Application of nodU gene in regulation and control of nodulation capability and nitrogen fixation efficiency of azotobacter stem nodule

Abstract

The invention discloses application of a nodU gene in regulation and control of nodulation capability and nitrogen fixation efficiency of azotobacter stem nodule, and belongs to the technical field of biology. According to the research, the nodU gene is over-expressed in the azotobacter japonicus, so that the nodulation and nitrogen fixation capacities of the azotobacter japonicus can be improved at the same time. The nodulation gene nodU overexpression strain of the nodulation gene nodU of the stem nodulation nitrogen-fixing rhizobium ORS571 is constructed, the nodulation gene nodU overexpression strain is inoculated to a leguminous plant for symbiosis, and compared with the leguminous plant inoculated with wild type rhizobium, the nodulation number of the leguminous plant can be obviously increased, the nodulation nitrogen-fixing capacity is improved, and the plant growth phenotype is improved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to application of a nodU gene in regulating the nodulation ability and nitrogen fixation efficiency of stem nodule nitrogen-fixing rhizobium. Background Art

[0002] Rhizobia are a class of Gram-negative bacteria that can establish a symbiotic nitrogen-fixing relationship with legumes. In natural ecosystems, the symbiotic nitrogen fixation between rhizobia and legumes helps improve soil fertility. Through nitrogen fixation, legumes can convert atmospheric nitrogen into nitrogen compounds that can be used by plants, thereby significantly expanding the plant's ability to utilize nitrogen. The nodulation process between rhizobia and legumes is mainly caused by nodulation factors. Nodulation factors are lipochitosan oligomers required for nodule development and intracellular infection of roots, and are active at extremely low concentrations. The enzymes responsible for the biosynthesis of nodulation factors are encoded by genes such as nod, noe, and nol, which are located in symbiotic plasmids or genomic islands. The synthesis of active nodulation factors generally requires the participation of multiple nodulation factor genes. With the cooperation of multiple genes and substrates, rhizobia synthesize biologically active nodulation factors and form nodulation symbiosis with the host.

[0003] Azorhizobium caulinodans ORS571 is a relatively special rhizobium with symbiotic and autogenic nitrogen-fixing abilities. It can not only form nodules on the roots of the host plant, Sesbania caulinodans, but also on its stems. This special nitrogen-fixing ability enables it to promote the growth of Sesbania caulinodans and improve its adaptability to saline-alkali environments. According to bioinformatics analysis, the symbiotic nitrogen-fixing function of Azorhizobium caulinodans ORS571 originates from acquired genetic evolution, and the symbiotic island may be integrated into the genome through horizontal transfer. The symbiotic island is mainly a nodulation gene cluster, which does not contain fix and nif genes. The nodulation gene cluster is 87.6kb in length, and cloning is quite difficult. At present, there is no report on the simultaneous regulation of nodulation and nitrogen-fixing ability of Azorhizobium caulinodans ORS571 based on a single nodU gene. Summary of the invention

[0004] In view of the above prior art, the purpose of the present invention is to provide an application of the nodU gene in regulating the nodulation ability and nitrogen fixation efficiency of stem-nodulated nitrogen-fixing rhizobia. The present invention has found that overexpressing the nodU gene in stem-nodulated nitrogen-fixing rhizobia can simultaneously improve the nodulation and nitrogen fixation abilities of stem-nodulated nitrogen-fixing rhizobia.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention provides the use of the nodU gene in the following (1) or (2):

[0007] (1) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia;

[0008] (2) Promote the symbiotic effect between rhizobia and plants;

[0009] The nodU gene is a DNA molecule as shown in the following i) or ii):

[0010] i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1;

[0011] ii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.2 except i).

[0012] In the above application, the symbiotic effect between rhizobia and plants is promoted including: increasing the number of nodules, improving nitrogen fixation capacity and / or promoting plant growth.

[0013] The nodU gene encodes carbamoyltransferase. The present invention has found that overexpressing a single nodU gene in stem-nod nitrogen-fixing rhizobium ORS571 can simultaneously improve the nodulation and nitrogen-fixing abilities of stem-nod nitrogen-fixing rhizobium ORS571. Inoculating stem-nod nitrogen-fixing rhizobium ORS571 overexpressing the nodU gene into legumes for symbiosis can significantly increase the number of nodules in legumes, improve nitrogen-fixing ability, and promote the growth of legumes.

[0014] The second aspect of the present invention provides the use of a protein encoded by a nodU gene in the following (1) or (2):

[0015] (1) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia;

[0016] (2) Promote the symbiotic effect between rhizobia and plants.

[0017] In the above application, the amino acid sequence of the protein encoded by the nodU gene is shown as SEQ ID NO.2.

[0018] Proteins are the specific executors and embodiments of gene functions. Therefore, the application of the protein encoded by the nodU gene in simultaneously improving the nodulation ability and nitrogen fixation ability of stem-nodulated nitrogen-fixing rhizobia and promoting the symbiotic effect between rhizobia and plants is also within the protection scope of the present invention.

[0019] The third aspect of the present invention provides the use of an expression cassette or a recombinant expression vector containing a nodU gene in any of the following (1)-(3):

[0020] (1) Construction of recombinant rhizobia overexpressing the nodU gene;

[0021] (2) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia;

[0022] (3) Promote the symbiotic effect between rhizobia and plants.

[0023] Preferably, the nucleotide sequence of the expression cassette containing the nodU gene is as shown in SEQ ID NO.3; it consists of a nodU gene upstream sequence (438 bp) (positions 1-438 of SEQ ID NO.3), a sequence encoding the nodU gene (1683 bp) (positions 439-2121 of SEQ ID NO.3) and a nodU gene downstream sequence (432 bp) (positions 2122-2553 of SEQ ID NO.3).

[0024] Preferably, the basic plasmid used to construct the recombinant expression vector is the pBBR1MCS-2 plasmid (sequence see https: / / www.addgene.org / 85168 / sequences / ), which is a vector capable of carrying exogenous DNA or target gene into host cells for amplification and expression.

[0025] A fourth aspect of the present invention provides a recombinant rhizobium that overexpresses the nodU gene, which is prepared by the following method:

[0026] The expression cassette containing the nodU gene shown in SEQ ID NO.3 was connected to the pBBR1MCS-2 plasmid to construct the recombinant plasmid pBBR1MCS-2-nodU;

[0027] The recombinant plasmid pBBR1MCS-2-nodU was introduced into stem nodule nitrogen-fixing rhizobium ORS571 to prepare recombinant rhizobium overexpressing the nodU gene.

[0028] The fifth aspect of the present invention provides the use of the above-mentioned recombinant rhizobium overexpressing the nodU gene in promoting plant nodulation and growth.

[0029] In the above application, the plant is Sesbania calyx.

[0030] A sixth aspect of the present invention provides a method for promoting nodulation and growth of Sesbania calyx under low nitrogen conditions, comprising the following steps:

[0031] After the germinated Sesbania calyx seeds were soaked with recombinant rhizobia overexpressing the nodU gene as an inoculant for 3 hours, the seeds were transferred to sterilized vermiculite mixed with a low-nitrogen nutrient solution and cultured at 25°C with a photoperiod of 12h:12h to promote the nodulation and growth of Sesbania calyx.

[0032] Beneficial effects of the present invention:

[0033] The present invention constructs a stem nodule nitrogen-fixing rhizobium ORS571 nodulation gene nodU overexpression strain, which is inoculated with legumes for symbiosis. Compared with legumes inoculated with wild-type rhizobia, the number of nodules in legumes can be significantly increased, the nitrogen fixation ability of nodules can be improved, and the plant growth phenotype can be improved, and statistical analysis shows significant differences. The genetically engineered recombinant rhizobia constructed by the present invention has a stronger nodulation ability in the roots and stems of the host Sesbania calyx than that of unmodified wild-type rhizobia, and its nitrogen fixation ability of nodules is significantly improved, and the growth-promoting ability of the host plant after colonization is stronger. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The results of agarose gel electrophoresis detection of the double enzyme digestion product of the recombinant plasmid pBBR1MCS-2-nodU constructed in Example 1 of the present invention, lane 1 is the product of the extracted recombinant plasmid pBBR1MCS-2-nodU after double digestion with restriction endonucleases HindⅢ and XbaⅠ; lane 2 is the nodU gene amplification product; lane 3 is the product of the plasmid pBBR1MCS-2 after double digestion with restriction endonucleases HindⅢ and XbaⅠ; indicating that the nodU sequence has been successfully connected to the vector.

[0035] Figure 2 Figure 2 shows the growth curves of the wild strain WT (ORS571) and the overexpression strain OEnodU constructed in the present invention in TY liquid culture medium.

[0036] Figure 3 This is a comparison of nodulation of Sesbania calyx 48 days after inoculation with different strains in a double-layer pot supplemented with low-nitrogen nutrient solution in Example 3. Among them, A is the root nodule phenotype; B is the stem nodule phenotype; C is the number of root nodules; and D is the number of stem nodules.

[0037] Figure 4 The growth conditions of Sesbania calyx in Example 3 after being inoculated with different strains in a double-layer pot supplemented with low-nitrogen nutrient solution for 48 days are compared.

[0038] Figure 5 The nitrogen fixation capacity of the root nodules and stem nodules of Sesbania calyx planted and inoculated with different strains in a double-layer pot supplemented with low-nitrogen nutrient solution in Example 3 for 48 days. Among them, A is the nitrogenase activity of the nodules; B is the nitrogenase activity of the stem nodules. DETAILED DESCRIPTION

[0039] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0040] As mentioned above, since the nodulation gene cluster of Azorhizobium caulinodans ORS571 is 87.6 kb in length, cloning is quite difficult. Therefore, how to further improve the nodulation and nitrogen fixation ability of Azorhizobium caulinodans ORS571 is the current technical difficulty.

[0041] The nodU gene encodes carbamoyltransferase, and its nucleotide sequence is shown in SEQ ID NO.1, which is as follows:

[0042]

[0043] The amino acid sequence of the protein encoded by the nodU gene is shown in SEQ ID NO.2, and is as follows:

[0044] .

[0045] In order to study the function of the nodU gene, the present invention constructed an expression cassette containing the nodU gene, the nucleotide sequence of which is shown in SEQ ID NO.3, and is as follows:

[0046]

[0047] The present invention has found that by overexpressing a single nodU gene in the stem-nod nitrogen-fixing rhizobium ORS571, the nodulation ability and nitrogen fixation ability of the stem-nod nitrogen-fixing rhizobium ORS571 can be simultaneously improved. Inoculating the stem-nod nitrogen-fixing rhizobium ORS571 overexpressing the nodU gene into legumes for symbiosis can significantly increase the number of nodules of legumes, improve the nitrogen fixation ability and promote the growth of legumes, thus proposing the present invention.

[0048] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0049] The experimental materials used in the examples of the present invention without specific description are all conventional experimental materials in the field and can be purchased through commercial channels. Among them:

[0050] Azorhizobium caulinodans ORS571 has been disclosed in non-patent literature, and the source of the literature is "Bioinformatics analysis of secretory proteins from the genome of Azorhizobium caulinodans ORS571", Genomics and Applied Biology, 2012, Vol. 31, No. 4, pp. 394-400. Within 20 years from the filing date, the public can obtain the strain from the applicant for use in repeating the present invention.

[0051] Escherichia coli DH5α was purchased from Quanshijin Company.

[0052] TY medium (solid medium with additional agar powder 15 g / L): tryptone 5 g / L, yeast powder 3 g / L, anhydrous calcium chloride 0.6 g / L, pH = 7.0, 121°C, sterilization for 20 min.

[0053] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder. pH = 7.0, 121°C, sterilize for 20 min.

[0054] Plant low-nitrogen nutrient solution: 0.075 g / L ferric citrate, 0.03 g / L calcium nitrate, 0.075 g / L potassium chloride, 0.06 g / L magnesium sulfate, 0.136 g / L potassium hydrogen phosphate, 0.46 g / L calcium sulfate, 1 mL / L trace element mixture; (wherein the trace element mixture comprises 2.86 g / L boric acid, 1.81 g / L manganese sulfate, 0.8 g / L copper sulfate pentahydrate, 0.22 g / L zinc sulfate, and 0.02 g / L molybdic acid); pH = 7.0, sterilized in a high-pressure steam cooker at 121°C for 20 min.

[0055] If no specific experimental conditions and methods are specified in the examples of the present invention, conventional conditions are generally used, such as J. Sambrook et al., ed., Molecular Cloning Experiment Guide (3rd edition), Science Press, 2002; DL Spector et al., ed., Cell Experiment Guide, Science Press, 2001; or the conditions recommended by the manufacturer.

[0056] The quantitative tests in the examples were repeated three times, and the data were processed using GraphPad Prism 8 statistical software. The experimental results were presented in line graphs and bar graphs as mean ± standard deviation, and Student's t-test was used to detect whether there were differences between samples and whether the differences were significant. * represents a significant difference, p < 0.05, which is marked above the bar graph.

[0057] Example 1: Construction of recombinant rhizobium overexpressing nodU gene

[0058] The genome of stem nodule nitrogen-fixing rhizobium ORS571 was extracted using the Tiangen Bacteria Genome Extraction Kit (refer to the enclosed instructions for the extraction method), and the concentration of the extracted sample was determined by Nanodrop 2000 (preferably 100-300 ng / μL), and stored at -20°C for later use. The extracted genomic DNA was used as a template to amplify the target gene using primers nodU-HB-F and nodU-HB-R, and the amplified fragments were electrophoresed by 1% agarose gel to determine that the size was consistent with the designed length.

[0059] nodU-HB-F:CCAAGCTTCAGAGTCTAACGGTCGTCGA;

[0060] nodU-HB-R:GCTCTAGAGCATCGTTAAGCGCCGCATACC.

[0061] The amplified gene fragment was purified by PCR product purification kit to obtain the specific amplified band, and the target fragment nodU was recovered by gel cutting. The plasmid pBBR1MCS-2 was extracted with a plasmid mini-extraction kit. The obtained plasmid pBBR1MCS-2 was cleaned and recovered after double digestion with XbaⅠ and HindⅢ to obtain a linear vector with sticky ends. The target fragment nodU was double digested by the same method to obtain the target fragment with sticky ends. The pBBR1MCS-2 plasmid and nodU fragment after enzyme digestion were connected with Thermofisher scientific T4 DNA ligase at 16℃ overnight, and the connected system was introduced into DH5α Escherichia coli competent cells, and diluted and coated on LB solid plates containing kanamycin and ampicillin, and cultured at 37℃ for 24h to screen positive recombinants. Positive plaques were picked and inoculated into test tubes and cultured at 37°C for 24 h. The plasmid was extracted using a plasmid mini-preparation kit and subjected to agarose gel electrophoresis after double digestion with XbaⅠ and HindⅢ to confirm that the recombinant plasmid pBBR1MCS-2-nodU was successfully constructed.

[0062] Agarose gel electrophoresis results Figure 1 As shown, the results showed that the nodU gene sequence had been successfully connected to the vector pBBR1MCS-2, and the recombinant plasmid was successfully constructed.

[0063] Cultivate the recipient bacteria (wild-type ORS571 strain), donor bacteria (DH5α containing pBBR1MCS-2-nodU recombinant strain) and helper bacteria (DH5α containing pRK2013 plasmid) to obtain bacterial liquid, collect the bacteria by centrifugation at 5000rpm for 3min, wash twice with non-resistant TY medium, and finally suspend in 1mL non-resistant TY medium. Take 300μL of donor bacteria, 200μL of helper bacteria and 100μL of recipient bacteria, mix them evenly, drop them in the center of the TY plate, let them stand and blow dry, and then place them in a 37℃ constant temperature incubator for 2d. Scrape the cultured bacteria with a sterile pipette tip, suspend them in 1mL of sterile water, and dilute to 10 -3 The bacterial suspension was obtained by smearing 100 μL onto TY solid medium containing ampicillin (100 μg / mL) and kanamycin (50 μg / mL), and cultured at 37°C for 2 days;

[0064] The single colony obtained above was placed in a liquid TY medium containing ampicillin (100 μg / mL) and kanamycin (50 μg / mL), shaken and cultured at 37°C and 180 rpm for 24 hours, and the plasmid was extracted using a plasmid small-scale extraction kit. After double digestion with XbaⅠ and HindⅢ, agarose gel electrophoresis was performed to confirm that the recombinant plasmid was transferred and the recombinant rhizobium (OEnodU) overexpressing the nodU gene was successfully constructed. The positive strain that was verified correctly, namely OEnodU, was stored in -80°C glycerol for later use.

[0065] Example 2: Growth curve determination of rhizobia in TY liquid culture medium.

[0066] The wild-type rhizobium WT (ORS571) and the overexpressing rhizobium OEnodU constructed in Example 1 were inoculated into 5 mL TY medium test tubes, respectively, and cultured at 37°C, 180 rpm for 24 h. The OD of each strain was measured. 600 The concentrations were adjusted to 0.6 respectively, and 500 μL of each were inoculated into conical flasks containing 50 mL of TY medium. The cultures were cultured at 37°C and 180 rpm. The OD was measured at 600 nm every 4 h. The measurement was continued until 48 h, and a growth curve was drawn.

[0067] The results are as follows Figure 2 As shown in the figure, compared with the wild-type rhizobium WT, the growth curve of the overexpressing strain OEnodU has no difference (i.e., the difference is not significant, ns). This indicates that the recombinant rhizobia overexpressing the nodU gene did not cause growth inhibition compared with the wild-type rhizobia in TY medium, eliminating the effect of the recombinant plasmid on the growth rate of the strain.

[0068] Example 3: Symbiosis experiment between rhizobia and leguminous plants

[0069] 1. Experimental methods:

[0070] Seed disinfection: Select Sesbania calyx seeds of similar mass and size and place them in a 50mL sterile conical flask. Soak them in 98% concentrated sulfuric acid for 10 minutes to soften the seed coat, and wash off the sulfuric acid on the surface with a large amount of sterile water. Then soak them in 3% sodium hypochlorite solution for 5 minutes and 75% ethanol for 5 minutes to disinfect the seed surface. Finally, wash them three times with sterile water and place the seeds on sterile wet filter paper for germination for 2 days.

[0071] Co-cultivation: wild-type rhizobium WT (ORS571) and overexpressing rhizobium OEnodU were inoculated into test tubes containing 5 mL of TY medium, cultured at 37°C, 180 rpm for 24 h, collected and centrifuged, and the OD600 of each strain was adjusted to 0.6, and 500 μL of each was inoculated into conical flasks containing 50 mL of TY medium, cultured at 37°C, 180 rpm for 24 h, centrifuged at 5000 rpm for 5 min, and resuspended with sterile water to OD600 =0.6 bacterial solution. 30 seedlings with the same growth were selected and placed in each bacterial solution and soaked at 25℃ for 3h; the seedlings soaked in sterile water were used as the control group. The soaked seedlings were planted in a double-layer pot filled with sterilized vermiculite and watered with low-nitrogen nutrient solution, one plant per pot, and 10 replicates per treatment. 20 days after planting, the stems of the plants were smeared with the same bacterial solution as above, and observed and photographed 48 days after planting, and the number of root nodules and stem nodules was counted; the acetylene reduction method (ARA) was used to determine the nitrogenase activity of the root nodules and stem nodules formed by the symbiosis of the wild strain WT and the overexpressing rhizobium OEnodU with the hairy calyx field sesbania, and the determination method was as follows:

[0072] Take 20 nodules and stem nodules formed by plants inoculated with different strains, weigh them and place them in 20mL sterile glass bottles, and seal the mouth of the glass bottle with a rubber stopper and a sealing film. Use a syringe to extract 10% of the air by volume, then inject 10% of high-purity acetylene gas by volume, and continue to culture at 37°C for 24 hours; use an injector to extract 1mL of mixed gas from the sealed glass bottle, and use a gas chromatograph to determine the gas components; set up three parallel groups for each strain, use sterile injection of acetylene gas as a negative control, inject 1mL to calibrate the position of the acetylene peak, and inject 1mL of pure ethylene to calibrate the amount of ethylene peak substance; nitrogenase activity is calculated based on the amount of ethylene generated per unit time.

[0073] The nitrogenase activity calculation formula is: ARA = Asa × (Vt / Vs) / (Ast / H / P); ARA represents nitrogenase activity, in μmol·h -1 ·g -1 ; Asa is the ethylene peak area, in cm 2 ; Vt is the gas volume of the bottle, in mL; Vs is the injection volume, in mL; Ast is the 1nmo1 standard ethylene peak area, in cm 2 ; H is the reaction time, unit is h; P is the protein content, unit is g.

[0074] 2. Experimental results:

[0075] Both wild-type rhizobium WT and rhizobium overexpressing OEnodU can cause Sesbania calyx to form root and stem nodules, but compared with wild-type rhizobium WT, the number of root and stem nodules formed by overexpressing OEnodU was significantly increased ( Figure 3 ), and further promoted the growth of plants ( Figure 4 ).

[0076] The nodules and stem nodules formed by the symbiosis between the overexpression strain OEnodU and Sesbania calyx were found to have good nitrogen fixation ability. The nitrogenase activity of the nodules was significantly higher than that of the wild-type strain WT (ORS571) and Sesbania calyx. The nitrogen fixation efficiency of the nodules was 20.48 μmol·h-1 ·g -1 , which is 29.27% ​​higher than that of ORS571; the nitrogen fixation efficiency of the stem nodules is as high as 24.77 μmol·h -1 ·g -1 , which is 31.92% higher than ORS571 ( Figure 5 ).

[0077] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of nodU gene in the following (1) or (2): (1) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia; (2) Promote the symbiotic effect between rhizobia and plants; The nodU gene is a DNA molecule as shown in the following i) or ii): i) the nucleotide sequence is the DNA molecule shown in SEQ ID NO.1; ii) A DNA molecule encoding the amino acid sequence shown in SEQ ID NO.2 except i).

2. The use according to claim 1, characterized in that: The promoting symbiotic effect between rhizobia and plants includes: increasing the number of nodules, improving nitrogen fixation ability and / or promoting plant growth.

3. Use of the protein encoded by the nodU gene according to claim 1 in the following (1) or (2): (1) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia; (2) Promote the symbiotic effect between rhizobia and plants.

4. Use of an expression cassette or recombinant expression vector containing a nodU gene in any of the following (1)-(3): (1) Construction of recombinant rhizobia overexpressing the nodU gene; (2) Simultaneously improve the nodulation and nitrogen fixation abilities of stem nodule nitrogen-fixing rhizobia; (3) Promote the symbiotic effect between rhizobia and plants.

5. The use according to claim 4, characterized in that: The nucleotide sequence of the expression cassette containing the nodU gene is shown in SEQ ID NO.

3.

6. The use according to claim 4, characterized in that: The basic plasmid used to construct the recombinant expression vector is the pBBR1MCS-2 plasmid.

7. A recombinant rhizobium overexpressing a nodU gene, characterized in that: Prepared by the following method: The expression cassette containing the nodU gene shown in SEQ ID NO.3 was connected to the pBBR1MCS-2 plasmid to construct the recombinant plasmid pBBR1MCS-2-nodU; The recombinant plasmid pBBR1MCS-2-nodU was introduced into stem nodule nitrogen-fixing rhizobium ORS571 to prepare recombinant rhizobium overexpressing the nodU gene.

8. Use of the recombinant rhizobium overexpressing the nodU gene according to claim 7 in promoting plant nodulation and growth.

9. The use according to claim 8, characterized in that: The plant is Sesbania calyx.

10. A method for promoting nodulation and growth of Sesbania pubescens under low nitrogen conditions, characterized in that: The following steps are involved: After soaking the germinated Sesbania calyx seeds with the recombinant rhizobium overexpressing the nodU gene as claimed in claim 7 as an inoculant for 3 hours, the seeds are transferred to sterilized vermiculite mixed with a low-nitrogen nutrient solution and cultured at 25° C. with a photoperiod of 12h:12h to promote the nodulation and growth of Sesbania calyx.

Images