagagaggccttggatctctacaaccag agggaagatggagagttcttctttaaattcctgtctgatctcccggccgcccccctggaggaggaaaacaatccgacaatcgcgttcttaataaaggagacggaatgcctgaaa tctgaagatatcaacttggaggaatgtgactacaagaaggacggggaggtgaaggtctgtggattgtacccggaggagaggggagacctcaaagactctgaaatgtgtcggcctg accaagaattctcgcaccaagcgagccggaggtaagaaggagtgcaaagattattactgtagactgctcacgaaacttggatcccgcggccacatctcaggcgtcgatctctga

[0063] The sequence table of the nucleotide sequence of the antimicrobial peptide gene of the alpine dwarf frog is as follows: sequence length is 456 bases; sequence type: nucleic acid; number of chains: single strand; topology: linear; sequence type: cDNA; source: skin of the alpine dwarf frog.

[0064] According to the gene of the antimicrobial peptide of the alpine pygmy frog, it is inferred that the nucleotides encoding the functionally mature antimicrobial peptide are 370-456 (SEQ ID NO.9), and the amino acid sequence is: AGGKKECKDYYCRLLTKLGSRGHISGVDL (see sequence SEQ ID NO.1).

[0065] The nucleotide sequence of the 370-456th antimicrobial peptide gene of Rana alpina (SEQ ID NO.9):

[0066] ggaggtaagaaggagtgcaaagattattactgtagactgctcacgaaacttggatcccgcggccacatctcaggcgtcgatctctga

[0067] Example 2: Preparation of Antioxidant Peptides from Rana alpina

[0068] 1. Preparation method of antioxidant peptides from Rana alpina

[0069] The functional mature antioxidant peptide amino acid sequence encoded by the gene of the alpine dwarf frog antioxidant peptide was inferred, and then the peptide was synthesized using an automatic peptide synthesizer. Desalting and purification were carried out by HPLC reverse phase C18 column chromatography. The disulfide bond was formed by air oxidation method, specifically, the polypeptide was dissolved in 0.1% acetic acid solution in a flask at 0.1 mg / ml, and then titrated to pH 7.8 with ammonium hydroxide, and then stirred at room temperature overnight. Desalting and purification were carried out by HPLC reverse phase C18 column chromatography. During purification, liquid A was 0.1% TFA + 100% CH3CN, and liquid B was 0.1% TFA + 100% H2O. The gradient method was that liquid A increased from 26% to 51% in 15 minutes, and the detection wavelength was 220nm. The purity of the purified alpine dwarf frog antibacterial peptide was identified by high performance liquid chromatography (HPLC), such as Figure 1 As shown, the peptide appeared at 10.822 minutes.

[0070] 2. Molecular weight was determined by fast atom bombardment mass spectrometry (FAB-MS), with glycerol: m-nitrobenzyl alcohol: dimethyl sulfoxide (1:1:1, V:V:V, volume ratio) as substrate, Cs+ as bombardment particle, current of 1μA, and emission voltage of 25KV. Figure 2 As shown, the molecular weight was calculated based on the mass spectrum to be 3166.70 Da.

[0071] 3. The alpine dwarf frog antioxidant peptide is a polypeptide encoded by the host defense peptide gene of the Chinese amphibian alpine dwarf frog. It is a polypeptide composed of 29 amino acids, with a molecular weight of 3166.70 Daltons, an isoelectric point of 9.19, and an amino acid sequence: AlaGlyGlyLysLysGluCysLysAspTyrTyrCysArgLeuLeuThrLysLeuGlySerArgGlyHisIIeSerGlyValAspLeu(AGGKKECKDYYCRLLTKLGSRGHISGVDL)(SEQ ID NO.1), in which the seventh cysteine ​​and the twelfth cysteine ​​form an intramolecular disulfide bond.

[0072] Example 3: In vitro antioxidant activity detection of Rana alpina antioxidant peptides

[0073] 1. Antioxidant peptides from alpine frogs to ABTS + , the influence of DPPH free radical scavenging rate

[0074] ABTS + Free radical scavenging activity was tested by the total antioxidant capacity test kit (ABTS method) of Bio-Tech Products with slight modifications (Product No.: S0119). Prepare peptides and Trolox solutions of different concentrations as required and test the ABTS activity of the peptides. + Relationship between free radical scavenging ability and concentration and time.

[0075] DPPH free radical scavenging ability: Dissolve DPPH powder in anhydrous ethanol to prepare a DPPH solution with a concentration of 0.25 mg / mL. Store in dark. Add 90 μL of the prepared DPPH solution to a 96-well plate, add 10 μL of the alpine frog antioxidant peptide to the peptide treatment group, add an equal volume of deionized water to the negative control group, and add an equal volume of Trolox to the positive control group. Place at room temperature in dark for 30 minutes. Use an ELISA reader to measure the absorbance at a wavelength of 517 nm. Calculate the scavenging rate of each sample for DPPH free radicals according to the following formula:

[0076]

[0077] A 对照 : Equal volume of deionized water A 样品 :10μL of different concentrations of peptide or Trolox

[0078] like Figure 3 As shown, the effects of different concentrations of Rana alpina antioxidant peptides (final concentrations of 0, 2.5, 5, 10, 20 and 40 μM) on ABTS +The scavenging ability of DPPH free radicals was tested, and water-soluble vitamin E (Trolox) (final concentrations of 0, 2.5, 5, 10, 20 and 40 μM) was used as a positive control. The results showed that the antioxidant peptide of the alpine frog had strong free radical scavenging activity and was concentration-dependent. However, the scavenging rate of DPPH free radicals was much lower than that of ABTS. + The scavenging rate of free radicals. This may be because DPPH is prepared with anhydrous ethanol, which is suitable for fat-soluble antioxidants. The anhydrous ethanol environment may affect the polypeptide structure and thus affect the free radical scavenging ability of the polypeptide.

[0079] 2. Protective effect of antioxidant peptides from Rana alpina against H2O2-damaged plasmid DNA

[0080] H2O2 DNA damage experiment: Weigh 242g of tris(hydroxymethyl)aminomethane (Trisbase) and 37.2g of ethylenediaminetetraacetic acid (EDTA) in a 1000mL beaker. Add 600mL of deionized water, stir until completely dissolved, add 57.1mL of glacial acetic acid and mix well. Add deionized water to make the solution dilute to 1L, prepare TAE buffer (50×) and store at room temperature. When using, dilute to 1× with deionized water. Weigh 1g of agarose, add to 100mL TAEbuffer solution, use a microwave to heat to completely dissolve the agarose, prepare 1% agarose gel, seal both ends of the electrophoresis template, pour in the agarose gel solution, and insert a comb. Cool to room temperature to solidify. Take a reaction mixture of 5μL PBS (10mM, pH7.4) + 1μL pPIC9K (final concentration of 0.5μg / μL) + 5μL polypeptide (final concentration of 0, 2.5, 5, 10, 20 and 40μM) + 2μL H2O2 (final concentration of 1.0mM) and incubate at 37°C for 30min. Then add 2uL Loading buffer (50% glycerol (v / v), 40mM EDTA and 0.05% bromophenol blue) to stop the reaction. The reaction mixture was electrophoresed at 60V for 50min in 1×TAE buffer containing ethidium bromide (0.5μg / mL). Observe and take pictures under UV light. Figure 4 As shown, the antioxidant peptides from Rana alpina could inhibit H2O2-induced plasmid DNA damage in a concentration-dependent manner. The results showed that the antioxidant peptides from Rana alpina had the effect of protecting DNA from oxidative damage.

[0081] Example 4: Effects of Rana alpina antioxidant peptides on copper sulfate-induced oxidative stress in zebrafish

[0082] 1. Detection of reactive oxygen levels in zebrafish induced by copper sulfate: Zebrafish larvae three days after fertilization (3dpf) were transferred to 12-well plates containing 940μL embryo culture medium, with 8 per well. Different doses of Alpine frog antioxidant peptides (final concentrations of 2.5, 5, and 10μM) were pre-incubated with zebrafish larvae for 1h. An equal volume of deionized water was added to the blank control group and the negative control group. CuSO4 solution (final concentration of 20μM) was added for 20min to induce oxidative stress. An equal volume of deionized water was added to the blank control group. The zebrafish larvae were then washed twice with fresh larval culture medium to remove residual CuSO4. DCFH-DA solution (final concentration of 10μM) was cultured in a dark environment at 28°C for 1h. After incubation, the zebrafish larvae were washed 3 times with fresh larval culture medium to remove residual DCFH-DA dye and reduce background fluorescence values. Anesthetized with 0.0003% MS-222 (tricaine methane sulfonate) and then transferred to a slide. Observed and photographed under a fluorescence microscope. Each larva was placed on its side. The fluorescence intensity of individual larvae was quantified using Autovision software and BDpathway855 system (BD Biosciences). Zebrafish larvae treated with deionized water alone served as blank controls, and zebrafish larvae treated with CuSO4 alone served as negative controls. The experiment was repeated three times.

[0083] 2. Detection of zebrafish neutrophil chemotaxis level: Tg (lyz: DsRed2) transgenic zebrafish larvae were transferred to 12-well plates containing 940 μL embryo culture medium, with 8 per well. Different doses of Alpine frog antioxidant peptides (final concentrations of 2.5, 5 and 10 μM) were pre-incubated with zebrafish larvae for 1 hour. An equal volume of deionized water was added to the blank control group and the negative control group. CuSO4 solution (final concentration of 20 μM) was added for 20 minutes to induce oxidative stress. An equal volume of deionized water was added to the blank control group. The zebrafish larvae were then washed twice with fresh culture medium to remove residual CuSO4. Anesthetized with 0.0003% MS-222 and then transferred to a slide. Observed and photographed under a fluorescence microscope. Each zebrafish larva was placed on its side.

[0084] like Figure 5 As shown in A and 5B, the antioxidant peptide of Rana alpina can significantly inhibit the increase of ROS level in zebrafish larvae induced by CuSO4 in a concentration-dependent manner. The results show that the antioxidant peptide of Rana alpina has a strong antioxidant effect both in vivo and in vitro. The inflammatory model of transgenic zebrafish Tg (lyz:DsRed2) expressing red fluorescent protein on neutrophils induced by CuSO4. Figure 5 As shown in C and 5D, the antioxidant peptide from the alpine dwarf frog inhibited the CuSO4-induced neutrophil migration in a concentration-dependent manner, indicating that the antioxidant peptide from the alpine dwarf frog has an anti-inflammatory effect in vivo.

[0085] Example 5: Effects of Rana alpina antioxidant peptides on UVB-induced skin photodamage in mice

[0086] 1. Effects of antioxidant peptides from Rana alpina on UVB-induced skin photodamage in mice

[0087] Construction of UVB radiation mouse photodamage model: First, depilatory cream (Veet, Hubei, China) was used to remove hair from the dorsal skin (2 × 3 cm) of each mouse. 2 ) for hair removal to facilitate subsequent UV stimulation. Except for the normal group, all other groups of mice were exposed to UVB light (PL-s9w / 2P, Philips, The Netherlands) at 0.1 mW / cm 2 The intensity of the radiation was irradiated for 1.5 h and monitored using a UVB radiometer (LS125+UVB, China). Cathelicidin-Np and Vc were dissolved in PBS. After intradermal injection of peptides and vitamin C, UVB radiation was immediately performed. After 48 h, the mice were anesthetized by intravenous injection of 100 mL of a solution containing 1% sodium pentobarbital (0.1 mL / 20 g). The skin was photographed, and then the skin tissue was collected and placed at -80 °C for subsequent experiments. Figure 6 As shown in A, compared with the PBS vehicle-treated control, after 48 h of UVB irradiation, the back skin of mice showed obvious damage, erythema and edema. Compared with the UVB-treated group, the mice treated with the antioxidant peptides of the alpine frog and Vc significantly alleviated these symptoms. Figure 6 As shown in B and 6C, compared with mice not irradiated with UVB (Ctrl), the number of epidermal cells in UVB-irradiated mice decreased and the cell nuclei were fragmented. The alpine frog antioxidant peptide and Vc treatment groups significantly inhibited the apoptosis of epidermal cells in UVB-irradiated mice. Figure 6 As shown in D, Masson trichrome staining showed that UVB irradiation caused degradation of skin collagen fibers, but the administration of Rana alpina antioxidant peptides and Vc could effectively reverse the degradation of collagen fibers.

[0088] 2. Effects of antioxidant peptides from Rana alpina on antioxidant enzymes in the skin of UVB-irradiated mice

[0089] Malondialdehyde (MDA) detection: Weigh the mouse skin samples collected during modeling, add PBS at a volume-to-weight ratio (9:1), grind the mouse skin thoroughly, and obtain the mouse skin homogenate supernatant. Use TBA preparation solution to prepare an appropriate amount of TBA into a 0.37% storage solution. Mix 3mL TAB diluent, 1mL TAB storage solution, and 60μL antioxidant in a 10mL centrifuge. Add 100μL PBS as a blank control to different centrifuge tubes, add 100μL of the sample to be tested, and then add 200μL MDA detection working solution and mix well. Heat at 100℃ for 15min. Cool to room temperature and centrifuge at 2500rpm for 10min. Take the supernatant, add 200μL / well to a 96-well plate, and detect the absorbance at 532nm with an enzyme reader.

[0090] Superoxide dismutase (SOD) detection: Remove blood from mouse skin with saline containing sodium heparin (0.16 mg / mL). Homogenize with 10 mg tissue / 100 μL SOD sample preparation solution. Centrifuge at 4°C, 12000 rpm for 5 minutes and collect the supernatant. Add 7.550 mL SOD detection buffer, 400 μL WST-8, and 50 μL enzyme solution to a 10 mL enzyme-free centrifuge tube in sequence and mix well. Add 25 μL reaction start solution (40×) and 975 μL SOD detection buffer to a 1.5 mL centrifuge tube and mix well. Add the sample to be tested and other working solutions to the 96-well plate according to the requirements in the table below and mix thoroughly. Incubate at 37°C for 30 minutes. Use an enzyme reader to detect the absorbance at 450 nm.

[0091]

[0092]

[0093] Catalase (CAT) detection: The catalase activity of the skin homogenate sample was determined using the Beyotime Catalase Detection Kit (#S0051, Beyotime). Mouse skin tissue was ground with the Western and IP cell lysate (P0013) produced by Beyotime at a weight-volume ratio of 10 mg / 100 μL. Place at 4°C for 10 min, centrifuge at 4°C, 12000 rpm for 10 min, and take the supernatant. Prepare 250 mM hydrogen peroxide solution, 5 mM hydrogen peroxide solution, color working solution, and hydrogen peroxide standard solution according to the instructions. Add 40 μL of catalase detection buffer to a new clean enzyme-free centrifuge tube, then add 10 μL of the mixture in the above steps and mix well. Add 10 μL of sample / well to each centrifuge tube in a 96-well plate. Add 200 μL of color working solution. Incubate at 25°C for 15 min and measure the absorbance at 520 nm.

[0094] like Figure 6As shown in EH, in the skin of mice irradiated by UVB, the levels of SOD, GSH and CAT were significantly reduced, and the level of MDA increased. The group treated with Rana alpina antioxidant peptide and Vc effectively inhibited the reduction of SOD, CAT and GSH induced by UVB, and inhibited the increase of MDA level, thereby reducing the oxidative damage of UVB to skin tissue.

[0095] 3. Effects of antioxidant peptides from Rana alpina on inflammatory factors in the skin of UVB-irradiated mice

[0096] The effects of antioxidant peptides from Rana alpina on the production of inflammatory factors in the skin of UVB-irradiated mice were examined. Figure 7 As shown, in the skin of mice exposed to ultraviolet light, the gene and protein levels of TNF-a, IL-6, and IL-1β were significantly increased, while the gene and protein levels of UVB-induced inflammatory factors were significantly inhibited by treatment with antioxidant peptides and Vc from the alpine frog.

[0097] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. An antioxidant peptide from Rana alpina, characterized in that: The alpine frog antioxidant peptide is a cyclic peptide composed of 29 amino acids, and its amino acid sequence is shown in SEQ ID NO.

1. The seventh cysteine ​​and the twelfth cysteine ​​form an intramolecular disulfide bond.

2. The alpine frog antioxidant peptide according to claim 1, characterized in that The alpine frog antioxidant peptide is prepared by a biological method or synthesized by a chemical method.

3. A nucleotide encoding the antioxidant peptide of the alpine frog according to claim 1.

4. The nucleotide according to claim 3, characterized in that The nucleotide sequence encoding the alpine black frog antioxidant peptide according to claim 1 is shown as SEQ ID NO.2 or SEQ ID NO.

9.

5. A reagent, characterized in that The reagent contains any one of 1) to 8): 1) The nucleotide according to claim 3; 2) An expression cassette containing the nucleotide sequence of claim 3; 3) A recombinant vector containing the nucleotide sequence of claim 3; 4) a recombinant vector containing the expression cassette described in 2); 5) A recombinant microorganism containing the nucleotide according to claim 3; 6) A recombinant microorganism containing the expression cassette described in 2); 7) A recombinant microorganism containing the recombinant vector described in 3); 8) A recombinant microorganism containing the recombinant vector described in 4).

6. Use of the alpine frog antioxidant peptide according to claim 1 or the nucleotide according to claim 3 in any of the following: 1) Preparation of antioxidant or anti-inflammatory drugs, health products, skin care products or cosmetics; 2) Preparation of cleared ABTS + and / or DPPH free radical preparations; 3) preparing preparations that reduce DNA damage caused by oxidative damage; 4) Prepare a preparation that inhibits CuSO4-induced oxidative stress and neutrophil migration in zebrafish.

7. Use of the alpine frog antioxidant peptide according to claim 1 or the nucleotide according to claim 3 in any of the following: 1) Preparation of medicines, health products, skin care products or cosmetics for preventing and / or treating skin damage or aging induced by ultraviolet radiation; 2) Preparation of drugs, health products, skin care products or cosmetics for inhibiting ultraviolet radiation-induced degradation of skin collagen fibers; 3) Preparation of drugs, health products, skin care products or cosmetics for inhibiting ultraviolet radiation-induced oxidative damage to skin tissue; 4) Preparation of medicines, health products, skin care products or cosmetics for inhibiting skin inflammation induced by ultraviolet radiation.

8. The use according to claim 7, characterized in that: The ultraviolet radiation is UVB radiation.

9. A composition, characterized in that The composition comprises the alpine frog antioxidant peptide according to claim 1 or the nucleotide according to claim 3.

10. The composition according to claim 9, characterized in that The composition also includes a pharmaceutically acceptable carrier.

Images