Penicillium oxalicum JM-C14-2 and application thereof

Abstract

The invention provides penicillium oxalicum JM-C14-2 and application thereof, and belongs to the technical field of microorganisms, and the preservation number of the penicillium oxalicum JM-C14-2 is CCTCC (China Center for Type Culture Collection) NO: M 20232615. The frontal bacterial colony of the penicillium oxalicum JM-C14-2 is dark green and has neat edges, the surface of the frontal bacterial colony is covered with a compact villous structure, and concentric annular textures are formed in the center of the bacterial colony; the conidiophore is usually monophytic or branched, the top end of the conidiophore is of a typical broom-shaped branch structure, conidium chains are arranged in a radial mode, and the surface of the conidium chains is smooth. The Penicillium oxalicum strain has obvious cellulase production capability and strong neutral phosphatase production capability, can prevent the diffusion and growth of pathogenic bacteria, can be prepared into a biological preparation for promoting plant growth and inhibiting pathogenic bacteria, improves soil nutrients, and has wide market application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a strain of Penicillium oxalicum JM-C14-2 and an application thereof. Background Art

[0002] Penicillium oxalicum is a fungus widely found in nature, and has attracted much attention for its unique metabolic characteristics and biological activity. This strain mainly comes from soil, plant residues, air, and some agricultural and sideline products. It is widely distributed, highly adaptable, and can survive and reproduce in a variety of natural environments.

[0003] In recent years, with the increasing attention paid to environmental protection and sustainable development, the development of green and efficient production technologies using microbial resources has become a research hotspot. Oxalic acid Penicillium has received widespread attention due to its unique physiological characteristics. Oxalic acid Penicillium can not only efficiently produce organic acids such as oxalic acid, but also has the ability to degrade a variety of difficult-to-degrade substances, such as polyethylene in plastic waste, showing its unique value in solving environmental pollution problems. In addition, this type of fungus can also synthesize a variety of secondary metabolites, including antibiotics, antioxidants, etc., which is also of great significance to the development of the pharmaceutical and health industry.

[0004] At present, there have been many basic studies on Penicillium oxalate at home and abroad, but there are still relatively few systematic explorations of its application in the agricultural field and research and development of its mechanism of action, including the decomposition of organic and inorganic substances in the soil, salt resistance, soil-borne diseases and the growth-promoting effect on plants. Further in-depth research on the specific mechanism and performance of Penicillium oxalate is still needed to provide new ideas for how to improve its application efficiency in agricultural production practice and the sustainable development of modern agriculture. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Penicillium oxalicum JM-C14-2 and its application. The Penicillium oxalicum JM-C14-2 has obvious cellulase production ability, protease production ability and neutral phosphatase production ability, and can be used to prepare a biological preparation for promoting tomato growth and inhibiting pathogens.

[0006] In order to achieve the above-mentioned invention object, the present invention adopts the following technical solutions: The present invention provides a strain of Penicillium oxalicum JM-C14-2, which is classified as Penicillium oxalicum strain JM-C14-2 is deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M 20232615.

[0007] Furthermore, the front colonies of the Penicillium oxalicum JM-C14-2 are dark green with neat edges and a surface covered with dense villi. The center of the colony darkens in color due to the accumulation of mature conidia, forming a concentric ring texture. Conidiophores are usually solitary or branched, with a typical broom-like branch structure at the top. The conidia chains are arranged radially, with a diameter of about 2.5-3.5 μm and a smooth surface.

[0008] The present invention also provides the use of the Penicillium oxalicum JM-C14-2 in preparing a biological agent for promoting tomato growth.

[0009] Furthermore, the tomato growth includes nutrient accumulation in tomato leaves and growth in tomato roots.

[0010] Furthermore, the oxalicum Penicillium JM-C14-2 can increase the length, surface area and volume of the root system, and improve the structure and function of the tomato root system.

[0011] Furthermore, the oxalicum Penicillium JM-C14-2 can increase the chlorophyll content, nitrogen accumulation and leaf surface temperature of tomato leaves.

[0012] The present invention also provides the use of the Penicillium oxalicum JM-C14-2 in the preparation of a biological preparation for inhibiting pathogenic bacteria.

[0013] Furthermore, the pathogen is Fusarium oxysporum.

[0014] The invention also provides the use of the Penicillium oxalicum JM-C14-2 in improving soil nutrients.

[0015] Furthermore, the Penicillium oxalicum JM-C14-2 has high protease production capacity, the ability to dissolve inorganic phosphorus and organic phosphorus, and the ability to produce cellulase.

[0016] Furthermore, the oxalic acid Penicillium JM-C14-2 has the ability to secrete oxalic acid and has strong salt-alkali resistance, which increases the content of soil hydrolyzable nitrogen, available phosphorus, quick-acting potassium, and organic matter.

[0017] Compared with the prior art, the present invention has the following advantages and technical effects: 1. The oxalic acid Penicillium JM-C14-2 provided by the present invention has a relatively obvious ability to produce cellulase and high ability to produce protease. At the same time, experiments have also verified that the oxalic acid Penicillium has a strong ability to produce neutral phosphatase. The neutral phosphatase produced by the oxalic acid Penicillium is 2-3 times that of the ordinary control group. The oxalic acid Penicillium described in the present invention secretes a variety of enzymes, which can be used for biodegradation of petroleum hydrocarbons, pectin, lignocellulose and phosphorus-containing pesticides, etc., and converts certain difficult-to-degrade organic pollutants into nutrients that can be used by microorganisms, thereby realizing the recovery and reconstruction of soil microbial communities.

[0018] 2. The oxalic acid Penicillium JM-C14-2 provided by the present invention has strong salt and alkali resistance, and certain substances secreted by the oxalic acid Penicillium can prevent the spread and growth of pathogens, further exploring its wide application potential in various contaminated sites.

[0019] 3. The oxalic acid Penicillium JM-C14-2 provided by the present invention can promote the growth of the root system and increase the chlorophyll content, nitrogen accumulation and leaf surface temperature of tomato leaves; at the same time, it can improve soil nutrients, including significantly improving the content of soil hydrolyzable nitrogen, effective phosphorus, quick-acting potassium and organic matter, further providing new ideas for how to improve application efficiency in modern agricultural production practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a morphological characteristic diagram of the oxalicum Penicillium JM-C14-2 on the Bengal red culture medium; wherein a is a front view of the plate, and b is a back view of the plate; Figure 2 The morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into the protease identification medium; wherein a is the front view of the plate, and b is the back view of the plate; Figure 3 It is a data diagram of protease production by the Penicillium oxalicum JM-C14-2; Figure 4 This is a morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into an inorganic phosphorus culture medium; wherein a is a front view of the plate, and b is a back view of the plate; Figure 5 This is a morphological diagram of the Penicillium oxalicum JM-C14-2 inoculated into an organophosphorus culture medium; wherein a is a front view of the plate, and b is a back view of the plate; Figure 6 The data diagram of neutral phosphatase production by the Penicillium oxalicum JM-C14-2 strain; Figure 7 It is a morphological characteristic diagram of the oxalicum Penicillium JM-C14-2 on the cellulase culture medium; wherein a is a front view of the plate, and b is a back view of the plate; Figure 8 It is a data diagram of the production of cellulase by the Penicillium oxalicum JM-C14-2 strain; Fig. 9 This is a morphological diagram of the oxalicum Penicillium JM-C14-2 inoculated into a saline-alkali culture medium; wherein a is a front view of the plate, and b is a back view of the plate; Fig.10 The figure is a morphological diagram of the antagonism between the Penicillium oxalicum JM-C14-2 and Fusarium lanceolatum; wherein a is the treatment group and b is the control group; Fig.11The tomato root growth after being treated with the Penicillium oxalicum JM-C14-2 suspension and the control CK graph; Fig.12 This is a scanning data diagram of tomato root system after application of the Penicillium oxalicum JM-C14-2 bacterial suspension; Fig.13 Data chart of leaf chlorophyll changes after applying oxalic acid Penicillium JM-C14-2 to potted tomatoes; Fig.14 Data on changes in leaf nitrogen content after application of oxalic acid Penicillium JM-C14-2 to potted tomatoes. DETAILED DESCRIPTION

[0021] The following will combine the contents in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Example 1: Source and screening of strains 1. Strain source The samples were collected from the soil under the crop residue pile in a greenhouse in Qingtianhu Village, Daotian Town, Shouguang City, Weifang City, Shandong Province in May 2023. The sampling was carried out according to the five-point sampling method, and the samples were mixed evenly and refined to obtain the original samples. After returning to the laboratory, some samples were stored at -80°C for strain isolation and screening. Some samples were air-dried for the determination of soil physical and chemical properties. The soil physical and chemical properties are shown in Table 1.

[0023] Table 1: Physical and chemical properties of sampled soil

[0024] 2. Strain screening Weigh 1 g of the fresh soil sample stored at -80°C, add 9 mL of phosphate buffer, shake well and mix to make 10 - ¹ dilution. Then 10-fold serial dilution (10 - ², 10 - ³、10 -4 ), the final dilution was 10 -4 Separate for concentrations appropriate for separation.

[0025] (1) Red Bengal culture medium Glucose 10g, peptone 5g, potassium dihydrogen phosphate 1.0g, magnesium sulfate (anhydrous) 0.5g, rose Bengal (concentration 10g / L) 3.3ml, agar 15g / L, dissolved in 1000ml distilled water, add 0.1g / 3.3ml of streptomycin per liter of culture medium before use.

[0026] (2) Fungal screening Initial screening: Select Bengal red medium suitable for the growth of Penicillium oxalicum. Take an appropriate amount of dilution (concentration of 10 -4 ) on the plate culture medium, and do 3 replicates for each dilution. Place the plate in a 28℃ constant temperature incubator for 3-5 days and observe the growth of the colonies. And observe its conidia chain and hyphae structure under a microscope. Screen out strains with typical morphological characteristics of Penicillium oxalicum, record the colony number, and purify.

[0027] Rescreening: Obtain pure culture by single spore isolation method to ensure the purity of the strain. Inoculate the purified strain onto red Bengal slant medium and store at 4°C for later use.

[0028] (3) Purification and culture of fungi Purification culture is performed from the suspected oxalic acid Penicillium colonies obtained by screening to obtain a pure oxalic acid Penicillium strain. To ensure the purity of the strain, multiple purification cultures may be required. After each purification, the strain must be identified under a microscope to confirm whether it is a single oxalic acid Penicillium strain. Finally, a suspected oxalic acid Penicillium strain was screened out and named oxalic acid Penicillium JM-C14-2.

[0029] Example 2: Strain Identification 1. Morphological identification The oxalicum Penicillium JM-C14-2 was inoculated on red Bengal medium and cultured. Figure 1 As shown in the figure, the front colony of Penicillium oxalicum JM-C14-2 is dark green with neat edges and dense villi on the surface, which is the dense growth area of ​​conidiophores. The color of the center of the colony deepens due to the accumulation of mature conidia, forming a concentric ring texture. Conidiophores are usually solitary or branched, with a typical broom-like branch structure visible at the top. The conidia chains are arranged radially, with a diameter of about 2.5–3.5μm and a smooth surface. The back of the strain is accompanied by the diffusion of transparent or light red water-soluble pigments, which are secondary metabolites. The mycelium is colorless or light brown in the culture medium, with a diameter of about 3–5μm, obvious separation, and the branching angles are mostly acute, which conforms to the typical microscopic characteristics of the genus Penicillium.

[0030] 2. Identification of strains using ITS method (1) The sequences of the primers used for PCR amplification of ITS rDNA are as follows (synthesized by TSINGKE, 5'→3'): ITS1: TCCGTAGGTGAACCTGCGG (SEQ ID No. 1); ITS4: TCCTCCGCTTATTGATATGC (SEQ ID No. 2).

[0031] (2) Method of extracting genomic DNA from fungi using a kit: Because fungal cells have thick cell walls on the outside, the effect of thermal lysis is poor, so a special silica gel column method is generally used to extract the genome. This experiment used the Solarbio Fungal Genomic DNA Extraction Kit (D2300).

[0032] (3) PCR reaction system (50ul) Table 2: PCR reaction system

[0033]

[0034] (4) PCR reaction conditions 95℃, 5min; (95℃, 15s; 58℃, 30s; 72℃, 10s) 30cycle; 72℃, 10min; 4℃, ∞.

[0035] 3. Single strain sequencing analysis The purified PCR product was subjected to base sequence determination (the product sequence is shown in SEQ ID No. 3). The forward and reverse sequences of the successfully sequenced peak graph were spliced ​​to obtain the 16s rDNA sequence of the strain, and the obtained sequence was Blast aligned on NCBI (https: / / www.ncbi.nlm.nih.gov / ), where Nucleotide BLAST was selected; the sequence was directly pasted into the "Enter Query Sequence" box and clicked "Blast" for alignment. After sequence alignment, it was confirmed that the oxalicum Penicillium JM-C14-2 belonged to the genus Penicillium.

[0036] The screened Penicillium oxalicum JM-C14-2 strain was deposited in China Center for Type Culture Collection; Address: Wuhan University, Wuhan, China; Deposit date: December 21, 2023; Penicillium Oxalicum strain The deposit number of JM-C14-2 is CCTCC NO: M 20232615.

[0037] Example 3: Analysis of the decomposition characteristics of soil organic nitrogen by Penicillium oxalicum 1. Protease screening medium: A: 5 g skim milk powder was dissolved in 500 ml distilled water and sterilized by autoclave at 115°C for 10 min. B: Dissolve 15 g of agar powder in 500 ml of distilled water and sterilize at 121°C for 20 min.

[0038] Mix the sterilized A and B and pour into a plate for later use.

[0039] After inoculation, culture the cells in a 30°C incubator for 3 days to observe the presence of a transparent zone and record its size.

[0040] 2. Protein decomposition characteristics In the clean bench, inoculate the oxalic acid Penicillium strain into the protein culture medium to ensure that the operation area is sterile. After the inoculation is completed, the plate is inverted and placed in a constant temperature incubator. According to the suitable growth temperature of oxalic acid Penicillium 28°C, it is cultured for 3-5 days, and the colony growth and transparent circle formation are observed daily.

[0041] like Figure 2 As shown, the colonies grew densely and were distributed over a large area on the surface of the culture medium, indicating that the bacteria had good adaptability and growth vitality on the protein culture medium and could utilize the nutrients in the culture medium for proliferation; this indicated that Penicillium oxalicum had a certain ability to decompose organic nitrogen.

[0042] 3. Protease production Using commercially available Bacillus subtilis as CK, purified Penicillium oxalicum JM-C14-2 and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The total amount of protease was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0043] The results showed that Figure 3 Compared with the protease concentration of 13.81 ug / L in the control group, the protease concentration of Penicillium oxalicum JM-C14-2 was 48.28 ug / L, indicating that Penicillium oxalicum has the ability to produce high protease and also has the ability to decompose soil organic nitrogen.

[0044] Example 4: Analysis of the effect of Penicillium oxalicum on the decomposition of inorganic phosphorus and organic phosphorus in soil 1. Effect of Penicillium oxalicum on the decomposition of inorganic phosphorus in soil Prepare inorganic phosphorus culture medium: 10 g glucose, 0.5 g ammonium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate heptahydrate, 0.03 g ferrous sulfate heptahydrate, 0.03 g manganese sulfate tetrahydrate, 5.0 g calcium phosphate, 20 g agar, dissolve in 1000 mL distilled water, pH 7.0, and sterilize at 121°C for 20 min.

[0045] Perform sterile operation in a clean bench and inoculate Penicillium oxalicum JM-C14-2 onto an inorganic phosphorus medium plate. After inoculation, place the plate upside down in a constant temperature incubator and culture it at 28°C, the suitable growth temperature for Penicillium oxalicum, for 3-5 days, and observe the colony growth and the formation of the phosphate-dissolving ring every day.

[0046] like Figure 4 As shown, after Penicillium oxalicum JM-C14-2 was inoculated into the inorganic phosphorus medium, it showed good adaptability, and the hyphae expanded rapidly and formed a dense network structure. The hyphae grew rapidly, and obvious colony formation was usually observed within 48 hours after inoculation; the phosphate-dissolving circle formed after the Penicillium oxalicum strain was inoculated into the inorganic phosphorus medium could be clearly observed.

[0047] Combination Figure 4 It can be seen that the formation of the phosphate-dissolving circle indicates that the oxalic acid Penicillium strain releases soluble phosphorus by secreting organic acids or phosphatase-like substances to dissolve Ca3(PO4)2, which preliminarily determines that oxalic acid Penicillium has the ability and mechanism to dissolve inorganic phosphorus.

[0048] 2. Decomposition mechanism of soil organic phosphorus by Penicillium oxalicum Organophosphorus medium: 10 g glucose, 0.5 g ammonium sulfate, 0.3 g sodium chloride, 0.3 g potassium chloride, 0.3 g magnesium sulfate heptahydrate, 0.03 g ferrous sulfate heptahydrate, 0.03 g manganese sulfate tetrahydrate, 5.0 g calcium phytate, 20 g agar, dissolved in 1000 mL distilled water, adjusted to pH 7.0, and autoclaved at 121°C for 20 min.

[0049] The organophosphate activation and phosphorus solubilization ability of Penicillium oxalicum can be systematically evaluated by analyzing the formation of phosphorus solubilization rings and the activity of neutral phosphatase. In the clean bench, the Penicillium oxalicum strain was inoculated into the organophosphate culture medium plate. After the inoculation, the plate was inverted and placed in a constant temperature incubator. The plate was cultured at 28°C, the suitable growth temperature of Penicillium oxalicum, for 3-5 days, and the colony growth and phosphorus solubilization ring formation were observed daily.

[0050] Figure 5 The plate was inoculated with Penicillium oxalicum JM-C14-2 on an organic phosphorus medium. Figure 5 As shown, the colonies grow in a dispersed manner, with different sizes and are approximately circular; the phosphate-dissolving zone can be clearly observed.

[0051] Combination Figure 5 It can be seen that the formation of the phosphate-dissolving circle indicates that Penicillium oxalicum JM-C14-2 decomposes organic phosphorus, and the enzymes secreted by it can promote the hydrolysis reaction of organic phosphorus, releasing phosphate ions for plant absorption and utilization. This preliminarily confirms that Penicillium oxalicum has the ability and mechanism to dissolve organic phosphorus.

[0052] 3. Analysis of the characteristics of neutral phosphatase produced by Penicillium oxalicum strains Using commercially available Bacillus subtilis as CK, purified Penicillium oxalicum JM-C14-2 and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (8000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The neutral phosphatase activity was determined using a plant neutral phosphatase (NLP) enzyme-linked immunosorbent assay kit.

[0053] like Figure 6 The neutral phosphatase production of the Penicillium oxalicum strain and CK was shown. The neutral phosphatase production of Penicillium oxalicum JM-C14-2 was significantly higher than that of the control group. The neutral phosphatase production of Penicillium oxalicum JM-C14-2 was 91.51 ng / L, while the production of the control group was 38.41 ng / L, indicating that the Penicillium oxalicum strain has a strong ability to produce neutral phosphatase, which is a manifestation of the ability of Penicillium oxalicum to solubilize phosphate.

[0054] Example 5: Analysis of the characteristics of decomposition of soil organic matter by Penicillium oxalicum 1. Identification of the ability of Penicillium oxalicum to decompose cellulose Prepare sodium carboxymethylcellulose medium: 10 g of peptone, 10 g of yeast powder, 10 g of sodium hydroxymethylcellulose, 5 g of sodium chloride, 1 g of potassium dihydrogen phosphate, and 15 g of agar powder, dissolve in 1000 ml of distilled water, and sterilize at 121°C for 20 min.

[0055] In the clean bench, the purified Penicillium oxalicum JM-C14-2 was inoculated into the cellulase culture medium and cultured at 28°C for 3-5 days. The colony diameter, color, edge characteristics and surface structure were regularly observed and recorded. If a transparent hydrolysis zone is formed around the colony, it indicates that the cellulase secreted by the strain has the ability to degrade cellulose substrates.

[0056] like Figure 7 As shown, the hydrolysis zone in the plate can be clearly seen, and the colonies grow well, which can determine that the oxalicum Penicillium JM-C14-2 has the ability to produce cellulase.

[0057] 2. Analysis of cellulase secretion by Penicillium oxalicum Commercially available Bacillus subtilis was used as CK, and the purified Penicillium oxalicum and CK were inoculated into Bengal red liquid culture medium, respectively, and cultured at 28°C and 150 rpm for 3-5 days. The fermentation broth was collected and centrifuged (4000 rpm, 10 min), and the supernatant was used for enzyme activity determination. The total amount of cellulase was determined using a plant cellulase (CE) enzyme-linked immunosorbent assay kit.

[0058] like Figure 8 The cellulase production of Penicillium oxalicum JM-C14-2 and CK was shown. The cellulase production of the control group was 26.95 ng / L, and the cellulase production of Penicillium oxalicum JM-C14-2 was 83.89 ng / L, which was significantly higher than that of CK. This shows that Penicillium oxalicum JM-C14-2 has a relatively obvious ability to produce cellulase, which plays an important role in decomposing and transforming organic matter in the soil.

[0059] Example 6: Characteristics of organic acid secretion by Penicillium oxalicum 1. Preparation of Czapek's liquid medium: 5g peptone, 10g glucose, 1.0g potassium dihydrogen phosphate, 0.5g magnesium sulfate (anhydrous), 3.3ml Bengal red (concentration 10g / L), dissolved in 11 distilled water, add 0.1g / 3.3ml streptomycin per liter of culture medium before use.

[0060] 2. Strain culture: The prepared liquid culture medium was dispensed into 250 mL conical flasks, 100 mL per flask, sterilized by autoclave at 121°C for 20 minutes, and cooled to room temperature. Under sterile conditions, a small amount of Penicillium oxalicum hyphae was inoculated into the liquid culture medium with an inoculation loop, and the inoculated conical flask was placed in a constant temperature shaker, set at 28°C and 150 rpm, and cultured for 3-5 days.

[0061] 3. Determination of oxalic acid production by strains After the culture is completed, take 10 mL of culture medium, centrifuge (3000 rpm, 10 minutes) to remove the bacteria, take 5 mL of supernatant in a 100 mL conical flask, add 10 mL of 1:1 sulfuric acid solution, and place the conical flask on an electric stove to heat to 70-80°C to promote the reaction between oxalic acid and potassium permanganate. Titrate with 0.02 mol / L potassium permanganate standard solution while hot, slowly add dropwise at first, and continue titrating after the purple-red color fades until the solution turns slightly red and does not fade within 30 seconds, and record the volume of potassium permanganate consumed (V1). At the same time, set up a blank control, replace the supernatant with distilled water, repeat the above steps, and record the volume of potassium permanganate consumed (V0).

[0062] The calculation formula of oxalic acid content is:

[0063]

[0064] Parameter Description: V1: Volume of potassium permanganate standard solution consumed in sample titration (mL) V0: Volume of potassium permanganate standard solution consumed in blank test (mL) C: Concentration of potassium permanganate standard solution (mol / L) 90.03: Molar mass of oxalic acid (g / mol) V: Sample volume (mL) 4. Analysis of oxalic acid production and pH value Table 3: Oxalic acid production and pH value

[0065]

[0066] From the data in Table 3, it can be seen that the oxalic acid content and pH value of Penicillium oxalicum JM-C14-2 are significantly different from those of the CK treatment group. The oxalic acid content of Penicillium oxalicum is as high as 13.5g / L, which is much higher than the 6.07g / L of the CK treatment group, indicating that Penicillium oxalicum JM-C14-2 has a strong ability to synthesize oxalic acid. The pH value of the Penicillium oxalicum strain treatment is 4.41, which is significantly lower than the 7.05 of the CK treatment group, which is related to the synthesis and secretion of a large amount of oxalic acid by Penicillium oxalicum. The oxalic acid secreted by Penicillium oxalicum plays an important role in the dissolution of soil nutrients and the decomposition of organic matter.

[0067] Example 7: Analysis of salt resistance characteristics of Penicillium oxalicum 7.5% sodium chloride medium: 3.0 g beef extract, 5.0 g peptone, 75.0 g sodium chloride, 15.0 g agar, 1000 mL distilled water, pH 7.0, sterilize at 121 ℃ for 20 min.

[0068] Take the activated Penicillium oxalicum strain and inoculate it onto the saline-alkali plate by the spot seeding method. Culture it at 28℃ for 3-5 days and observe the growth of the colony. Fig. 9 As shown, Penicillium oxalicum showed a dispersed growth state on the saline-alkali medium, with multiple colonies distributed on the surface of the medium and a large number of colonies, indicating that it has a certain adaptability and growth vitality on the saline-alkali medium. This shows that Penicillium oxalicum can be used to improve the soil fertility of saline-alkali land.

[0069] Example 8: Antibacterial properties of Penicillium oxalicum In the clean bench, the pathogen was inoculated into the PDA solid medium by aseptic operation, and then 3 ml of the 10-fold dilution of the supernatant of Penicillium oxalicum was inoculated with a pipette. Each treatment was repeated 3 times. In a sterile environment, the pathogen Fusarium lanceolatum was inoculated as a treatment group, and 3 replicates were also set. Cultured in a constant temperature incubator at 28°C for 3-5 days. Regularly observe and record the growth of the colonies in the two treatments.

[0070] like Fig.10As shown, in the treatment group (left plate), the colonies of Penicillium oxalicum grew vigorously around the inoculation point of Penicillium oxalicum and on the entire plate; the growth of the pathogenic bacteria of Fusarium lanceolatum was significantly inhibited; in the control group (right plate), the growth of the pathogen was not disturbed by other bacteria, and the colonies showed a uniform growth state, with a darker color, and the colony diameter was significantly larger than the colony diameter of the pathogen in the treatment group, and the overall coverage area was larger. Fig.10 It can be seen that Penicillium oxalicum has a significant inhibitory effect on the pathogenic bacteria of Fusarium scaber.

[0071] Example 9: Effect of Penicillium oxalicum on soil fertility Take 500 g of soil sample and evenly put it into 1L plastic cups to ensure the soil is uniform in looseness. The plastic cups are randomly divided into experimental group and control group, with 5 replicates in each group. Add 30mL of Penicillium oxalicum liquid (OD 600 =0.3), and then add 180ml of sterile water; add an equal amount of 210ml of sterile water to the control group to make the soil reach saturated water holding capacity and ensure that the soil is in suitable humidity conditions. Cover the plastic cup with a layer of film and seal it, place it in a constant temperature incubator, and culture it at 25℃ and 60% for 30 days. During the culture period, weigh and add sterile water regularly to maintain constant soil moisture. After the culture, the standard soil agrochemical analysis method is used to determine the content of available nitrogen, phosphorus, and potassium in the soil.

[0072] Table 4: Soil fertility of different treatments

[0073]

[0074] According to Table 4, it can be observed that the application of Penicillium oxalate to the soil can significantly increase the content of soil hydrolyzable nitrogen, available phosphorus, fast-acting potassium, and organic matter compared with CK. There is no significant difference in pH between the treatment of Penicillium oxalate JM-C14-2 and CK, indicating that Penicillium oxalate JM-C14-2 can significantly increase the content of hydrolyzable nitrogen, available phosphorus, and fast-acting potassium and organic matter in the soil, promote the decomposition and transformation of nutrients, and play a positive role in improving soil fertility.

[0075] Example 10: Growth-promoting effect of indoor Penicillium oxalicum on tomatoes Material preparation: Wash the sand several times with clean water, air dry it, and put it into a 500ml plastic cup. Put 200g of sand into each cup. Wash all the substrates of the root system of the 4-leaf tomato seedlings with uniform growth, and plant them in the sand for sand culture test. The nutrient solution used is Hogland nutrient solution.

[0076] Inoculation treatment: First, pour 30 ml of nutrient solution into each potted plant to fully soak the sand. Then, take 30 ml of activated bacteria from each group and dilute it 10 times for use. Pour 30 ml of diluted bacterial solution into each treatment. One group is the control group, which only pours 30 ml of nutrient solution and 30 ml of sterile water. Repeat each treatment 5 times.

[0077] Growth index measurement: After the tomato plants grow to 15 days old, use a plant nutrient rapid tester to measure the chlorophyll content and nitrogen content of the leaves. Use a root scanner to measure the root growth status.

[0078] Study on the effect of Penicillium oxalicum strains on the growth of tomato seedlings: 1. Impact on tomato root growth By setting up a control group (CK, without bacterial solution) and a treatment group (with bacterial suspension), the study was conducted from two perspectives: root morphology comparison and data analysis after scanning.

[0079] Comparative analysis of root morphology Fig.11 and Fig.12 It can be seen intuitively that the tomato plants treated with the suspension of Penicillium oxalicum JM-C14-2 have obvious differences in root morphology compared with the control (CK). The tomato root system in the treatment group is more developed, the main root may be longer, and the number of lateral roots is relatively large, showing a more vigorous growth trend; while the root system of the control group is relatively thin and weak, and the number of lateral roots is small. The morphological difference shows that Penicillium oxalicum promotes the growth and development of the tomato root system.

[0080] According to the root scanning data analysis, the root index values ​​of the treatment group and the control group (CK) in terms of multiple root indexes are shown in Table 5.

[0081] Table 5 Scanning data of potted tomato root system

[0082]

[0083] (1) Total root length: The total root length of the treatment group was 224.14 cm, which was significantly higher than that of the control group (98.85 cm). This indicates that the application of Penicillium oxalicum suspension significantly increased the total length of the tomato root system and promoted the potted tomatoes to absorb more water and nutrients.

[0084] (2) Total root surface area: The total root surface area of ​​the treatment group was 55.773 cm², which was higher than the 28.31 cm² of the control group. The larger root surface area can enhance the contact area between the root system and the soil environment, and increase the absorption area of ​​nutrients and water by potted tomatoes.

[0085] (3) Total root projection area: The total root projection area of ​​the treatment group was 17.75 cm², which was higher than that of the control group (9.01 cm²), which was consistent with the results of the root surface area, further illustrating the advantages of the roots of the treatment group in terms of spatial expansion and absorption function.

[0086] (4) Total volume: The total volume of the treatment group was 1.10 cm³, which was higher than that of the control group (0.64 cm³), indicating that the root system of the treatment group was more complete in material accumulation and structural development.

[0087] (5) Average root diameter: The average root diameter of the treatment group was 0.79 mm, slightly lower than that of the control group (0.91 mm). This may be due to the more vigorous root growth of the treatment group and the large number of lateral roots, which resulted in a relatively smaller average diameter, but did not affect its overall absorption function.

[0088] (6) Total number of root tips: The total number of root tips in the oxalicum group was 446, and that in the CK group was 317. The total number of root tips in the oxalicum group was 129 more than that in the CK group. This indicates that compared with the CK group, oxalicum may promote the growth of root tips, resulting in an increase in the total number of root tips.

[0089] According to the comparison of tomato root morphology and scanning data analysis results, the application of Penicillium oxalicum suspension has a significant promoting effect on the root growth of potted tomatoes, which can increase the length, surface area, volume, etc. of the root system, and improve the structure and function of the tomato root system as a whole. It helps to improve the tomato plant's ability to absorb nutrients and water, and thus has a positive impact on the growth, development, and yield quality of tomatoes.

[0090] 2. Effect of strains on nutrients in tomato leaves The nutrient content of tomato seedling leaves was measured using a leaf nutrient rapid tester. Fig.13 and Fig.14 shown.

[0091] like Fig.13 As shown in the figure, in terms of chlorophyll SPAD value, the average value of the treatment group (Penicillium oxalicum) was 40.26, which was higher than that of the control group (37.30), indicating that the application of bacterial solution can increase the chlorophyll content of tomato leaves or enhance photosynthesis; according to Fig.14 The results showed that in terms of nitrogen content, the average value of the treatment group was 2.76 mg / kg, which was greater than the control group's 2.56 mg / kg, indicating that Penicillium oxalicum helps tomato leaves accumulate nitrogen, which is beneficial to plant growth and metabolism. Penicillium oxalicum has a positive effect on the chlorophyll content and nitrogen accumulation of potted tomato leaves, and can promote plant growth.

[0092] The above embodiments only illustrate the technical solutions of the present invention, rather than limiting it. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A strain of Penicillium oxalicum JM-C14-2, characterized in that: Its classification name is Penicillium oxalicum strain JM-C14-2 is deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: M 20232615.

2. Use of the Penicillium oxalicum JM-C14-2 according to claim 1 in the preparation of a biological agent for promoting tomato growth.

3. The use according to claim 2, characterized in that: The tomato growth includes nutrient accumulation in tomato leaves and growth of tomato root system.

4. The use according to claim 2, characterized in that: The oxalic acid Penicillium JM-C14-2 can increase the chlorophyll content, nitrogen accumulation and leaf surface temperature of tomato leaves.

5. Use of the Penicillium oxalicum JM-C14-2 according to claim 1 in the preparation of biological preparations for inhibiting pathogenic bacteria.

6. The use according to claim 5, characterized in that: The pathogen is Fusarium oxysporum.

7. Use of the Penicillium oxalicum JM-C14-2 according to claim 1 in improving soil nutrients.

8. The use according to claim 7, characterized in that: The oxalicum Penicillium JM-C14-2 has high protease production capacity, the ability to dissolve inorganic phosphorus and organic phosphorus, and the ability to produce cellulase.

9. The use according to claim 7, characterized in that: The oxalic acid Penicillium JM-C14-2 has the ability to secrete oxalic acid and has strong salt-alkali resistance, and increases the content of soil hydrolyzable nitrogen, available phosphorus, quick-acting potassium and organic matter.

Images