Actinidia eriantha endophytic fungus and application thereof

Abstract

The invention discloses actinidia eriantha endophytic fungi and application thereof, and belongs to the technical field of plant growth promotion. The endophytic fungi are separated from living actinidia eriantha of actinidae plants by adopting a traditional endophytic fungi separation and purification technology, belong to ascomycophyta, hypocrea, erythrinae and spiropolyspora fungi, and are preserved in the China General Microbiological Culture Collection Center on March 8, 2024, the strain is classified and named as the powdery spiropolyspora farinosa AER17, and the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) No.41113. The invention further discloses a preparation method of the powdery spiropolyspora farinosa AER17. The invention also discloses an application of the endophytic fungi: the expression of Arabidopsis thaliana growth related genes DPE2, PHS1, G6PD3 and G6PD5 is improved, the growth of a model plant Arabidopsis thaliana is promoted, and the fresh weight is improved by 149.20% (Plt; 0.01), the root length is increased by 47.39% (Plt; 0.01) of the substrate.

Description

Technical Field

[0001] The invention relates to the technical field of plant growth promotion, in particular to an endophytic fungus of Actinidia pubescens and an application thereof in promoting the growth of a model plant Arabidopsis thaliana. Background Art

[0002] Actinidia eriantha Benth. is a perennial vine plant of the genus Actinidia in the family Actinidiaceae. Its dried root is used as medicine, also known as white peach, white vine pear root, white peach, vine pear root, etc. Actinidia eriantha Benth. is mainly distributed in Zhejiang, Jiangxi, Fujian, Hunan, Guangdong, Guangxi, Guizhou and other places. It is included in the 2015 edition of "Zhejiang Province Traditional Chinese Medicine Processing Standards" and is one of the commonly used medicinal materials of the She ethnic group. The root of white vine peach is cold in nature and bitter in taste. It has the effects of detoxification, swelling, clearing heat and removing dampness. It is mainly used to treat gastric cancer, nasopharyngeal cancer, breast cancer, lung cancer, etc. Its biologically active ingredients mainly include triterpenes, flavonoids, etc. In recent years, the artificial cultivation of Actinidia eriantha has become an increasing trend year by year. However, it was found in the research and production process that Actinidia eriantha Benth. The propagation method of cuttings and division is mostly used for the propagation of hairy kiwifruit, with a low propagation coefficient, and the medicinal part is the root. It is only harvested once after many years of cultivation, and the cultivation yield is not high.

[0003] Endophytic fungi colonize in plant tissues or cells and have co-evolved with host plants for a long time. Endophytic fungi do not cause obvious diseases in the plants themselves. In recent years, research on endophytic fungi in medicinal plants has focused on the biodiversity, distribution patterns, secondary metabolites, and the relationship between endophytic fungi and hosts. Endophytic fungi in plants can promote plant growth, resist pathogenic microorganisms, resist insect pests, promote plant resistance to abiotic stress, and produce secondary metabolites that are the same or similar to those of the host. Among them, endophytic fungi play an important role in promoting the growth of crops or medicinal plants. For example, Beauveria bassiana and Metarhizium anisopliae can form a symbiotic relationship with plants and have the ability to resist pathogenic microorganisms, enhance plant disease resistance and promote plant growth.

[0004] In order to increase the yield of medicinal plants, the market currently uses chemical, physical and agricultural measures to increase crop yields, but the effect is slow, and the long-term use of chemical fertilizers has a significant negative impact on soil fertility and microecology. Many studies have shown that plant endophytic fungi can promote plant growth. For example, the effective colonization of the endophytic fungus Phomopsis liquidambaris in peanuts can promote the growth of lateral roots and root hairs, promote nitrogen absorption and metabolism, and thus promote peanut growth. After inoculation with endophytic fungi, the ground diameter, aboveground fresh weight, underground fresh weight, aboveground dry weight and underground dry weight of Pinus sylvestris var. mongolica seedlings increased by 67.72%, 36.13%, 41.58%, 36.13% and 41.48% respectively compared with the control group. Endophytic fungi significantly promoted the growth of Pinus sylvestris seedlings. Arabidopsis thaliana is an annual herbaceous plant of the genus Arabidopsis in the family Cruciferae. It has become a model plant material in the study of medicinal botany and molecular biology because of its small genome, short growth cycle and easy genetic modification. Studies have shown that endophytes of medicinal plants can significantly promote the growth of Arabidopsis and increase its biomass accumulation. For example, after co-cultivation with Arabidopsis, endophytic fungi such as Penicillium sp. and Hansfordia sp. can change the root structure of Arabidopsis and promote the germination of lateral roots, thereby effectively promoting growth and increasing its biomass. The fermentation products of the endophytic fungus Epichloe bromicola of Coix can promote the development of lateral roots by inhibiting the length of the main root, enhancing the nutrient uptake efficiency of Arabidopsis, and thus promoting the growth of Arabidopsis. The endophytic fungus Y8 (Colletotrichum endophyticum) of Epimedium koreanum has the ability to secrete the auxin IAA. After inoculation with Arabidopsis, it can significantly promote the root growth of Arabidopsis and increase its biomass accumulation.

[0005] However, there are no reports on the application of endophytic fungi from Actinidia pubescens to promote the growth of Arabidopsis thaliana. Summary of the invention

[0006] The purpose of the present invention is to provide an endophytic fungus of Actinidia pubescens and an application thereof in promoting the growth of Arabidopsis thaliana in view of the deficiencies of the prior art.

[0007] In the first aspect of the present invention, there is provided an endophytic fungus of Actinidia pubescens, belonging to the Ascomycota, Hypocreales, Erythrocephalae, and Clonostachys genus. The endophytic fungus is isolated from the living body of Actinidia pubescens of Actinidia pubescens by using traditional endophytic fungi separation and purification technology, and is identified as Clonostachys farinosa AER17 by microbial taxonomy. The strain has been deposited, the strain deposit number is CGMCC No. 41113, the deposit date is March 8, 2024, and the deposit unit is China General Microbiological Culture Collection Center (CGMCC), the address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the zip code is 100101.

[0008] The solid culture characteristics of the endophytic fungus of the present invention are: cultured on PDA solid medium at 26°C, growing slowly, the colonies are white powdery, with obvious filamentous edges, and light pink on the back. Figure 1 Under the microscope, the mycelium is thin, the surface is smooth, the internal divisions are obvious, and the mycelium is expanded in a network, such as Figure 2 shown.

[0009] The endophytic fungus ITS molecular sequence of the present invention is shown in SEQ ID NO.1:

[0010] TTACCGAGTTTACAACTCCCAAACCCATGTGAACATACCTACTGTTGCTTCGGCGGGATTGCCCCGGGCGCCTCGTGTGCCCCGGATCAGGCGCCCGCCTAGGAACTTCAACTCTTGTTTTATTTTGAATCTTCTGAGTAGTTTTTACAAATAAATAAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCTGAGCGTCATTTCAACCCTCATGCCCCTAGGGCGTGGTGTTGGGGATCGGCCAAAGCCCGCGAGGGACGGCCGGCCCCTAAATCTAGTGGCGGACCCGTCGTGGCCTCCCCTGCGAAGTAGTGATATTCCGCATCGGAGAGCGACGAGCCCCTGCCGTTAAAACCCCC.

[0011] The sequencing results were compared on the NCBI website (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi), and the sequence homology with Clonostachys farinosa (OQ910590), Clonostachys farinosa (OQ910595), and Clonostachys farinosa (OQ910616) was 99.79%, 99.58%, and 99.58%, respectively. Multiple sequence alignment was performed using MEGA7.0, and neighbor-joining (NJ) analysis was used. One sequence was randomly selected and the alignment was repeated 1000 times. The phylogenetic tree of the endophytic fungi of the present invention is shown in Figure 3 .

[0012] The second aspect of the present invention provides the use of the above endophytic fungus in promoting the growth of Arabidopsis thaliana.

[0013] Specifically: the fungus is made into a 5×5mm cake and inoculated into the Arabidopsis growth medium, which can increase the expression of Arabidopsis growth-related genes DPE2, PHS1, G6PD3, and G6PD5, promote the growth of Arabidopsis lateral roots, and increase the fresh weight of Arabidopsis.

[0014] The above applications are mainly realized through the following technical solutions:

[0015] (1) AER17 was picked out from the cryopreservation tube and inoculated into PDA medium (the formula is 200 g potato, 20 g glucose, 15 g agar, 1000 mL distilled water, natural pH), and cultured in the dark at 26°C and 65% humidity for 7 days.

[0016] (2) Take an appropriate amount of Arabidopsis seeds and put them into a centrifuge tube. Add an appropriate amount of 75% ethanol, shake up and down for 30 seconds, aspirate the ethanol, add an appropriate amount of sodium hypochlorite to the centrifuge tube, shake for 7-8 minutes, aspirate the sodium hypochlorite, add an appropriate amount of sterile water, shake for 3-4 minutes, aspirate the sterile water, repeat 5 times, and finally add agar water to the centrifuge tube. Use a pipette to spot Arabidopsis on a 1 / 2MS plate and seal it with a sealing film. After incubating the plate in a 4°C refrigerator for 2 days, place it in an artificial climate incubator at 24°C for incubation.

[0017] The formula of 1 / 2MS culture medium is potassium nitrate 0.95g / L, ammonium nitrate 0.825g / L, potassium dihydrogen phosphate 0.085g / L, magnesium sulfate 0.09g / L, calcium chloride 0.165g / L, potassium iodide 0.83mg / L, boric acid 6.2mg / L, manganese sulfate 16.9mg / L, zinc sulfate 8.6mg / L, sodium molybdate 0.25mg / L, copper sulfate 0.025mg / L, inositol 0.1g / L, cobalt chloride 0.025mg / L, glycine 2.0mg / L, EDTA sodium salt 37.26mg / L, vitamin B1 0.1mg / L, ferrous sulfate 15.2mg / L, niacin 0.5mg / L, vitamin B6 0.5mg / L, pH 5.80-6.00.

[0018] (3) Draw a horizontal line at a diameter of about 7 cm on the upper part of the 1 / 2 MS medium, and select five Arabidopsis seedlings with similar growth conditions, with the interval between the seedlings being 0.5-1.0 cm.

[0019] (4) In the experimental group, a 5×5 mm fungus cake was punched out with a hole puncher and placed 3 cm away from the Arabidopsis seedlings with tweezers. A PDA block of the same size was punched out with a hole puncher as the control group. Three biological replicates were set for each treatment.

[0020] (5) The plants were cultured in a 24°C light incubator with 16 h of light and 8 h of darkness. The fresh weight and root length of Arabidopsis were measured 14 days later. It was clearly observed that AER17 promoted the growth of Arabidopsis ( Figure 4 ), transcriptome sequencing showed that AER17 significantly increased the expression of Arabidopsis growth-related genes DPE2, PHS1, G6PD3, and G6PD5 ( Figure 5 ).

[0021] The present invention has the advantages that:

[0022] The endophytic fungus Clonostachys farinosa AER17 of the kiwifruit of the present invention can improve the expression of Arabidopsis growth-related genes DPE2, PHS1, G6PD3, and G6PD5 after co-cultivation with Arabidopsis thaliana, promote the growth of Arabidopsis thaliana, increase the fresh weight of Arabidopsis thaliana by 149.20% (P<0.01), and increase the root length by 47.39% (P<0.01). The endophytic fungus of the present invention has an obvious effect of promoting the growth of Arabidopsis thaliana, and brings broad application prospects to the field of plant growth promotion technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The present invention is further described below in conjunction with the accompanying drawings and embodiments;

[0024] Figure 1: Colony morphology of Clonostachys farinosa AER17;

[0025] Figure 2 :The bacterial morphology of Clonostachys farinosa AER17 under a microscope;

[0026] Figure 3 :Phylogenetic tree of Clonostachys farinosa AER17 based on ITS (NJ method);

[0027] Figure 4 : Actual photos and biomass statistics of the effect of Clonostachys farinosa AER17 on the fresh weight and root length of Arabidopsis thaliana;

[0028] Figure 5 :Statistical graph showing that Clonostachys farinosa AER17 increases the expression levels of Arabidopsis growth-related genes DPE2, PHS1, G6PD3, and G6PD5. DETAILED DESCRIPTION

[0029] The endophytic fungus of the invention is a strain separated from the roots of hairy-flowered kiwifruit produced in Liandu, Lishui, Zhejiang.

[0030] In the following examples, unless otherwise indicated, % refers to volume percentage.

[0031] Embodiment 1:

[0032] The endophytic fungi are separated and obtained according to the following steps: the collected hairy kiwifruit roots are rinsed under tap water for 30 minutes to remove the soil and other impurities on the surface, the surface moisture is dried with sterilized filter paper, and three-step surface disinfection treatment is performed: 75% ethanol treatment for 1 minute, 2.5% sodium hypochlorite treatment for 5 minutes, and 75% ethanol treatment for 1 minute. After the sample is disinfected, it is dried with sterilized filter paper, and the roots are cut into small tissue blocks (0.5cm×0.5cm) with a sterile scalpel, and 120 tissue blocks are randomly selected, and each group of 3 tissue blocks is placed in a plate containing penicillin (50mg / L) PDA culture medium (PDA culture medium formula is 200g potato, 20g glucose, 15g agar, 1000mL distilled water, pH natural). After sealing, it is placed in a 26°C fungal incubator for culture, and the growth of endophytic fungal hyphae and the formation of colonies are regularly observed. After the hyphae grow out from around the tissue block, the tip hyphae are picked and transferred to a new PDA culture dish to be cultured until the hyphae have a single morphology, and finally the endophytic fungus strain AER17 of the present invention is isolated. Figure 1As shown, it grows slowly on the PDA plate, and the colonies are white powdery, with obvious filamentous edges and light pink on the back. Figure 2 ), it can be seen that the mycelium is relatively fine, the surface is smooth, the separation is obvious, and the mycelium is expanded in a network.

[0033] Take the frozen tube of AER17 strain, inoculate the bacterial cake into PDA medium, and culture it in the dark at 26℃ and 65% humidity for 7 days. The genomic DNA of the isolated and purified endophytic fungus AER17 was extracted using the Takara9770A kit. Primers ITS4 (SEQ ID NO.2: 5'-GGAAGTAAAAGTCGTAAGG-3') and ITS5 (SEQ ID NO.3: 5'-TCCTCCGCTTAT TGATATGC-3') were used for PCR amplification. PCR reaction system (50μL): 2μL DNA template; 1μL primers ITS4 and ITS5; 2×TapPCR MasterMix (containing dye solution) 25μL; ddH2O is added to 50μL. The PCR reaction cycle parameters and steps are as follows: 95°C pre-denaturation for 3 min; 94°C denaturation for 40 s, 52°C annealing for 50 s, 72°C extension for 1 min, 35 cycles of denaturation-annealing-extension; and finally 72°C extension for 10 min. The PCR product detected by agarose gel electrophoresis was sent to Shanghai Bioengineering Company for sequence determination, and the sequence is shown in SEQ ID NO.1. The sequence measured by the PCR product was used as the target sequence, and the homologous sequence was searched in the GenBank database in NCBI. The reference sequence most similar to the morphological sequence was downloaded, and the phylogenetic analysis was performed using the neighbor-joining method (NJ) to determine the phylogenetic status of the strain to be identified, such as Figure 3 As shown. The sequence homology of the endophytic fungus of the present invention with Clonostachys farinosa (OQ910590), Clonostachys farinosa (OQ910595), and Clonostachys farinosa (OQ910616) is 99.79%, 99.58%, and 99.58%, respectively. It belongs to the phylum Ascomycota, the orders Hypocreales, the family Erythrocephala, and the genus Clonostachys. It is classified and named as Clonostachys farinosa AER17, and the strain deposit number is CGMCC No.41113.

[0034] Embodiment 2:

[0035] Under sterile conditions, AER17 was picked out from the cryopreservation tube and inoculated into PDA medium (the formula is 200g potato, 20g glucose, 15g agar, 1000mL distilled water, natural pH), and cultured in the dark at 26℃ and 65% humidity for 7 days. Take an appropriate amount of Arabidopsis seeds and put them into a centrifuge tube, add an appropriate amount of 75% ethanol, shake up and down for 30s, suck out the ethanol, add an appropriate amount of sodium hypochlorite to the centrifuge tube, shake for 7-8min, suck out the sodium hypochlorite, add an appropriate amount of sterile water to the centrifuge tube, shake for 3-4min, suck out the sterile water, repeat 5 times, finally add agar water to the centrifuge tube, use a gun tip to spot Arabidopsis on a 1 / 2MS plate, and seal it with a sealing film. After the plate is cultured in a 4℃ refrigerator for 2 days, it is cultured in an artificial climate incubator at 24℃. The formula of 1 / 2MS culture medium is 0.95g / L potassium nitrate, 0.825g / L ammonium nitrate, 0.085g / L potassium dihydrogen phosphate, 0.09g / L magnesium sulfate, 0.165g / L calcium chloride, 0.83mg / L potassium iodide, 6.2mg / L boric acid, 16.9mg / L manganese sulfate, 8.6mg / L zinc sulfate, 0.25mg / L sodium molybdate, 0.025mg / L copper sulfate, 0.1g / L inositol, 0.025mg / L cobalt chloride, 2.0mg / L glycine, 37.26mg / L EDTA sodium salt, 0.1mg / L vitamin B1, 15.2mg / L ferrous sulfate, 0.5mg / L niacin, vitamin B6 0.5mg / L, pH 5.80-6.00.

[0036] Draw a horizontal line at a diameter of about 7 cm on the upper part of the 1 / 2MS culture medium, select 5 Arabidopsis seedlings with similar growth conditions and pick up the straight line. The interval between the seedlings is 0.5-1.0 cm. In the experimental group, the AER17 fungal cake was punched out with a hole puncher, and the cake was picked up with tweezers and placed 3 cm away from the Arabidopsis seedlings; PDA blocks of the same size were punched out with a hole puncher as the control group, and 3 biological replicates were set up for each treatment. Cultured in a 24°C light incubator with 16 h of light and 8 h of darkness, the fresh weight and root length of Arabidopsis were measured after 14 days, and it can be clearly observed that AER17 promotes the growth of Arabidopsis, with the fresh weight increased by 149.20% (P<0.01) and the root length increased by 47.39% (P<0.01). Figure 4 shown.

[0037] Arabidopsis thaliana in the control group and AER17 treatment group after 14 days of co-cultivation were washed with sterile water, dried with sterile filter paper, and placed in liquid nitrogen for later use. Arabidopsis total RNA was extracted with Trizol reagent, and the quantity and purity of total RNA were analyzed using Bioanalyzer2100 and RNA6000Nano LabChip Kit (Agilent, CA, USA, 5067-1511), respectively. Sequencing libraries were constructed using high-quality RNA samples with RIN values ​​> 7.0. Oligo (dT) magnetic beads were used to specifically capture mRNA with Poly A through two rounds of purification. The captured mRNA was fragmented using a magnesium ion shearing kit under high temperature conditions, 94°C, 5-7min. The fragmented RNA was synthesized into cDNA by reverse transcriptase, and the second strand was synthesized by Escherichiacoli DNA polymerase I. The composite double strands of these DNA and RNA were converted into DNA double strands. At the same time, dUTP Solution was added to the second strand to fill the ends of the double strand DNA into blunt ends, and then an A base was added to each end so that it could be connected to the adapter with a T base at the end, and the fragment size was screened and purified using magnetic beads. The second strand was digested with UDG enzyme, and then PCR was used to form a library with a fragment size of 300±50bp. Finally, the double-end sequencing was performed using Illumina Novaseq TM 6000 according to standard operations, and the sequencing mode was PE150. The FPKM value was used to represent the gene expression level. The results showed that AER17 significantly increased the expression of Arabidopsis growth-related genes DPE2, PHS1, G6PD3, and G6PD5. The FPKM values ​​of the above four genes in the control group were 14.2, 15.3, 6.0, and 10.9, respectively. The FPKM values ​​of the four genes in the AER17 treatment group were 35.9, 52.2, 26.6, and 25.1, respectively, which were increased by 152.82%, 241.18%, 343.33%, and 130.28% compared with the control, respectively. Figure 5 shown.

[0038] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the embodiments. Those skilled in the art may make various equivalent modifications or substitutions without violating the spirit of the present invention. These equivalent modifications or substitutions are all included in the scope defined by the claims of this application.

Claims

1. An endophytic fungus of Actinidia pubescens, characterized in that: The endophytic fungus was isolated from the living body of Actinidia quinata, a plant of the Actinidia genus, Actinidiaceae, using traditional endophytic fungus separation and purification technology. It belongs to the Ascomycota, Hypocreales, Erythrocephalae, and Clonostachys genus. It was deposited in the China General Microbiological Culture Collection Center on March 8, 2024, and was classified and named Clonostachys farinosa AER17, and the culture collection number is CGMCC No.41113.

2. An application of the endophytic fungus of Actinidia pubescens according to claim 1, characterized in that: Used to promote the growth of the model plant Arabidopsis thaliana.

3. The use according to claim 2, characterized in that: The endophytic fungus of Actinidia pubescens promotes the growth of Arabidopsis thaliana by promoting the increase of fresh weight and root length and improving the expression of growth-related genes DPE2, PHS1, G6PD3 and G6PD5.

4. The use according to claim 3, characterized in that: The application is specifically to co-cultivate the endophytic fungi of Actinidia pubescens and Arabidopsis thaliana.

5. The use according to claim 4, characterized in that: The co-culture conditions were as follows: culture in a 24°C light incubator with 16 h of light and 8 h of darkness.

6. The use according to claim 4, characterized in that: The co-cultivation medium was 1 / 2MS medium, and the endophytic fungi of Actinidia pubescens were inoculated into the 1 / 2MS medium in the form of bacterial cakes, and the inoculation amount of bacterial cakes was 1 bacterial cake / plate.

7. The use according to claim 6, characterized in that: The formula of 1 / 2MS culture medium is: potassium nitrate 0.95g / L, ammonium nitrate 0.825g / L, potassium dihydrogen phosphate 0.085g / L, magnesium sulfate 0.09g / L, calcium chloride 0.165g / L, potassium iodide 0.83mg / L, boric acid 6.2mg / L, manganese sulfate 16.9mg / L, zinc sulfate 8.6mg / L, sodium molybdate 0.25mg / L, copper sulfate 0.025mg / L, inositol 0.1g / L, cobalt chloride 0.025mg / L, glycine 2.0mg / L, EDTA sodium salt 37.26mg / L, vitamin B1 0.1mg / L, ferrous sulfate 15.2mg / L, niacin 0.5mg / L, vitamin B6 0.5mg / L, pH 5.80-6.00.

Images