Isoquinoline anti-inflammatory drug and application thereof

Abstract

The invention provides an isoquinoline compound as shown in a formula (I) and application of the isoquinoline compound in treatment of inflammation. The compound can inhibit expression of pro-inflammatory cytokines in various inflammatory models such as LPS (lipopolysaccharide)-induced RAW264.7 cells, LPS-induced THP-1 cells, LPS-induced mouse primary macrophages and PGN-induced RAW264.7 cells, has wide anti-inflammatory activity at the cellular level, and can inhibit expression of CSF2 and block a cascade amplification effect of an NF-kappa B inflammatory signal channel in mechanism. # imgabs0 #

Description

Technical Field

[0001] The invention relates to the technical field of medicines, in particular to an isoquinoline anti-inflammatory drug and application thereof. Background Art

[0002] Inflammation is the body's defense response to physical or chemical damage, pathogen infection, etc. The inflammatory response is an important immune defense mechanism of the human body. On the one hand, the inflammatory response helps the body resist infection by pathogens. On the other hand, dysregulated inflammatory response can lead to tissue and organ damage. The inflammatory response is accompanied by the activation of inflammatory signaling pathways and the secretion of inflammatory cytokines. The main cytokines involved in the inflammatory response include IL-1β, TNF-α, IL-6, IL-8, IFN-β, etc. The expression of these cytokines and the further activation of their downstream signaling pathways are related to a series of complex physiological responses such as immune cell infiltration, cell migration and tissue destruction, as well as symptoms (such as redness, swelling, heat and pain).

[0003] Studies have shown that the occurrence of almost all major human diseases is related to inflammatory responses, so it is particularly important to screen effective anti-inflammatory drugs. The inventors have discovered an isoquinoline compound that has a wide range of inhibitory effects on the expression of pro-inflammatory cytokines in a variety of cell models. Whether the drug has broad-spectrum anti-inflammatory activity and its anti-inflammatory mechanism have not been disclosed. Summary of the invention

[0004] (I) Technical solution

[0005] In view of the deficiencies of the prior art, the present invention is achieved through the following technical solution: an isoquinoline anti-inflammatory drug, the structure of which is shown in formula (I):

[0006]

[0007] Preferably, the compound of formula (I) is dissolved in dimethyl sulfoxide at a concentration of 10 mg / mL, and the compound of formula (I) is diluted to a desired concentration using cell culture medium.

[0008] Preferably, the compound of formula (I) is used to inhibit LPS-induced inflammatory response of RAW264.7 cells, LPS-induced inflammatory response of THP-1 cells, and LPS-induced inflammatory response of primary mouse macrophages.

[0009] Preferably, the compound of formula (I) is used for PGN-induced inflammatory response of RAW264.7 cells.

[0010] Preferably, the compound of formula (I) is used to inhibit the inflammatory response induced by HSV-1 infection.

[0011] Preferably, the compound of formula (I) is used to inhibit the positive feedback effect of CSF2 on inflammatory response.

[0012] Preferably, the compound of formula (I) is used to inhibit the activation of NF-κB signaling pathway to reduce inflammatory response.

[0013] (II) Beneficial effects

[0014] The present invention provides an isoquinoline anti-inflammatory drug and its application, which has the following beneficial effects:

[0015] This compound can inhibit the expression of proinflammatory cytokines in various inflammatory models, such as LPS-induced RAW264.7 cells, LPS-induced THP-1 cells, LPS-induced mouse primary macrophages, and PGN-induced RAW264.7 cells, and has a wide range of anti-inflammatory activity at the cellular level. Mechanistically, this compound can inhibit the expression of CSF2 and block the cascade amplification effect of the NF-κB inflammatory signaling pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The results show that the inhibition of proinflammatory cytokines (IL-1α, IL-1β, IL-6, IFN-β, MCP1) by isoquinoline compounds is concentration-dependent. After pretreatment with isoquinoline compounds at different concentrations (5, 10, 20, 30, 40 μg / mL) for 4 h, LPS was stimulated for 6 h, RNA was collected for reverse transcription, and qPCR was used to detect the RNA expression levels of Il6, Il1b, and Mcp1. ns, no significant difference, *, p < 0.05; **, p < 0.01; ***, p < 0.001.

[0017] Figure 2 The results show that in the LPS-induced RAW264.7 cell model, the isoquinoline compounds did not inhibit the activity of RAW264.7 cells at a concentration of less than 40 μg / mL. After treatment with different concentrations (5, 10, 20, 30, 40 μg / mL) of isoquinoline compounds for 12 hours, CCK8 was used to detect cell activity. ns, no significant difference, *, p < 0.05.

[0018] Figure 3The results show that isoquinoline compounds widely inhibit the expression of proinflammatory cytokines in LPS-induced RAW264.7 cells, LPS-induced THP-1 cells, and LPS-induced mouse primary macrophages. Figure A shows that isoquinoline compounds inhibit the secretion of proinflammatory cytokines in the LPS-induced RAW264.7 cell inflammation model; Figure B shows that isoquinoline compounds inhibit the secretion of proinflammatory cytokines in the LPS-induced mouse peritoneal primary macrophage inflammation model; Figure C shows that isoquinoline compounds inhibit the secretion of proinflammatory cytokines in the LPS-induced human peripheral blood mononuclear cell line THP-1 inflammation model; dex is the positive control drug dexamethasone, and the administration concentration is 10μg / mL. *, p<0.05; **, p<0.01; ***, p<0.001.

[0019] Figure 4 The image shows the differentially expressed genes of RAW264.7 cells before and after drug administration by RNA-seq high-throughput screening. Figure A shows the enrichment of differentially expressed genes; Figure B shows the core KEGG enrichment of differentially expressed genes; and Figure C shows the heat map of representative differentially expressed genes.

[0020] Figure 5 The display shows the verification of differentially expressed genes before and after administration in high-throughput screening, and the verification of CSF2, which has the most significant expression difference before and after administration, in THP-1 cells. Among them, Figure A is the verification of differentially expressed genes Csf2, Cxcl3, Il23a, Cxcl2, Hbegf, and Bcl6b in the sequencing results of RAW264.7 cells; Figure B is the verification of CSF2, the most significant gene in THP-1 cells. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

[0021] Figure 6 The results show that isoquinoline compounds inhibit the expression of CSF2 and inhibit the amplification cascade of inflammatory signaling pathways. Among them, isoquinoline compounds significantly inhibited the expression of pro-inflammatory cytokines such as IL6 and IL1A, while exogenous addition of CSF2 positively feedbacked the expression of pro-inflammatory cytokines induced by LPS. **, p < 0.01; ***, p < 0.001.

[0022] Figure 7The anti-inflammatory effect of isoquinoline compounds in the HSV-1 virus infection model and PGN-induced RAW264.7 cell model is shown. Figure A shows that RAW264.7 macrophages were pretreated with 10 μg / mL whe29, dex, and dmso, respectively, and then stimulated with HSV-1 for 6 hours. After collecting RNA reverse transcription, qPCR was used to detect the RNA expression levels of cytokines and chemokines such as Il6 and Il1b; Figure B shows that RAW264.7 macrophages were pretreated with 10 μg / mL whe29, dex, and dmso, respectively, and then stimulated with PGN for 6 hours. After collecting RNA reverse transcription, qPCR was used to detect the RNA expression levels of cytokines and chemokines such as Il6 and Il1b. ns, no significant difference; *, p < 0.05; **, p < 0.01.

[0023] Figure 8 It is shown that isoquinoline compounds inhibit the activation of NF-κB signaling pathway, while isoquinoline compounds have no significant effect on other inflammatory signaling pathways. DETAILED DESCRIPTION

[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Example 1: Cell recovery, passage, and culture

[0026] Cell recovery: Take out the frozen cells from liquid nitrogen and immediately put them into a 37°C water bath. After thawing, transfer the cells to a 15mL centrifuge tube in a biosafety cabinet, add 4mL of cell culture medium, mix well, and centrifuge at 800rpm for 5min. After centrifugation, discard the supernatant in the biosafety cabinet, transfer to a cell culture dish with complete culture medium, mix well, and culture in an incubator.

[0027] Cell passaging and culture: Take mouse macrophage cell line RAW264.7 cells and discard the old culture medium in a biosafety cabinet, add 3 mL of DMEM culture medium (containing 10% serum) to a 10 cm culture dish, place in a 4°C refrigerator for 5 minutes, blow off the cells in a biosafety cabinet, and take one-third of the cells for passaging. Take human peripheral blood mononuclear cell line THP-1 cells and pass them in a biosafety cabinet. Transfer the suspended cells to a centrifuge tube, centrifuge at 600 rpm for 5 minutes, discard the supernatant in a biosafety cabinet, add 3 mL of 1640 culture medium (containing 10% serum), blow off the cells, and take one-third of the cells for passaging.

[0028] Example 2: Isolation and culture of primary mouse peritoneal macrophages

[0029] For mice aged 6-8 weeks, 3 mL of hydroxyethyl starch broth (3%, used after autoclaving) was injected into the peritoneum of each mouse. After 3-4 days, the mice were euthanized and soaked in 75% disinfectant alcohol. The abdominal skin was cut open in a biosafety cabinet. 15 mL of serum-free culture medium was drawn with a syringe to repeatedly aspirate the peritoneal cells and transferred to a 15 mL centrifuge tube. Centrifuge at 600 rpm for 10 min. The supernatant was discarded in the biosafety cabinet. DMEM culture medium containing 10% serum (supplemented with double antibody) was added to resuspend and filter. The filtered cell suspension was blown evenly and counted. According to the 12-well plate, 5X10 cells per well were plated. 5 The cells were plated and mixed. After 2 hours, the medium was replaced with normal DMEM medium containing 10% serum for subsequent experiments.

[0030] Example 3: Western blot, SDS-PAGE electrophoresis

[0031] Protein extraction: discard the culture medium, wash once with PBS buffer, add RIPA lysis buffer containing protease inhibitors, lyse on ice for 30 minutes, collect the lysate into an EP tube, centrifuge at 16000g for 30 minutes, and transfer the supernatant to a new EP tube. Take 2μL to measure the protein concentration using the BCA method. Add the corresponding volume of protein loading buffer to the remaining liquid, mix well, centrifuge instantly, place in a 100℃ metal bath for heating and denaturation for 10 minutes, and immediately insert on ice to cool after the end, centrifuge and store in a -20℃ refrigerator or directly proceed to the next step of protein imprint detection.

[0032] SDS-PAGE gel electrophoresis: protein loading, fill to the same volume with 1X loading buffer, add electrophoresis buffer, constant voltage 80V for 30min, and electrophoresis at 120-150V until the detected protein is separated to the appropriate position.

[0033] Transfer: Fill the membrane with transfer solution and transfer in an ice bath. Determine the transfer time according to the molecular weight. Generally, transfer at 320V for 1 hour. For proteins with larger molecular weight, extend the transfer time appropriately.

[0034] Blocking: Block with 5% skim milk at room temperature for 2 hours.

[0035] Primary antibody incubation: dilute the corresponding primary antibody with 5% BSA and incubate at room temperature for 2 hours or at 4°C overnight. Wash three times with TBST at the end of incubation, each time for 10 minutes.

[0036] Secondary antibody incubation: dilute the secondary antibody with 5% BSA at a dilution ratio of 1:2000. Add the secondary antibody and incubate at room temperature for 1 hour. After incubation, wash three times with TBST, each time for 10 minutes.

[0037] ECL development: Prepare the color developing solution in a 1:1 ratio and develop.

[0038] Example 4: RNA extraction, reverse transcription and real-time fluorescence quantitative PCR

[0039] The water used to prepare reagents during the experiment was DEPC-treated water.

[0040] Extract total RNA using RNAfast200 kit: Use RNAfast200 kit to extract RNA according to the kit operation procedure. The specific procedure is to discard the culture medium of adherent cells, wash once with 1X PBS (DEPC water) buffer, add RA2 lysis solution in the kit, lyse the adherent cells on ice for 30 minutes, transfer the lysis solution to the collection column with a pipette, centrifuge at 12000rpm for 1min, discard the liquid, add 500μL of washing solution, and centrifuge at 12000rpm for 1min. After repeating the washing, empty it again. Add elution solution and centrifuge at 12000rpm for 1min. Collect the centrifuge solution and determine the RNA concentration using nanodrop2000 or nanodrop one UV spectrophotometer.

[0041] RNA reverse transcription: using TOYOBO's ReverTra qPCR RT Master Mixwith gDNARemover (FSQ 301) kit, the method is carried out according to the FSQ 301 operation process. The reverse system is 1ug total RNA. Take 1ug total RNA and add it to the eight-row strip, dilute it to 12μL with DEPC water, place it in the PCR instrument at 65℃ for 5min, and quickly cool it to 4℃. Add 4μL of DNA hydrolase mixture, mix it well, incubate it in the PCR instrument at 37℃ for 5min, and quickly cool it to 4℃. Add 4μL of reverse transcriptase mixture, mix it well, incubate it in the PCR instrument at 37℃ for 15min, anneal it at 50℃ for 5min, denature it at 95℃ for 5min, quickly cool it to 4℃, and store it in a -20℃ refrigerator.

[0042] Real-time fluorescence quantitative PCR: Use the SYBR Green Realtime PCR Master Mix (QPK-201) kit from TOYOBO. 20μL qPCR reaction system: 4.2μL DEPC water, 0.4μL each of 10μM upstream primer and downstream primer, 10μL SYRB GREEN enzyme (2X), 5μL diluted cDNA, mix well. Reaction procedure (three-step method): 95℃ denaturation for 1 minute; 95℃ denaturation for 10 seconds, 56℃ annealing for 20 seconds, 72℃ extension for 20 seconds, 40 cycles; 95℃ denaturation for 1 minute, 65℃ annealing for 1 minute, 95℃ 15 seconds, 40℃ 30 seconds.

[0043] Attached primer sequences:

[0044] Actb-m-q-F:AGTGTGACGTTGACATCCGT;

[0045] Actb-m-q-R:GCAGCTCAGTAACAGTCCGC;

[0046] Il6-m-q-F:CCCCAATTTCCAATGCTCTCC;

[0047] Il6-m-q-R:CGCACTAGGTTTGCCGAGTA;

[0048] Il1b-m-q-F:GAAATGCCACCTTTTGACAGTG;

[0049] Il1b-m-q-R:TGGATGCTCTCATCAGGACAG;

[0050] Ifnb-m-q-F:CAGCTCCAAGAAAGGACGAAC;

[0051] Ifnb-m-q-R:GGCAGTGTAACTCTTCTGCAT;

[0052] Il1a-m-F:CGAAGACTACAGTTCTGCCATT;

[0053] Il1a-m-R:GACGTTTCAGAGGTTCTCAGAG;

[0054] Cxcl2-m-F:CCAACCACCAGGCTACAGG;

[0055] Cxcl2-m-R:GCGTCACACTCAAGCTCTG;

[0056] Csf2-m-F:GGCCTTGGAAGCATGTAGAGG;

[0057] Csf2-m-R:GGAGAACTCGTTAGAGACGACTT;

[0058] Bcl6b-m-F:GGCTACGTCCGAGAGTTCAC;

[0059] Bcl6b-m-R:CTTGTGCGCTCTTAGGGGT;

[0060] Cxcl3-m-F:TCTCACCACAGCCCTTCGCA;

[0061] Cxcl3-m-R:AAAAACAAGCAGGTAAAGACACATC;

[0062] Il23a-m-F:ATGCTGGATTGCAGAGCAGTA;

[0063] Il23a-m-R:ACGGGGCACATTATTTTTAGTCT;

[0064] Hbegf-m-F:CGGGGAGTGCAGATACCTG;

[0065] Hbegf-m-R:TTCTCCACTGGTAGAGTCAGC;

[0066] Mcp1-m-F:GCATCCACGTGTTGGCTCA;

[0067] Mcp1-m-R:CTCCAGCCTACTCATTGGGATCA;

[0068] ACTB-h-q-F:AGAAGGATTCCTATGTGGGCG;

[0069] ACTB-h-q-R:GGATAGCACAGCCTGGATAGCA;

[0070] IL6-h-F:ACTCACCTCTTCAGAACGAATTG;

[0071] IL6-h-R:CCATCTTTGGAAGGTTCAGGTTG;

[0072] IL1B-h-F:ATGATGGCTTATTACAGTGGCAA;

[0073] IL1B-h-R:GTCGGAGATTCGTAGCTGGA;

[0074] IL1A-h-F:AGATGCCTGAGATACCCAAAACC;

[0075] IL1A-h-R:CCAAGCACACCCAGTAGTCT;

[0076] CSF2-h-F:TCCTGAACCTGAGTAGAGACAC;

[0077] CSF2-h-R:TGCTGCTTGTAGTGGCTGG;

[0078] HSV-1-qF: ATACCGACGATTCTGCGACCT;

[0079] HSV-1-qR: TTATTGCCGTCATAGCGCGG.

[0080] Example 5: Drug administration concentration screening

[0081] RAW264.7 cells were plated in 24-well plates, with 2*10^5 cells per well. The drugs were diluted and added to the corresponding 24-well plates (final drug concentrations of 0, 5, 10, 20, 30, and 40 μg / mL), with DMSO as a negative control. After incubation for 4 hours with the drug, the wells with DMSO negative control were left without LPS as a control, and the remaining wells were stimulated with LPS (200 ng / mL) for 6 hours. Three replicate wells were added for each well. The cells were harvested, RNA was extracted, reverse transcribed, and the RNA expression levels of Il6, Il1β, and chemokine Mcp1 were quantitatively detected in real time as an indicator of whether the drug has an anti-inflammatory effect. The results showed that the higher the drug concentration, the better the activity.

[0082] Example 6: Drug toxicity study

[0083] The toxic dose of isoquinoline compounds was detected by Cell Counting Kit-8. RAW264.7 macrophages were plated in 96-well plates (100 μL) at a cell density of 1*10^5 / mL. After 12 hours, the cells were pretreated with drug concentrations of 0 μg / mL (DMSO control), 5 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, and 40 μg / mL, respectively. Each treatment group had 8 or 4 replicates. After 12 hours of drug pretreatment, 10 μL of CCK-8 solution was added to each well. Do not generate bubbles in the wells and continue to incubate in a cell culture incubator for 2 hours. The absorbance at 450 nm was measured using an ELISA reader. The results showed that in RAW264.7 macrophages, drug concentrations higher than 40 μg / mL inhibited cell activity.

[0084] Example 7: Study on the broad spectrum of anti-inflammatory effects of drugs in different cells

[0085] RAW264.7 macrophages and primary mouse peritoneal macrophages were plated in 24-well plates, with 2*10^5 cells per well. After 12 hours, DMSO was used as a negative control. After adding 10μg / mL of drug and incubating for 4 hours, the wells with DMSO negative control were left without LPS as controls, and the remaining wells were stimulated with LPS (200ng / mL) for 6 hours. Three replicate wells were used for each. The cells were harvested, RNA was extracted, reverse transcribed, and real-time quantitative detection of RNA expression levels of Il6, Il1β, and chemokine Mcp1 was performed. THP-1 cells, a mononuclear cell line of human peripheral blood, were plated in 24-well plates, with 3*10^5 cells per well. After 12 hours, PMA induced the suspension cells to adhere to the wall. After 24 hours of adherence, the medium was changed. After 12 hours of recovery, DMSO was used as a negative control. After 4 hours of incubation with 10μg / mL of the drug, the wells with DMSO negative control were left without LPS as controls, and the remaining wells were stimulated with LPS (200ng / mL) for 6 hours. Three replicate wells were used for each. The cells were harvested, RNA was extracted, reverse transcribed, and the RNA expression levels of IL6, IL1β, and chemokine MCP1 were detected by real-time quantitative analysis. The results showed that the drug has broad-spectrum anti-inflammatory activity in different cell models.

[0086] Example 8: Transcriptome Sequencing Analysis

[0087] Sample preparation: 1*10^7 RAW264.7 macrophages were plated in 10 cm cell culture dishes, a total of 4 dishes. After 12 hours, DMSO and 10μg / mL of drugs were added to two dishes each for 4 hours. DMSO- and drug-treated cells were taken from one dish each, stimulated with 200ng / mL LPS, and collected after 6 hours. Collected 4 dishes of cells, added 1mL of TRIZOL lysis buffer to each dish, and mixed by pipetting.

[0088] Total RNA extraction: After TRIZOL lysis, place the cell sample at room temperature for 5-10 minutes to completely separate the nuclear protein from the nucleic acid. Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and place at room temperature for 3 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes. Transfer the upper aqueous phase to a clean centrifuge tube, add an equal volume of isopropanol, mix well, and place at room temperature for 20 minutes. Centrifuge at 12000 rpm at 4°C for 10 minutes and discard the supernatant. Add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 12000 rpm at 4°C for 3 minutes and discard the supernatant. Dry at room temperature for 5-10 minutes. Add 30-50 μL of RNase-free ddH2O to fully dissolve the RNA.

[0089] mRNA library construction:

[0090] 1. Use the Qubit RNA detection kit to accurately quantify Total RNA to determine the amount of Total RNA added for library construction.

[0091] 2. mRNA purification and fragmentation: Remove the mRNA Capture Beads from 2-8℃ and let it stand to balance to room temperature for about 30 minutes. Prepare a Nuclease free centrifuge tube, dissolve 0.01-5μg total RNA in 50μL Nuclease free water, and place it on ice for later use. Invert or vortex to mix the magnetic beads, pipette 50μL of magnetic bead suspension and add it to 50μL total RNA sample, and pipette it 6 times to mix it thoroughly. Place the mixture of magnetic beads and RNA in a PCR instrument, 65℃, 5min; 4℃ hold to denature the RNA. Incubate at room temperature for 5min to allow the mRNA to completely bind to the magnetic beads. Place the sample in a magnetic stand and let it stand at room temperature for 5min to separate the mRNA from the total RNA, and carefully remove the supernatant. Remove the sample from the magnetic stand, use 200μL BeadsWash Buffer, and pipette it repeatedly 6 times to mix it thoroughly. Place the sample in a magnetic rack, let it stand at room temperature for 5 minutes, and carefully remove the supernatant. Repeat the washing steps for a total of two washes. Remove the sample from the magnetic rack, add 50μL of Tris Buffer to resuspend the magnetic beads, and pipette repeatedly for 6 times to mix thoroughly. Place the sample in a PCR instrument, 80℃, 2min; 25℃hold, elute the mRNA. Add 50μL of Beads Binding Buffer, and pipette repeatedly for 6 times to mix thoroughly. Let it stand at room temperature for 5min to allow the mRNA to bind to the magnetic beads. Place the sample in a magnetic rack, let it stand at room temperature for 5min, and carefully remove the supernatant. Remove the sample from the magnetic rack, use 200μL of Beads Wash Buffer, pipette repeatedly for 6 times to mix thoroughly, put the sample back into the magnetic rack, let it stand at room temperature for 5min, and aspirate all the supernatant. Remove the sample from the magnetic rack, resuspend the magnetic beads with 18.5μL Frag / Prime buffer, and pipette 6 times to mix thoroughly; place the sample in a PCR instrument, 94℃ for 5min, and hold at 4℃. After the fragmentation program is completed, immediately place the sample in the magnetic rack, transfer 17μL of the supernatant to a new nuclease free centrifuge tube, and immediately enter the first-strand synthesis reaction.

[0092] 3. Double-stranded cDNA synthesis: Take out the 1st Strand Synthesis Reaction Buffer from -20℃, thaw and mix by inversion; prepare the reaction solution for the first-strand cDNA synthesis: Fragmented mRNA 17μL, Strand Specificity Reagent 6μL, 1st Strand Synthesis Enzyme Mix 2μL, a total of 25μL. Use a pipette to gently blow or vortex to mix, and centrifuge the reaction solution to the bottom of the tube. Place the above PCR tube in the PCR instrument, set the reaction program, and synthesize the first-strand cDNA. The PCR program is as follows: hot cover 105℃On, 25℃10min, 42℃15min, 70℃15min, 4℃Hold.

[0093] After the reaction is completed, the second-strand cDNA synthesis is immediately carried out. Prepare the second-strand cDNA synthesis reaction solution: 1st Strand cDNA 25μL, 2nd Strand Synthesis Buffer 20μL, 2nd Strand Synthesis EnzymeMix 5μL, a total of 50μL. Use a pipette to gently blow or vortex to mix, and centrifuge the reaction solution to the bottom of the tube. Place the above PCR tube in the PCR instrument, set the reaction program, and synthesize the second-strand cDNA. The PCR program is as follows: hot cover 105℃ Off, 16℃ 1hour, 4℃ Hold.

[0094] 4. Double-stranded cDNA purification: Hieff NGS TM DNA Selection Beads DNA (Cat#12601) was taken out from 2-8℃ 30min in advance and allowed to stand at room temperature to equilibrate to room temperature. Invert or vortex to allow Hieff NGS TMMix DNASelection Beads thoroughly, pipette 90μL (1.8×) magnetic bead suspension into the second-strand cDNA sample (50μL), vortex or use a pipette to mix thoroughly. Incubate at room temperature for 5 minutes. Let stand on the magnetic stand for 5 minutes. After the solution is clarified, keep the sample in the magnetic stand and carefully remove the supernatant. Keep the sample in the magnetic stand, add 200μL of freshly prepared 80% ethanol to rinse the magnetic beads (be careful not to blow the magnetic beads away), incubate at room temperature for 30s, and carefully remove the supernatant. Repeat the previous step for a total of 2 rinses. Keep the sample in the magnetic stand and open the lid to air dry the magnetic beads for 5 minutes. Remove the sample from the magnetic stand, add 51μL of nuclease free water, vortex or use a pipette to mix thoroughly, and let stand at room temperature for 5 minutes. After centrifugation, place the tube on a magnetic rack for 5 minutes. After the solution becomes clear, carefully pipette 50 μL of the supernatant into a new nuclease-free centrifuge tube.

[0095] 5. End repair / dA tail addition: After thawing Endprep Buffer and Endprep Enzyme, invert and mix, and place on ice for later use. Prepare the following reaction system in a sterile PCR tube: Fragmentedds cDNA 50μL, EndprepBuffer 6μL, Endprep Enzyme 4μL, a total of 60μL. Use a pipette to gently blow or vortex to mix, and centrifuge the reaction solution to the bottom of the tube. Place the above PCR tube in a PCR instrument, set the reaction program, and perform end repair / dA tail addition reaction. The PCR program is as follows: hot cover 105℃On, 30℃20min, 72℃20min, 4℃Hold.

[0096] 6. Adapter ligation: Thaw Ligation Enhancer, Quick T4 DNA Ligase and DNA Adapter, invert and mix, and place on ice for later use. Continue to prepare the following reaction system in the PCR tube after end repair / dA tail addition: dA-tailed DNA 60μL, Ligation Enhancer 30μL, Quick T4 DNA Ligase 5μL, DNA Adapter5μL, a total of 100μL. Use a pipette to gently blow or vortex to mix, and centrifuge the reaction solution to the bottom of the tube. Place the above PCR tube in the PCR instrument, set the following reaction program, and perform the adapter ligation reaction. The PCR program is as follows: hot cover 105℃Off, 20℃15min, 4℃Hold.

[0097] 7. Ligation product purification and fragment size sorting: Hieff NGS TMTake the DNA Selection Beads out of the refrigerator and equilibrate at room temperature for at least 30 minutes. Prepare 80% ethanol. Vortex or invert the beads to ensure thorough mixing. Pipette 80 μL of Hieff NGS TM Add DNA Selection Beads (0.8×, Beads:DNA=0.8:1) to the AdapterLigation product, vortex or pipette to mix, and incubate at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it on a magnetic rack to separate the beads and liquid. After the solution is clear (about 5 minutes), carefully remove the supernatant. Keep the PCR tube in the magnetic rack, add 200μL of freshly prepared 80% ethanol to rinse the beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant. Repeat step 5 for a total of two rinses. Keep the PCR tube in the magnetic rack, open the lid and air dry the beads until they just crack (no more than 5 minutes). Remove the PCR tube from the magnetic rack, add 102μL of ddH2O, vortex or use a pipette to gently pipette to mix thoroughly, and let it stand at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it in a magnetic rack. After the solution is clarified (about 5 minutes), carefully transfer 100 μL of supernatant to a new PCR tube for double-round sorting. According to the DNA fragment length requirements, add 58 μL of the first-round sorting magnetic beads to the above 100 μL DNA, vortex or pipette 10 times to mix. Incubate at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it in a magnetic rack. After the solution is clarified (about 5 minutes), carefully transfer the supernatant to a clean centrifuge tube, leaving 1-2 μL of solution at the bottom of the tube. Add 15 μL of the second-round sorting magnetic beads to the supernatant. Vortex or pipette 10 times to mix, and let it stand at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it in a magnetic rack. After the solution is clarified (about 5 minutes), carefully remove the supernatant. Keep the PCR tube in the magnetic rack, add 200μL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30s, and carefully remove the supernatant. Keep the PCR tube in the magnetic rack, open the lid and dry the magnetic beads until they just crack (about 5min). Remove the PCR tube from the magnetic rack, add 21μL of ddH2O, vortex or use a pipette to gently blow to mix thoroughly, and let it stand at room temperature for 5min. Centrifuge the PCR tube briefly and place it in the magnetic rack to separate the magnetic beads and liquid. After the solution is clear (about 5min), carefully transfer 2μL of supernatant to a clean tube.

[0098] 8. Library amplification: Keep the PCR tube in the magnetic rack at all times, open the lid and dry the magnetic beads until they just crack (about 5 minutes). Take the PCR tube out of the magnetic rack, add 21μL of ddH2O, vortex or use a pipette to gently blow and mix thoroughly, and let it stand at room temperature for 5 minutes. Centrifuge the PCR tube briefly and place it in the magnetic rack to separate the magnetic beads and liquid. After the solution is clear (about 5 minutes), carefully transfer 20μL of the supernatant to a clean tube. Place 2× Super Canace TM After thawing, mix the High-Fidelity Mix and Primer Mix reagents by inversion and place on ice for later use. Prepare the following reaction system in a sterile PCR tube: 2×Super Canace TM High-Fidelity Mix 25μL, Primermix 5μL, Adapter Ligated DNA 20μL, total 50μL. Use a pipette to gently blow or shake to mix, and briefly centrifuge to collect the reaction solution to the bottom of the tube. Place the PCR tube in the PCR instrument, set the following reaction program, and perform PCR amplification. The PCR program is as follows: 98℃1min; 98℃10s, 60℃30s, 72℃30s (14CT); 72℃5min, 4℃Hold. Use Hieff NGS TM DNA Selection Beads (0.9×, Beads:DNA=1:1) were used to purify the library amplification products.

[0099] Library quality control: The library was tested by gel electrophoresis. The main fragments were between 300-500 bp, with an error of about 50 bp, which met the sequencing requirements.

[0100] Quantitative mixing and sequencing: The recovered DNA is accurately quantified using the Qubit DNA detection kit to facilitate sequencing after equal mixing in a 1:1 ratio.

[0101] Example 9: Experimental verification of RNA-Seq results

[0102] RAW264.7 macrophages were plated in 24-well plates, with 2*10^5 cells per well. After 12 hours, DMSO and 10μg / mL dexamethasone and isoquinoline drugs were added for 4 hours, and 200ng / mL LPS was stimulated for 6 hours. Three replicate wells were used for each. Cells were harvested, RNA was extracted, reverse transcribed, and real-time quantitative detection of the expression of Csf2, Cxcl3, Il23a, Cxcl2, Hbegf, and Bcl6b was performed.

[0103] THP-1 cells, a mononuclear cell line derived from human peripheral blood, were plated in 24-well plates, with 3*10^5 cells per well. After 12 hours, PMA induced the suspension cells to adhere to the wall, and the medium was changed after 24 hours of adherence. After the cells recovered for 12 hours, DMSO and 10μg / mL dexamethasone and isoquinoline drugs were added for incubation for 4 hours, and 200ng / mL LPS was stimulated for 6 hours. Three replicate wells were used for each. The cells were harvested, RNA was extracted, reverse transcribed, and the expression of CSF2 was detected by real-time quantitative analysis.

[0104] Example 10: CSF2 positive feedback inflammatory response

[0105] THP-1 cells, a mononuclear cell line of human peripheral blood, were plated in 24-well plates, with 3*10^5 cells per well. After 12 hours, PMA induced the suspension cells to adhere to the wall. After 24 hours of adherence, the medium was changed. After the cells recovered for 12 hours, DMSO and 10μg / mL dexamethasone and isoquinoline drugs were added for incubation for 2 hours, and the medium was changed and CSF2 of the corresponding concentration and 200ng / mL LPS were added for stimulation for 6 hours. Three replicate wells were used for each. The cells were harvested, RNA was extracted, reverse transcribed, and the expression of CSF2 was detected by real-time quantitative analysis.

[0106] Example 11: Drug selectively inhibits activation of NFκB signaling pathway

[0107] RAW264.7 macrophages were plated in 6-well plates, with 8*10^5 cells per well. After 12 hours, DMSO and isoquinoline drugs were added and incubated for 4 hours, and then stimulated with 200ng / mL LPS for 0, 1, and 2 hours. The cells were harvested, total protein was extracted, and the activation degree of p65, p38, and Erk was detected by western blot.

[0108] Example 12: Drugs inhibit the expression of pro-inflammatory cytokines in the PGN-induced inflammation model

[0109] RAW264.7 macrophages were plated in 24-well plates, with 2*10^5 cells per well. After 12 hours, DMSO and 10μg / mL isoquinoline drugs were added for 4 hours, and PGN was stimulated for 6 hours. Three replicate wells were used for each. Cells were harvested, RNA was extracted, reverse transcribed, and real-time quantitative detection of the expression of Il1b, Il6, and Ifnb1 was performed.

[0110] Example 13: Drugs inhibit the expression of pro-inflammatory cytokines in the HSV-1-induced inflammation model

[0111] RAW264.7 macrophages were plated in 24-well plates, with 2*10^5 cells per well. After 12 hours, DMSO and 10μg / mL of isoquinoline drugs were added for 4 hours, and HSV-1 was stimulated for 6 hours. Three replicate wells were used for each. Cells were harvested, RNA was extracted, reverse transcribed, and real-time quantitative detection of the expression of Il1b, Il6, and HSV-1 was performed.

[0112] Example 14: Data Statistical Analysis

[0113] GraphPad Prism8 software was used for statistical analysis. Multiple groups of data were compared pairwise, and the difference between two groups was analyzed by unpaired T test. Data are presented as mean ± SEM. P value < 0.05 was considered statistically different, and P < 0.01 was considered to be extremely significant.

[0114] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. An isoquinoline anti-inflammatory drug, characterized in that: The structure is shown in formula (I):

2. An isoquinoline anti-inflammatory drug according to claim 1, characterized in that: The compound of formula (I) was dissolved in dimethyl sulfoxide at a concentration of 10 mg / mL, and the compound of formula (I) was diluted to a desired concentration using cell culture medium.

3. An isoquinoline anti-inflammatory drug according to claim 1-2, characterized in that: The compound of formula (I) is used to inhibit LPS-induced inflammatory response of RAW264.7 cells, LPS-induced inflammatory response of THP-1 cells, and LPS-induced inflammatory response of primary mouse macrophages.

4. An isoquinoline anti-inflammatory drug according to claim 1-2, characterized in that: The compound of formula (I) is applied to the PGN-induced inflammatory response of RAW264.7 cells.

5. An isoquinoline anti-inflammatory drug according to claim 1-2, characterized in that: The compound of formula (I) is used to inhibit the inflammatory response induced by HSV-1 infection.

6. An isoquinoline anti-inflammatory drug according to claim 1-2, characterized in that: The compound of formula (I) is used to inhibit the positive feedback effect of CSF2 on inflammatory response.

7. An isoquinoline anti-inflammatory drug according to claim 1-2, characterized in that: The compound of formula (I) is used to inhibit the activation of NF-κB signaling pathway and alleviate inflammatory response.

Images