A high mountain microhylidae antioxidant peptide and application thereof
By preparing and applying antioxidant peptides from the alpine dwarf frog, the problem of insufficient research on antioxidant peptides of this species in existing technologies has been solved, achieving effective protection and repair of skin damage caused by ultraviolet radiation, and exhibiting significant antioxidant and anti-inflammatory effects.
Patent Information
- Application Number
- CN202510310524.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-17
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-03-17
AI Technical Summary
There is insufficient research on antioxidant peptides from the alpine frog in existing technologies, especially their potential role in resisting ultraviolet damage has not been fully explored. Furthermore, existing research on antioxidant peptides mainly focuses on their free radical scavenging ability, and there is a lack of effective drugs or cosmetics for the treatment of skin photoaging.
An antioxidant peptide composed of 29 amino acids from the alpine frog is provided. The amino acid sequence is shown in SEQ ID NO. 1. It has intramolecular disulfide bonds, is prepared by biological or chemical methods, and encodes nucleotides for use in the preparation of antioxidant or anti-inflammatory drugs and skin care products. It can scavenge free radicals, protect DNA, and inhibit the degradation of skin collagen fibers and inflammation.
The antioxidant peptides from the alpine dwarf frog exhibit significant antioxidant and anti-inflammatory effects. They can scavenge free radicals, protect DNA, inhibit UVB-induced skin damage and collagen fiber degradation, and alleviate skin inflammation. They can be used to prevent and treat skin damage caused by ultraviolet radiation.
Smart Images

Figure CN119899256B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the pharmaceutical field, specifically to an antioxidant peptide from the alpine frog and its applications. Background Technology
[0002] Skin aging is a phenomenon caused by natural or unnatural factors, and can be divided into endogenous aging and exogenous aging based on its cause. Causes of exogenous skin aging include long-term ultraviolet (UV) radiation, harsh climate and environment, poor lifestyle habits, and excessive work stress, among which UV radiation is the most common and primary cause of skin aging.
[0003] Ultraviolet (UV) radiation is a portion of the electromagnetic radiation spectrum emitted by the sun, with wavelengths ranging from 100 to 400 nm. Based on wavelength, UV radiation can be divided into three parts: UVC (100-280 nm), UVB (280-315 nm), and UVA (315-400 nm). The ozone layer completely absorbs UVC and absorbs most of UVB. Therefore, of the UV radiation entering the Earth's atmosphere, 95% is UVA wavelength, and the remaining 5% is UVB. UVA is the longest wavelength form of UV radiation and is the wavelength that primarily causes skin aging and wrinkles. Compared to UVA, less UVB penetrates the Earth's ozone layer, but UVB is 1000 times more biologically active than UVA. Numerous studies have shown that long-term or excessive exposure to UVB radiation leads to the formation of free radicals, resulting in damage to lipids, proteins, and other components in the skin, as well as changes in gene expression levels. Once this damage exceeds the skin's antioxidant system's repair capacity, it can lead to acute inflammation, photoaging, and skin diseases such as skin cancer. Therefore, it is necessary to develop drugs or cosmetics that can repair skin damage induced by ultraviolet radiation.
[0004] Currently, the main antioxidant measures developed for skin photoaging are as follows: (1) Application of antioxidants: Use local antioxidants to neutralize free radicals and reduce oxidative damage, such as vitamin C, vitamin E, selenium, green tea polyphenols, etc. Promote the synthesis of endogenous antioxidants in the skin, such as glutathione, superoxide dismutase (SOD) and catalase (CAT). (2) Enhancement of DNA repair mechanisms: Promote DNA repair pathways such as nucleotide excision repair (NER), base excision repair (BER) and mismatch repair (MMR) to repair DNA damage caused by UV. Use ingredients such as nicotinamide (vitamin B3) to activate DNA repair enzymes and improve cell repair capacity. (3) Anti-inflammatory effects: Use nonsteroidal anti-inflammatory drugs (NSAIDs), steroids and other drugs to reduce the inflammatory response caused by UV. Apply local anti-inflammatory ingredients, such as salicylic acid and hyaluronic acid, to reduce the release of inflammatory mediators. (4) Protection and regeneration of collagen and elastin: Retinol (a vitamin A derivative), peptide growth factors, etc. are used to promote the synthesis of collagen and elastin and improve skin elasticity. The activity of metalloproteinases (MMPs) is inhibited, reducing the degradation of collagen and elastin.
[0005] Amphibians (especially frogs) serve as natural reservoirs of bioactive peptides. Their exposed skin is directly exposed to ultraviolet radiation, giving them a more robust intrinsic antioxidant system compared to other vertebrates with physical shielding (such as feathers or scales). However, only a limited number of studies have been reported on antioxidant peptides in amphibians. Furthermore, it is noteworthy that the bioactivities of antioxidant peptides are diverse. For example, GL-21 (from *Odorrana andersonii*), cathelicidin-OA1 (from *Odorrana andersonii*), and Gj-CATH3 (from *Gekkojaponicus*) possess free radical scavenging and wound-healing activities. PN-CATH1 and PN-CATH2 (from *Pelophylax nigromaculata*) possess both free radical scavenging and antibacterial activities. However, most research on these antioxidant peptides focuses on their free radical scavenging abilities, with very little research into their potential pharmacological value and mechanisms of action. Currently… Only a few frog-derived antioxidant peptides have been reported to protect against UV radiation damage. For example, FW-1 and FW-2 (from *Hylaannectans*) show potential antioxidant activity by inhibiting UVB-induced reactive oxygen species (ROS) production. OM-G15 (from *Odorrana margaretae*) can protect epidermal cells from UVB-induced apoptosis by downregulating Bax and upregulating Bcl-2 to inhibit DNA damage. However, the discovery and research of amphibian-derived antioxidant peptides still require further advancement.
[0006] *Nanorana parkeri*, a species of frog in the family Ranidae, is the most common amphibian in Tibet, primarily distributed around lakes, streams, and rivers on the Qinghai-Tibet Plateau. It is also found in Pakistan and northwestern Nepal (Amphibians of China: https: / / www.amphibiachina.org / search / ). Compared to plains at the same latitude, Tibet experiences 1-3 times more solar radiation. As the highest-altitude frog species in the world, the exposed skin of *Nanorana parkeri* makes it more sensitive to ultraviolet radiation. Compared to its lower-altitude relatives, *Nanorana parkeri* exhibits stronger resistance to UV damage. However, research on whether *Nanorana parkeri* resists UV damage through antioxidant peptides is insufficient. Furthermore, only three antimicrobial peptides derived from *Nanorana parkeri* with antibacterial activity—Japonicin-1Npa, Japonicin-1Npb, and Parkerin—have been reported. Therefore, the applicant believes that there are still undiscovered bioactive substances in this species that have been identified and described, particularly HDPs with antioxidant and antimicrobial activities. Summary of the Invention
[0007] To address the shortcomings of existing technologies, the purpose of this invention is to provide an antioxidant peptide from the alpine frog and its applications.
[0008] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0009] This invention provides an antioxidant peptide from the alpine pygmy frog, which is a cyclic peptide composed of 29 amino acids, as shown in SEQ ID NO. 1. The cysteine residues at positions 7 and 12 form an intramolecular disulfide bond. Secondary structure simulation results show that this alpine pygmy frog antioxidant peptide exhibits an α-helix structure, with the remaining structures being random coils.
[0010] Furthermore, the alpine frog antioxidant peptides are prepared by biological methods or synthesized by chemical methods.
[0011] In another aspect, the present invention provides a nucleotide encoding the antioxidant peptide of the alpine frog.
[0012] Furthermore, the nucleotide sequence encoding the antioxidant peptide of the alpine dwarf frog is shown in SEQ ID NO. 2 or SEQ ID NO. 9.
[0013] In another aspect, the present invention provides a reagent comprising any one of 1) to 8):
[0014] 1) The nucleotides mentioned above;
[0015] 2) An expression cassette containing the nucleotides;
[0016] 3) A recombinant vector containing the aforementioned nucleotides;
[0017] 4) A recombinant vector containing the expression cassette described in 2);
[0018] 5) Recombinant microorganisms containing the aforementioned nucleotides;
[0019] 6) Recombinant microorganisms containing the expression cassette described in 2);
[0020] 7) Recombinant microorganisms containing the recombinant vector described in 3);
[0021] 8) Recombinant microorganisms containing the recombinant vector described in 4).
[0022] In another aspect, the present invention provides the use of the said alpine frog antioxidant peptide or the said nucleotide in any of the following:
[0023] 1) To prepare antioxidant or anti-inflammatory drugs, skin care products, or cosmetics;
[0024] 2) Preparation of ABTS removal + Preparations containing and / or DPPH free radicals;
[0025] 3) Prepare formulations to mitigate DNA damage caused by oxidative stress;
[0026] 4) Prepare a formulation to inhibit CuSO4-induced oxidative stress and neutrophil migration in zebrafish.
[0027] In another aspect, the present invention provides the use of the said alpine frog antioxidant peptide or the said nucleotide in any of the following:
[0028] 1) To prepare drugs, skin care products or cosmetics for the prevention and / or treatment of skin damage or aging induced by ultraviolet radiation;
[0029] 2) To prepare drugs, skin care products, or cosmetics that inhibit ultraviolet radiation-induced degradation of skin collagen fibers;
[0030] 3) To prepare drugs, skin care products, or cosmetics that inhibit ultraviolet radiation-induced oxidative damage to skin tissue;
[0031] 4) Prepare drugs, skin care products or cosmetics that inhibit ultraviolet radiation-induced skin inflammation.
[0032] 8. The application according to claim 7, wherein the ultraviolet radiation is UVB radiation.
[0033] In another aspect, the present invention provides a composition comprising the aforementioned alpine frog antioxidant peptide or the aforementioned nucleotide.
[0034] Furthermore, the composition further includes a pharmaceutically acceptable carrier.
[0035] The drug provided by this invention can be administered via: injection, including intravenous injection, subcutaneous injection, and intracavitary injection; mucosal administration, such as nasal administration; or intracavitary administration, such as rectal administration, with local onset of action or systemic effect after absorption. The preferred route of administration is intravenous administration.
[0036] The beneficial effects of this invention are as follows:
[0037] This invention employs in vitro free radical scavenging and DNA damage protection experiments, zebrafish oxidative stress experiments, and mouse skin photodamage experiments. The results show that the antioxidant peptides of the alpine frog have good anti-inflammatory and antioxidant effects, can protect plasmid DNA damaged by H2O2, inhibit CuSO4-induced accumulation of reactive oxygen species and neutrophil migration in zebrafish larvae, and alleviate UVB radiation-induced skin damage in mice.
[0038] The alpine dwarf frog antioxidant peptides of this invention exert antioxidant effects both in vivo and in vitro through multiple pathways. First, these peptides exert their antioxidant effects through free radical scavenging and DNA protection activities. Second, they also exert antioxidant and anti-inflammatory effects by inhibiting neutrophil chemotaxis. Finally, they inhibit skin damage by suppressing UVB-induced degradation of skin collagen fibers, inflammatory responses, and oxidative stress. Attached Figure Description
[0039] Figure 1 The HPLC purification and identification results of the antioxidant peptides from the alpine frog of the present invention are shown.
[0040] Figure 2 This is the mass spectrometry identification result of the antioxidant peptides from the alpine frog in this invention;
[0041] Figure 3 The antioxidant peptides from the alpine frog of this invention are effective against ABTS. + Scavenging effect of free radicals and DPPH free radicals;
[0042] Figure 4 This invention demonstrates the protective effect of the alpine frog antioxidant peptide against H2O2-damaged plasmid DNA.
[0043] Figure 5 This invention relates to the inhibitory effect of the alpine frog antioxidant peptide on CuSO4-induced oxidative damage and inflammatory outbreak in zebrafish.
[0044] Figure 6 This invention demonstrates the protective effect of alpine frog antioxidant peptides against UVB-induced skin damage in mice.
[0045] Figure 7The present invention relates to the effect of the antioxidant peptide from the alpine frog on UVB-induced inflammatory factors in mouse skin. Detailed Implementation
[0046] To better understand the present invention, it is now further described with reference to the following embodiments and accompanying drawings. The embodiments are for illustrative purposes only and do not limit the invention in any way. In the embodiments, all original reagents and materials are commercially available, and experimental methods not specifically specified are conventional methods and conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.
[0047] Cathelicidin-Np (abbreviated as: Alpine pygmy frog antioxidant peptide) is a novel antioxidant peptide identified from the skin of the Alpine pygmy frog. NCBI protein BLAST results indicate that the Alpine pygmy frog antioxidant peptide belongs to the Cathelicidin family of polypeptides. Secondary structure simulation results show that the α-helix is the main structural feature of the Alpine pygmy frog antioxidant peptide, with the remaining structures being random coils. The amphiphilic α-helix structure facilitates the peptide's binding to cells, providing a basis for its biological activity.
[0048] This invention provides an antioxidant peptide derived from the skin of the alpine dwarf frog. This alpine dwarf frog antioxidant peptide is a cyclic peptide composed of 29 amino acids, with a molecular weight of 3166.70 Daltons and an isoelectric point of 9.19. Its amino acid sequence is: AlaGlyGlyLysLysGluCysLysAspTyrTyrCysArgLeuLeuThrLysLeuGlySerArgGlyHisIIeSerGlyValAspLeu (AGGKKECKDYYCRLLTKLGSRGHISGVDL) (as shown in SEQ ID NO. 1). The cysteine residues at positions 7 and 12 of the above peptide form an intramolecular disulfide bond.
[0049] The preparation process and application of the alpine dwarf frog antioxidant peptide and its gene of the present invention include the following aspects:
[0050] Example 1: Preparation of antioxidant peptides from the alpine frog
[0051] 1. Total RNA extraction from the skin of the Alpine pygmy frog: Live Alpine pygmy frogs were cleaned with water and flash-frozen in liquid nitrogen for 4 h. Approximately 200 mg of skin tissue was collected and 10 mL of total RNA extraction buffer (Trizol solution, GIBCOBRL, USA) was added. The mixture was homogenized in a 20 mL glass homogenizer for 30 min. An equal volume of phenol / chloroform solution was added, and the mixture was vigorously mixed. The mixture was incubated at room temperature for 10 min, then centrifuged at 12,000 rpm for 10 min at 4 °C, and the precipitate was discarded. An equal volume of isopropanol was added to the supernatant, and the mixture was incubated at room temperature for 10 min, then centrifuged at 12,000 rpm for 10 min at 4 °C. The precipitate was washed once with 75% ethanol, air-dried, and the precipitate at the bottom of the tube was the total RNA from the skin.
[0052] 2. Purification of skin mRNA from *Phoebe zhennan*: Skin mRNA isolation and purification were performed using the mRNA Isolation Systems kit from PROMEGA (USA). Specifically: 500 μg of total RNA from *Phoebe zhennan* skin was dissolved in 500 μL of DEPC water and incubated at 65°C for 10 min. 3 μL of Oligo(dT) probe and 13 μL of 20×SSC solution were added, mixed well, and allowed to cool to room temperature; this was called solution A. The mixture was then gently tapped with magnetic beads until adsorption on a magnetic rack lasted 30 s. The supernatant was discarded, and 0.3 mL of 0.5×SSC was added until adsorption on the magnetic rack lasted 30 s. Finally, 0.1 mL of 0.5×SSC was added to suspend the mixture; this was called solution B. Add solution A to solution B, incubate at room temperature for 10 minutes, and allow to adhere to a magnetic rack for 30 seconds. Discard the supernatant, wash four times with 0.1×SSC solution, and discard the supernatant again. Add 0.15 mL of DEPC-treated water to suspend the supernatant, allow to adhere to a magnetic rack for 30 seconds, transfer the supernatant to a new tube, add another 0.15 mL of DEPC-treated water to resuspend the supernatant, allow to adhere to a magnetic rack for 30 seconds, and transfer the supernatant back to the previous tube. The supernatant contains purified *Pterocarya stenoptera* skin mRNA. Add 1 / 10 volume of 3M sodium acetate (pH 5.2) and an equal volume of isopropanol, incubate at -70°C for 30 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, discard the supernatant, and dissolve the precipitate in 10 μL of DEPC-treated water to obtain *Pterocarya stenoptera* skin mRNA.
[0053] 3. Construction of cDNA library from the skin of the alpine dwarf frog: The plasmid cDNA library was constructed using the CLONTECH Creator™ SMART™ cDNA Library Construction Kit.
[0054] A) cDNA First-Strand Synthesis (mRNA Reverse Transcription): Add 1 μL of *Phoebe pilosa* skin mRNA, 1 μL of SMART IV oligonucleotides, and 1 μL of CDS III / 3' PCR primers to a 0.5 mL sterile centrifuge tube, and add 2 μL of deionized water to bring the total volume to 5 μL. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 sec, then incubate at 72°C for 2 min. Incubate the centrifuge tube on ice for 2 min. Add the following reagents to the centrifuge tube: 2.0 μL of 5× first-strand buffer, 1.0 μL of 20 mM dithiothreitol, 1.0 μL of 10 mM dNTP mixture, and 1.0 μL of PowerScript reverse transcriptase. Mix the reagents in the centrifuge tube and centrifuge at 12000 rpm for 15 sec, then incubate at 42°C for 1 h. Place the centrifuge tube on ice to stop the first-strand synthesis. Take 2 μL of the synthesized cDNA first strand from the centrifuge tube for later use.
[0055] B) Second-strand amplification using long-terminal polymerase chain reaction (LD-PCR): The PCR instrument was preheated to 95°C. A centrifuge tube containing 2 μL of first-strand cDNA (mRNA reverse transcription), 80 μL of deionized water, 10 μL of 10×Advantage 2 PCR buffer, 2 μL of 50×dNTP mixture, 2 μL of 5' PCR primers, 2 μL of CDS III / 3' PCR primers, and 2 μL of E. coli polymerase was reacted. Amplification was performed in the PCR instrument according to the following program: 95°C for 20 sec, 95°C for 5 sec, 68°C for 6 min, for 22 cycles. After the cycles, the synthesized double-stranded cDNA was extracted from the centrifuge tube.
[0056] C) PCR products were extracted and recovered using the PROMEGA SV Gel and PCR Clean-Up System kit, following these steps: Add an equal volume of membrane binding buffer to the PCR-obtained cDNA double strands and mix thoroughly by inversion. Transfer the mixture to a centrifuge column and incubate at room temperature for 5 minutes to allow the DNA to fully bind to the silica membrane. Centrifuge at 12000 rpm for 30 seconds and discard the waste liquid in the collection tube. Add 700 μL of elution buffer (containing ethanol) to the centrifuge column and centrifuge at 12000 rpm for 30 seconds, discarding the waste liquid in the collection tube. Repeat the above steps. Centrifuge at 12000 rpm for 5 minutes. Place the centrifuge column in a new centrifuge tube. Add 30 μL of ultrapure water and incubate at room temperature for 5 minutes. Centrifuge at 12000 rpm for 30 seconds; the solution at the bottom of the tube is the purified cDNA double strands.
[0057] D) Enzyme digestion, ligation, and transformation of the ligation product: Add 1 μL of Takara pMD18-T vector and 4 μL of *Pleurotus ostreatus* cDNA double-stranded solution to a microcentrifuge tube, bringing the total volume to 5 μL. Add 5 μL of ligase buffer mixture. Incubate at 16°C for 2 h. Add the total volume (10 μL) to 100 μL of DH5α competent cells and incubate on ice for 30 min. Heat at 42°C for 90 sec, then incubate on ice for 1 min. Add 890 μL of LB medium incubated at 37°C and incubate with gentle shaking at 37°C for 60 min. Spread 200 μL onto LB medium containing XGal, IPTG, and Amp and incubate at 37°C for 16 h to form single colonies. Wash each LB plate with 5 mL of LB liquid medium and freeze with 30% glycerol. The constructed cDNA contains approximately 1 × 10⁻⁶ cells / mL. 6 A single clone.
[0058] 4. Cloning and screening of the antioxidant peptide gene from the alpine pygmy frog: The universal nucleotide sequence base primer 5'-WSCRCAGRYCTTCACCTCC-3' (SEQ ID NO. 3), encoding the cathelin domain, was paired with the 5' PCR primer (5'-AAGCAGTGGTATCAACGCAGAGT-3') (SEQ ID NO. 4) from the SMART™ cDNA library construction kit to synthesize the 5' nucleotide sequence of the alpine pygmy frog antioxidant peptide gene. The PCR procedure was as follows: 95°C for 4 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 1 minute. The final extension was performed at 72°C for 10 minutes. The PCR product (~300 bp) was purified by gel electrophoresis and cloned into the pMD18-T vector (Takara Biotechnology, Dalian, China) for sequencing.
[0059] After obtaining the 5' nucleotide sequence of the antioxidant peptide from the alpine pygmy frog, a primer sequence 5'-GGATGAAGACCTGGCAGTGTGTGTG-3' (SEQ ID NO. 5) was synthesized and coupled with the 3' PCR primer CDSIII (5'-ATTCTAGAGGCCGAGGCGGCCGACATG-3') (SEQ ID NO. 6). The complete gene of the alpine pygmy frog antioxidant peptide was obtained by transcription using total cDNA diluted 100-fold. The PCR program was similar to that for the 5' fragment amplification, except that the annealing temperature was 52°C and the extension time was 45 s in the cycling program. After final extension and purification, the PCR product was finally sequenced.
[0060] 5. Sequencing and results of antioxidant peptide genes from the Alpine Frog: Plasmid DNA was extracted and the nucleotide sequence was determined using the dideoxy method. The instrument used was an Applied Biosystems 373A fully automated nucleotide sequencer. The sequencing primers were BcaBEST™ Sequencing Primer RV-M and BcaBEST™ Sequencing Primer M13-47. The sequence of BcaBEST™ Sequencing Primer RV-M was: 5'GAGCGGATAACAATTTCACACAGG 3' (SEQ ID NO. 7), and the sequence of BcaBEST™ Sequencing Primer M13-47 was: 5'CGCCAGGGTTTTCCCAGTCACGAC 3' (SEQ ID NO. 8).
[0061] The gene sequencing results from the 5' end to the 3' end are shown below (SEQ ID NO. 2):
[0062] atgaaggtctggcagtgtgcgctatggatctccgctctcacattgcaggcggctcgctctcagtctccggatcgggaagaatggatcagagaggccttggatctctacaaccag agggaagatggagagttcttctttaaattcctgtctgatctcccggccgcccccctggaggaggaaaacaatccgacaatcgcgttcttaataaaggagacggaatgcctgaaa tctgaagatatcaacttggaggaatgtgactacaagaaggacggggaggtgaaggtctgtggattgtacccggaggagaggggagacctcaaagactctgaaatgtgtcggcctg accaagaattctcgcaccaagcgagccggaggtaagaaggagtgcaaagattattactgtagactgctcacgaaacttggatcccgcggccacatctcaggcgtcgatctctga
[0063] The nucleotide sequence listing of the antioxidant peptide gene from the alpine dwarf frog is as follows: sequence length: 456 bases; sequence type: nucleic acid; number of strands: single strand; topology: linear; sequence type: cDNA; source: skin of the alpine dwarf frog.
[0064] Based on the gene sequence of the antioxidant peptide of the alpine dwarf frog, it is inferred that the functionally mature antioxidant peptide is encoded by nucleotides 370-456 (SEQ ID NO. 9), with the amino acid sequence: AGGKKECKDYYCRLLTKLGSRGHISGVDL (see sequence SEQ ID NO. 1).
[0065] Nucleotide sequence of the antioxidant peptide gene of the alpine pygmy frog (Sections 370-456) (SEQ ID NO. 9):
[0066] ggaggtaagaaggagtgcaaagattattactgtagactgctcacgaaacttggatcccgcggccacatctcaggcgtcgatctctga
[0067] Example 2: Preparation of antioxidant peptides from the alpine frog
[0068] 1. Preparation method of antioxidant peptides from alpine pygmy frog
[0069] Based on the deduction of the amino acid sequence encoding the functional mature antioxidant peptide from the gene of the alpine dwarf frog, the peptide was synthesized using an automated peptide synthesizer. The peptide was then desalted and purified by HPLC reversed-phase C18 column chromatography. Disulfide bond formation was achieved using air oxidation, specifically by dissolving the peptide in a flask at 0.1 mg / ml in 0.1% acetic acid solution, titrating with ammonium hydroxide to pH 7.8, and then stirring overnight at room temperature. The peptide was then desalted and purified by HPLC reversed-phase C18 column chromatography. During purification, solution A consisted of 0.1% TFA + 100% CH3CN, and solution B consisted of 0.1% TFA + 100% H2O. A gradient method was used, increasing the concentration of solution A from 26% to 51% over 15 min, with a detection wavelength of 220 nm. The purity of the purified alpine dwarf frog antioxidant peptide was identified by high-performance liquid chromatography (HPLC). Figure 1 As shown, the peptide appeared at 10.822 minutes.
[0070] 2. Molecular weight was determined using fast atom bombardment mass spectrometry (FAB-MS) with glycerol:m-nitrobenzyl alcohol:dimethyl sulfoxide (1:1:1, V:V:V, volume ratio) as the substrate, Cs+ as the bombardment particle, a current of 1 μA, and an emission voltage of 25 kV. Figure 2 As shown, the molecular weight calculated from the mass spectrum is 3166.70 Da.
[0071] 3. The antioxidant peptide of the alpine pygmy frog is a polypeptide encoded by the host defense peptide gene of the Chinese amphibian, the alpine pygmy frog. It is a polypeptide composed of 29 amino acids with a molecular weight of 3166.70 Daltons and an isoelectric point of 9.19. The amino acid sequence is: AlaGlyGlyLysLysGluCysLysAspTyrTyrCysArgLeuLeuThrLysLeuGlySerArgGlyHisIIeSerGlyVal AspLeu(AGGKKECKDYYCRLLTKLGSRGHISGVDL) (SEQ ID NO. 1), in which the cysteine at position 7 and position 12 forms an intramolecular disulfide bond.
[0072] Example 3: In vitro antioxidant activity assay of antioxidant peptides from the alpine frog
[0073] 1. Antioxidant peptides from the alpine pygmy frog against ABTS + The effect of DPPH free radical scavenging rate
[0074] ABTS + Free radical scavenging activity was determined using the Beyotime Total Antioxidant Capacity Assay Kit (ABTS method) with slight modifications (product number: S0119). Different concentrations of peptide and Trolox solutions were prepared as required, and the ABTS activity of the peptides was measured. + The relationship between free radical scavenging capacity and concentration and time.
[0075] DPPH free radical scavenging ability: DPPH powder was dissolved in anhydrous ethanol to prepare a 0.25 mg / mL DPPH solution. Store in the dark. Add 90 μL of the prepared DPPH solution to a 96-well plate. Add 10 μL of alpine frog antioxidant peptide to the peptide treatment group, add an equal volume of deionized water to the negative control group, and add an equal volume of Trolox to the positive control group. Incubate at room temperature in the dark for 30 min. Measure the absorbance at 517 nm using a microplate reader. Calculate the DPPH free radical scavenging rate for each sample using the following formula:
[0076]
[0077] A 对照 Equal volumes of deionized water A 样品 10 μL of different concentrations of peptides or Trolox
[0078] like Figure 3 As shown, the effects of different concentrations of alpine pygmy frog antioxidant peptides (final concentrations of 0, 2.5, 5, 10, 20, and 40 μM) on ABTS were determined. +The DPPH free radical scavenging ability was compared with that of water-soluble vitamin E (Trolox) (final concentrations of 0, 2.5, 5, 10, 20, and 40 μM) as a positive control. The results showed that the antioxidant peptides of the alpine pygmy frog possessed strong free radical scavenging activity in a concentration-dependent manner. However, the scavenging rate of DPPH free radicals was much lower than that of ABTS. + Free radical scavenging rate. This may be because DPPH is formulated with anhydrous ethanol, which is suitable for lipid-soluble antioxidants. The anhydrous ethanol environment may affect the peptide structure and thus the peptide's free radical scavenging ability.
[0079] 2. Protective effect of antioxidant peptides from alpine pygmy frogs on H2O2-damaged plasmid DNA
[0080] H2O2 DNA Damage Experiment: Weigh 242 g of Trisbase and 37.2 g of EDTA into a 1000 mL beaker. Add 600 mL of deionized water and stir until completely dissolved. Add 57.1 mL of glacial acetic acid and mix well. Add deionized water to bring the solution to a final volume of 1 L to prepare a TAE buffer (50×). Store at room temperature. Before use, dilute to 1× with deionized water. Weigh 1 g of agarose and add it to 100 mL of TAE buffer solution. Heat in a microwave oven until the agarose is completely dissolved to prepare a 1% agarose gel. Seal both ends of the electrophoresis template, pour in the agarose gel solution, and insert a comb. Allow to cool and solidify at room temperature. A reaction mixture of 5 µL PBS (10 mM, pH 7.4), 1 µL pPIC9K (final concentration 0.5 µg / µL), 5 µL peptides (final concentrations of 0, 2.5, 5, 10, 20, and 40 μM), and 2 µL H2O2 (final concentration 1.0 mM) was incubated at 37°C for 30 min. The reaction was then stopped by adding 2 µL of loading buffer (50% glycerol (v / v), 40 mM EDTA, and 0.05% bromophenol blue). The reaction mixture was then electrophoresed at 60 V for 50 min in 1×TAE buffer containing ethidium bromide (0.5 µg / mL). The mixture was observed and photographed under UV light. Figure 4 As shown, the antioxidant peptides of the alpine pygmy frog can inhibit H2O2-induced plasmid DNA damage in a concentration-dependent manner. The results indicate that the antioxidant peptides of the alpine pygmy frog possess a protective effect against oxidative damage to DNA.
[0081] Example 4: Effects of antioxidant peptides from the alpine frog on copper sulfate-induced oxidative stress in zebrafish
[0082] 1. Detection of reactive oxygen species (ROS) levels in zebrafish induced by copper sulfate: Three-day-old zebrafish larvae (3dpf) were transferred to 12-well plates containing 940 μL of embryo culture medium, with 8 larvae per well. Different doses of alpine pygmy frog antioxidant peptides (final concentrations of 2.5, 5, and 10 μM) were pre-incubated with the zebrafish larvae for 1 h. Equal volumes of deionized water were added to the blank control and negative control groups. CuSO4 solution (final concentration of 20 μM) was added for 20 min to induce oxidative stress. An equal volume of deionized water was added to the blank control group. The zebrafish larvae were then washed twice with fresh larval culture medium to remove residual CuSO4. They were then cultured in the dark at 28°C for 1 h with DCFH-DA solution (final concentration of 10 μM). After incubation, the zebrafish larvae were washed three times with fresh larval culture medium to remove residual DCFH-DA staining and reduce background fluorescence values. The larvae were anesthetized with 0.0003% MS-222 (tricaine methanesulfonate) and then transferred to a glass slide. They were observed and photographed under a fluorescence microscope. Each larva was placed laterally. The fluorescence intensity of individual larvae was quantified using Autovision software and the BDpathway855 system (BDBiosciences). Zebrafish larvae treated only with deionized water served as a blank control, and zebrafish larvae treated only with CuSO4 served as a negative control. The experiment was repeated three times.
[0083] 2. Detection of neutrophil chemotaxis in zebrafish: Tg(lyz:DsRed2) transgenic zebrafish larvae were transferred to 12-well plates containing 940 μL of embryo culture medium, with 8 larvae per well. Different doses of alpine pygmy frog antioxidant peptides (final concentrations of 2.5, 5, and 10 μM) were pre-incubated with the zebrafish larvae for 1 h. Equal volumes of deionized water were added to the blank control and negative control groups. CuSO4 solution (final concentration of 20 μM) was added for 20 min to induce oxidative stress. An equal volume of deionized water was added to the blank control group. The zebrafish larvae were then washed twice with fresh culture medium to remove residual CuSO4. They were anesthetized with 0.0003% MS-222 and then transferred to glass slides. Observation and photography were performed under a fluorescence microscope. Each zebrafish larva was placed laterally.
[0084] like Figure 5 As shown in Figures A and 5B, the antioxidant peptides of the alpine dwarf frog significantly inhibited the CuSO4-induced increase in ROS levels in zebrafish larvae in a concentration-dependent manner. The results indicate that the alpine dwarf frog antioxidant peptides possess strong antioxidant activity both in vitro and in vivo. An inflammation model was induced using CuSO4 in transgenic zebrafish Tg(lyz:DsRed2) expressing red fluorescent protein on neutrophils. Figure 5As shown in C and 5D, the antioxidant peptides of the Alpine dwarf frog inhibited CuSO4-induced neutrophil migration in a concentration-dependent manner, indicating that the antioxidant peptides of the Alpine dwarf frog have anti-inflammatory effects in vivo.
[0085] Example 5: Effects of antioxidant peptides from the alpine frog on UVB-induced photodamage in mouse skin
[0086] 1. Effects of antioxidant peptides from the alpine frog on UVB-induced photodamage in mice
[0087] Establishing a mouse model of UVB radiation photodamage: First, hair removal cream (Veet, Hubei, China) was applied to the dorsal skin (2×3 cm) of each mouse. 2 Mice underwent hair removal treatment to prepare for subsequent ultraviolet stimulation. Except for the normal control group, all other groups of mice were treated with a UVB lamp (PL-s9w / 2P, Philips, Netherlands) at 0.1 mW / cm². 2 Mice were exposed to UVB radiation for 1.5 h, and the intensity was monitored using a UVB radiometer (LS125+UVB, China). Cathelicidin-Np and vitamin C were dissolved in PBS. Immediately after intradermal injection of the peptide and vitamin C, mice were subjected to UVB radiation. 48 h later, mice were anesthetized intravenously with 100 mL of a solution containing 1% sodium pentobarbital (0.1 mL / 20 g), and the skin was photographed. Skin tissue was then collected and stored at -80°C for subsequent experiments. Figure 6 As shown in Figure A, compared to the PBS-treated control, mice exhibited significant skin damage, erythema, and edema on their backs after 48 hours of UVB irradiation. Mice treated with alpine frog antioxidant peptides and Vitamin C showed significant relief of these symptoms compared to the UVB-treated group. Figure 6 As shown in B and 6C, compared with mice not exposed to UVB (Ctrl), mice exposed to UVB had fewer epidermal cells and fragmented nuclei. The treatment groups with alpine frog antioxidant peptides and vitamin C significantly inhibited apoptosis of epidermal cells in UVB-irradiated mice. Figure 6 As shown in Figure D, Masson's trichrome staining indicated that UVB irradiation led to the degradation of skin collagen fibers, but administration of anti-oxidative peptides from *Pterocarya stenoptera* and vitamin C effectively reversed this degradation. 2. Effects of *Pterocarya stenoptera* anti-oxidative peptides on antioxidant enzymes in the skin of mice exposed to UVB radiation.
[0088] Malondialdehyde (MDA) detection: Mouse skin samples collected during modeling were weighed and PBS was added at a volume-to-weight ratio of 9:1. The mouse skin was thoroughly homogenized to obtain the supernatant of the mouse skin homogenate. A 0.37% stock solution of TBA was prepared using TBA preparation solution. 3 mL of TBA diluent, 1 mL of TBA stock solution, and 60 μL of antioxidant were mixed thoroughly in a 10 mL centrifuge tube. 100 μL of PBS was added to each centrifuge tube as a blank control, followed by 100 μL of the test sample and 200 μL of MDA detection working solution. The mixture was then thoroughly mixed. The mixture was heated at 100℃ for 15 min. After cooling to room temperature, the mixture was centrifuged at 2500 rpm for 10 min. The supernatant was collected and added at 200 μL / well to a 96-well plate. The absorbance at 532 nm was measured using a microplate reader.
[0089] Superoxide dismutase (SOD) detection: Blood was removed from mouse skin using physiological saline containing heparin sodium (0.16 mg / mL). The sample was homogenized with 10 mg tissue / 100 μL SOD sample preparation solution. Centrifuged at 12000 rpm for 5 min at 4℃, and the supernatant was collected. 7.550 mL of SOD detection buffer, 400 μL of WST-8, and 50 μL of enzyme solution were added sequentially to a 10 mL enzyme-free centrifuge tube, and mixed thoroughly. 25 μL of reaction initiation solution (40×) and 975 μL of SOD detection buffer were added to a 1.5 mL centrifuge tube, and mixed thoroughly. The test sample and other working solutions were added to a 96-well plate according to the requirements in the table below, and mixed thoroughly. The plate was incubated at 37℃ for 30 min. The absorbance at 450 nm was measured using a microplate reader.
[0090]
[0091]
[0092] Catalase (CAT) detection: Catalase activity in skin homogenate samples was determined using the Beyotime Catalase Detection Kit (#S0051, Beyotime). Mouse skin tissue was homogenized using Beyotime's Western blotting and IP cell lysis buffer (P0013) at a weight-to-volume ratio of 10 mg / 100 μL. The homogenate was incubated at 4°C for 10 min, then centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected. 250 mM hydrogen peroxide solution, 5 mM hydrogen peroxide solution, chromogenic working solution, and hydrogen peroxide standard solution were prepared according to the manufacturer's instructions. 40 μL of catalase detection buffer was added to a new, clean, enzyme-free centrifuge tube, followed by 10 μL of the mixture from the previous steps, and the mixture was thoroughly mixed. 10 μL of sample / well was added to each centrifuge tube into a 96-well plate. 200 μL of chromogenic working solution was then added. After incubation at 25°C for 15 min, the absorbance was measured at 520 nm.
[0093] like Figure 6 As shown in the EH, in the skin of mice irradiated with UVB, the levels of SOD, GSH, and CAT were significantly reduced, while the level of MDA was increased. The treatment group with antioxidant peptides from the alpine frog and vitamin C effectively inhibited the UVB-induced reduction of SOD, CAT, and GSH, while inhibiting the increase in MDA levels, thereby reducing the oxidative damage of UVB to skin tissue.
[0094] 3. Effects of antioxidant peptides from the alpine frog on inflammatory factors in the skin of mice exposed to UVB radiation.
[0095] The effects of antioxidant peptides from the alpine frog on the production of inflammatory factors in the skin of mice exposed to UVB radiation were investigated. Figure 7 As shown, in mouse skin exposed to ultraviolet light, the gene and protein levels of TNF-α, IL-6, and IL-1β were significantly increased, while the treatment with alpine frog antioxidant peptides and vitamin C significantly inhibited the gene and protein levels of UVB-induced inflammatory factors.
[0096] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. An antioxidant peptide from the alpine frog, characterized in that, The alpine dwarf frog antioxidant peptide is a cyclic peptide composed of 29 amino acids, the amino acid sequence of which is shown in SEQ ID NO. 1, with the seventh and twelfth cysteines forming an intramolecular disulfide bond.
2. The alpine frog antioxidant peptide according to claim 1, characterized in that, The antioxidant peptides from the alpine frog are prepared by biological methods or synthesized by chemical methods.
3. A nucleotide encoding the antioxidant peptide of the alpine frog as described in claim 1, characterized in that, The nucleotide sequence encoding the alpine frog antioxidant peptide of claim 1 is shown in SEQ ID NO. 2 or SEQ ID NO.
9.
4. A reagent, characterized in that, The reagent contains: The nucleotide of claim 3.
5. The reagent according to claim 4, characterized in that, The reagent contains any one of 1) to 3): 1) An expression cassette containing the nucleotides of claim 3; 2) A recombinant vector containing the nucleotides of claim 3; 3) Recombinant microorganisms containing the nucleotides described in claim 3.
6. The use of the alpine frog antioxidant peptide of claim 1 or the nucleotide of claim 3 in the following: To prepare antioxidant or anti-inflammatory drugs, skin care products, or cosmetics.
7. The application according to claim 6, characterized in that, The application includes any of the following: 1) Preparation of ABTS removal + Preparations containing and / or DPPH free radicals; 2) To prepare formulations that mitigate DNA damage caused by oxidative stress; 3) Prepare a formulation to inhibit CuSO4-induced oxidative stress and neutrophil migration in zebrafish.
8. The use of the alpine frog antioxidant peptide of claim 1 or the nucleotide of claim 3 in the following: Prepare drugs, skin care products, or cosmetics for the prevention and / or treatment of skin damage or aging induced by ultraviolet radiation.
9. The application according to claim 8, characterized in that, The application includes any of the following: 1) To prepare drugs, skin care products, or cosmetics that inhibit ultraviolet radiation-induced degradation of skin collagen fibers; 2) To prepare drugs, skin care products, or cosmetics that inhibit ultraviolet radiation-induced oxidative damage to skin tissue; 3) Prepare drugs, skin care products or cosmetics that inhibit ultraviolet radiation-induced skin inflammation.
10. The application according to claim 9, characterized in that, The ultraviolet radiation mentioned is UVB radiation.
11. A composition, characterized in that, The composition comprises the alpine frog antioxidant peptide of claim 1 or the nucleotide of claim 3.
12. The composition according to claim 11, characterized in that, The composition also includes a pharmaceutically acceptable carrier.
Citation Information
Patent Citations
Microhyla pulchra antioxidation peptide and gene thereof, and application of microhyla pulchra antioxidation peptide to pharmacy
CN106432425A
Nanorana ventripunctata skin antioxidant peptide antioxidin-NV as well as gene and application thereof
CN112125968A