Modified thlaspi arvense FLC gene as well as mutant and application thereof

Abstract

The invention discloses a modified thlaspi arvense FLC gene, a mutant of the modified thlaspi arvense FLC gene and application of the modified thlaspi arvense FLC gene and the mutant of the modified thlaspi arvense FLC gene. The modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or substituting and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence as shown in SEQ ID NO.2 and / or within 30bp upstream and downstream of the target sequence. The modified thlaspi arvense FLC gene, the mutant thereof and the like have application prospects in the aspects of early flowering and fruiting of thlaspi arvense, shortening of the growth period, lodging resistance, convenience in close planting and improvement of the seed yield.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a modified FLC gene of Cyperus rotundus and a mutant thereof and application thereof. Background Art

[0002] Thlaspi arvense L., a cruciferous plant, is native to Eurasia and is a self-pollinating diploid (2n=2x=14). Thlaspi arvense has strong cold resistance and can withstand temperatures as low as -45°C. It can be planted as a winter cover crop during the traditional fallow period after summer annual plants such as wheat, corn or soybeans to prevent soil erosion and nutrient loss, protect surface and groundwater sources, suppress the growth of weeds in early spring, and provide a food source for pollinators. Thlaspi arvense has a short growth cycle in temperate regions. It can be sown in the fall of the current year and harvested in early summer of the following year. The seed yield has been reported to be between 1,500 and 2,400 kg / hectare. After harvesting, an additional season of annual plants with a shorter growth period, such as soybeans, can be planted to improve the overall land use efficiency and improve the farmland ecosystem. The average oil content of Thlaspi arvense seeds is about 35%, and its fatty acid composition can be used as a biofuel. The seed oil also has the potential to be converted into edible oil and a source of edible protein.

[0003] At present, the whole genome sequencing of iris has been completed, and it can be used as a new dicotyledonous model plant for molecular genetics research. These advantages show that the artificial domestication and breeding of iris is relatively easy. As a diploid, iris has many genes that correspond one-to-one with those of Arabidopsis thaliana, which can provide an important reference for trait improvement and field phenotypic verification. At present, foreign countries have used gene editing and chemical mutagenesis methods to improve some important agronomic and physiological and biochemical traits, such as transparent seed coat phenotype, reduced pod bursting at maturity, and seed oil composition. However, when growing iris in an artificially controlled environment (such as an artificial climate chamber), it must undergo 21 days of low-temperature vernalization treatment at the seedling stage to enable the iris to transform from vegetative growth to reproductive growth stage and to bloom and bear fruit. This requires that the artificially controlled environment (such as an artificial climate chamber) must have low-temperature vernalization conditions, and the entire growing period is about 140 days, which greatly prolongs the plant growth cycle. This poses a great challenge to the application of iris as a model plant or model crop. Summary of the invention

[0004] In order to overcome the problems existing in the prior art, the technical solution provided by the present invention is as follows:

[0005] In the first aspect, the present invention provides a modified FLC gene of Cyperus rotundus, comprising a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

[0006] In the present invention, the unmodified FLC gene of Cyperus rotundus was obtained from NCBI, and the gene accession number is: OU46686. The CDS sequence of the FLC gene of Cyperus rotundus is shown in SEQ ID NO.1.

[0007] In the present invention, the target sequence shown in SEQ ID NO.2 is modified by gene editing technology to obtain the modified FLC gene of Cyperus rotundus.

[0008] In some embodiments, gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

[0009] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 30 bp upstream and downstream of the target sequence.

[0010] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 30 bp upstream and downstream of the target sequence.

[0011] In a second aspect, the present invention provides a flc mutant of Cyperus rotundus, comprising a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

[0012] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 20 bp upstream and downstream of the target sequence.

[0013] In some preferred embodiments, the modified target sequence is a nucleotide sequence obtained by deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 20 bp upstream and downstream of the target sequence.

[0014] In a third aspect, the present invention provides a method for constructing a flc mutant of Cyperus rotundus, characterized in that the method comprises the following steps:

[0015] (1) constructing a CRISPR / Cas9 vector for the modified FLC gene of Cyperus rotundus;

[0016] (2) transforming Agrobacterium with the vector obtained in step (1);

[0017] (3) transforming the target Imbricata plants using the Agrobacterium obtained in step (1) by using the floral dipping method;

[0018] (4) Screening and / or identification of positive Cyperus rotundus plants.

[0019] In a fourth aspect, the present invention provides a method for improving a variety of Cyperus rotundus, comprising:

[0020] The method comprises making the antler cyperus contain a modified antler cyperus FLC gene with decreased activity or inactivation, so as to obtain a gene-edited antler cyperus variety, wherein the modified antler cyperus FLC gene contains a modified target sequence, and the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence;

[0021] The gene-edited iris variety includes at least one of the following changes: early flowering and fruiting, shortened growth period, facilitating dense planting and increasing seed yield.

[0022] Furthermore, the target sequence shown in SEQ ID NO.2 is modified by gene editing technology to obtain a modified FLC gene of Cyperus rotundus, so that the activity of the FLC gene of Cyperus rotundus is reduced or inactivated.

[0023] In some embodiments, gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

[0024] In some preferred embodiments, gene editing comprises insertion or deletion.

[0025] In a fifth aspect, the present invention provides an expression vector, a host cell or a recombinant bacterium comprising the modified Cyperus rotundus FLC gene described above.

[0026] In a sixth aspect, the present invention provides the above-mentioned modified FLC gene of the antler capillaris, the above-mentioned flc mutant of the antler capillaris, the construction method of the above-mentioned flc mutant of the antler capillaris, and the above-mentioned method for improving the antler capillaris variety, including the use of the expression vector, host cell or recombinant bacteria of the above-mentioned modified FLC gene of the antler capillaris in at least one of the following changes: early flowering and fruiting of the antler capillaris, shortening the growth period, dwarfing the plant, resisting lodging, facilitating close planting and increasing seed yield.

[0027] The beneficial effects of the present invention include at least the following:

[0028] The present invention utilizes gene editing technology for the first time to transform the FLC gene that controls the sensitivity of iris to low-temperature vernalization. The transformed iris FLC gene and its mutant, the construction method of the iris flc mutant, the method for improving iris varieties, the expression vector, host cell or recombinant bacteria containing the transformed iris FLC gene, etc. have application prospects in at least one of early flowering and fruiting of iris, shortening the growth period, dwarfing the plant, lodging resistance, facilitating close planting and increasing seed yield. Specifically:

[0029] 1) It is only necessary to modify the target sequence in the FLC gene and / or its upstream and downstream within 30 bp by gene editing (such as gene knockout, gene knockdown, gene insertion, base substitution).

[0030] 2) The flc mutant of Cyperus rotundus containing the modified Cyperus rotundus FLC gene can enter reproductive growth without sensing low temperature and bloom and bear fruit at least one month earlier.

[0031] 3) The entire growth period of the flc mutant of Cyperus rotundus is shortened to about 80 days, which will provide the necessary conditions for Cyperus rotundus to be used as an emerging model plant. Compared with the current entire growth period of about 140 days, the plant growth period is greatly shortened.

[0032] 4) The plants of the flc mutant of Cyperus rotundus are dwarfed and suitable for dense planting. The previous planting density of Cyperus rotundus was 30,000 plants / mu, while the planting density of the flc mutant of the present invention can reach 150,000-200,000 plants / mu.

[0033] 5) Moreover, since it is suitable for dense planting, the seed yield per mu of the flc mutant of the present invention can be increased by at least about 2 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 A schematic diagram showing the structure of the AtU6-26-sgRNA-SK plasmid in Example 1 of the present invention.

[0035] Figure 2 It shows that the positive seedlings screened in Example 1 of the present invention can grow normally on the hygromycin medium, while the non-positive seedlings no longer grow after germination, and the cotyledons and hypocotyls gradually turn black.

[0036] Figure 3 The figure shows the comparison between the phenotype of the flc mutant plant and the wild-type plant in Example 1 of the present invention.

[0037] Figure 4 It shows that in Example 1 of the present invention Figure 3 (a) The corresponding flc mutant plant phenotype and sequence comparison with the wild type.

[0038] Figure 5 It shows that in Example 1 of the present invention Figure 3 (b) The corresponding flc mutant plant phenotype and sequence comparison with the wild type.

[0039] Figure 6 It shows that in Example 1 of the present invention Figure 3 (c) The corresponding flc mutant plant phenotype and sequence comparison with the wild type.

[0040] Figure 7 It shows that in Example 1 of the present invention Figure 3 (e) The corresponding flc mutant plant phenotype and sequence comparison with the wild type.

[0041] Figure 8 It shows that in Example 1 of the present invention Figure 3 (f) The corresponding flc mutant plant phenotype and sequence comparison with the wild type.

[0042] Fig. 9 Schematic diagram of height comparison between the flc mutant plant (right) and the wild-type plant (left) in Example 1 of the present invention. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical scheme and beneficial effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, and are intended to be used to explain the present invention, but do not constitute a limitation of the present invention.

[0044] The endpoints and any values ​​of the ranges disclosed in the present invention are not limited to the precise ranges or values, and these ranges or values ​​or approximate values ​​should be understood to include values ​​close to these ranges or values ​​(such as within the range of ±5%). For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be regarded as specifically disclosed in this article. In the description of this application, unless otherwise specified, the meaning of "multiple / multiple" and similar words is two / kinds or more than two / kinds.

[0045] The present invention is further described in detail below in conjunction with the examples. It should be understood that if the experimental methods in the following examples do not specify specific conditions, they are usually implemented according to conventional conditions or according to the conditions adopted by the partners.

[0046] The vector reference file in the following examples: Yan L., Wei S., Wu Y., Hu R., Li H., Yang W., and Xie Q. (2015). High efficiency genome editing in Arabidopsis using Yao promoter-driven CRISPR / Cas9 system. Mol. Plant. The public can obtain it from the applicant to repeat the experiment, but it cannot be used for other purposes.

[0047] Example 1

[0048] In this example, the CDS sequence of the FLC gene (unmodified) of Thlaspi arvense L. was obtained from NCBI data, gene accession number: OU466862, and was verified by amplification and sequencing of test materials. The final nucleotide sequence SEQID NO.1 is shown below:

[0049] ATGGGGAGAAAAAAACTAGAAATCAAGCGAATTGAGAACAAAAGTAGCCGACAAGTCACCTTCTCCAAACGACGCAACGGTCTCATCGAGAAAGCTCGTCAGCTTTCTGTTCTCTGCGATGCATCCGTCGCTCTTCTCGTTGTCTCT GCCTCTGGCAAGCTATACAGCTTCTCCTCCGGCGATAACTTGGTCAAGATCCTTGATCGATATGGAAAACAACATGCTGATGATCTTAAAGCCTTGGATCTTCAGTCAAAAGCTCTGAACTATGGTTCGCACCATGAGCTACTAGAAC TTGTGGAAAGCAAGCTTGTGGAATCAGATGTCGACAATGTAAGTGTGGATTCCCTCGTTCAGCTGGAGGATCACCTTGAGACTGCCTTTCAATAACTAGAGCTAGGAAGACTGAATTAATGTTGAAGCTTGTTGATAGCCTCAAAGA AAAGGAGAAATTGCTGAAAGAAGAGAATCAGGTTTTGGCTAGCCAGATGGAGAAGAATCATATGGAAGCAGATGCTGATAATATGGAGATGTCACCTGGACAAATCTCCGACATGAATCTTCCGGTAACTCTCCCGCTGCTTAATTAG

[0050] Among them, CCTCTGGCAAGCTATACAGCTTC of bases 149-171 in the above CDS sequence is the target sequence shown in SEQ ID NO.2. According to the requirements of vector construction, the target primers were designed and sent to the company for synthesis. The primer sequences are as follows:

[0051] SEQ ID NO.3(FLC-Cas9-1F):

[0052] 5'-ATTGAAGCTGTATAGCTTGCCAG-3'

[0053] SEQ ID NO.4 (FLC-Cas9-1R):

[0054] 5'-AAACCTGGCAAGCTATACAGCTT-3'

[0055] 1. The vector construction method includes:

[0056] 1. Target primer processing;

[0057] 1) Before starting the experiment, you first need to dissolve the target primer in water to a 10uM stock solution;

[0058] 2) Pipette 10ul of each upstream and downstream primers and add them into a 250ul EP tube;

[0059] 3) Pipette 80ul 1×TB (pH 8.0) solution and add it to a 250ul EP tube;

[0060] 4) Place the EP tube into the PCR instrument and set the program to heat at 98°C for 5 minutes;

[0061] 5) After the heating process is completed, take out the PCR tube and let it cool at room temperature.

[0062] 2. Construction of sgRNA intermediate vector

[0063] Use AtU6-26-sgRNA-SK plasmid to connect the target fragment obtained above to the specific position of SK plasmid (such as Figure 1 shown),

[0064] Obtain AtU6-26-sgRNA-SK backbone:

[0065] The first step is to use BsaⅠ-HFv2 to digest the AtU6-26-sgRNA-SK plasmid to obtain the AtU6-26-sgRNA-SK backbone. The components and addition amounts of the digestion system are shown in Table 1.

[0066] Table 1 Enzyme digestion system components and addition amounts for obtaining the AtU6-26-sgRNA-SK backbone

[0067] Enzyme digestion system components Addition amount SK plasmid 12ul BsaⅠ-HFv2 1.5ul rCutSmartBuffer 6ul <![CDATA[ddH 2 The]]> 40.5ul

[0068] Each component of the above enzyme digestion system was added to a 1.5 ml centrifuge tube in turn, mixed thoroughly, and digested at 37°C for 4 hours. After the digestion was completed, the digestion effect was detected by gel electrophoresis, and the plasmid fragments after digestion were recovered using a gel recovery kit. Among them, the connection system components and addition amounts for constructing the SK-vector carrying a single target are shown in Table 2.

[0069] Table 2 Components and addition amounts of the connection system for constructing SK-vectors carrying single targets

[0070] Connection system components Addition amount SK plasmid after restriction digestion 2ul Annealed target fragment 1ul 10XT4DNAligasebuffer 1ul T4DNAligase 0.5ul <![CDATA[ddH 2 The]]> 5.5ul

[0071] Add the components of the above ligation system into a 1.5 ml centrifuge tube in sequence, mix thoroughly, and react at 16°C for 1 hour.

[0072] Transformation of DH5α competent cells

[0073] Take out the DH5α competent cells from the -80 refrigerator and slowly thaw them on ice. After the competent cells are completely thawed, use a pipette to draw 100ul of the competent cells and add them to the centrifuge tube containing the ligation product, slowly pipette and mix, place the centrifuge tube on ice for 5min, then heat shock at 42℃ for 80s, and return to the ice box after the heat shock treatment and let it stand for 5min. After the standing period, add 500ml of LB medium to the centrifuge tube, resuscitate and culture at 37℃200r for 30min, draw 100ul and evenly spread it on the LB+Amp solid medium, and culture at 37℃ for 12h.

[0074] Monoclonal identification

[0075] Single clone identification was performed by single colony PCR, with the single clone colony as template and the primers as SEQ ID

[0076] NO.5(SK-gRNA-F):5'-CGACTCACTATAGGGCGAATTGG-3', SEQ ID

[0077] NO.6 (SK-gRNA-R): 5'-CCTCACTAAAGGGAACAAAAGCTGG-3', use the tip of the white (10ul) gun to pick up a monoclonal bacterium, first dip it lightly in the "colony PCR premix" three to four times, and then insert the gun tip into the shaking tube containing LB+Amp liquid culture medium.

[0078] Table 3 Components and addition amounts of colony PCR premix for monoclonal identification

[0079] Colony PCR master mix components Addition amount 2XPCRMix 12.5ul SK-gRNA-F 1ul SK-gRNA-R 1ul <![CDATA[ddH 2 The]]> 10.5ul

[0080] Table 4 PCR reaction program for single clone identification

[0081]

[0082] The length of the amplified target fragment is about 500bp. It is detected by 1% agarose gel electrophoresis at 220V for 20min. The shaking tube corresponding to the correctly identified monoclonal clone is selected and 5ml LB+Amp liquid culture medium is added. It is cultured at 37℃200r for 12 hours. The plasmid is extracted using the "plasmid extraction kit" and sent for sequencing to further confirm the correct connection.

[0083] 3. Construction of CRISPR / Cas9 vector for FLC target sequence

[0084] The SK-gRNA plasmid vector carrying the FLC target was obtained by digestion with SpeⅠ and Nhe. The enzyme digestion system is shown in Table 5 below:

[0085] Table 5 Enzyme digestion system of CRISPR / Cas9 vector of FLC target sequence

[0086] Enzyme digestion system components Addition amount SK-gRNA Plasmid 15ul SpeⅠ 1.5ul NheⅠ 1.5ul CutSmartBuffer 6ul <![CDATA[ddH 2 The]]> 36ul

[0087] The components of the above enzyme digestion system were added to a 1.5 ml centrifuge tube in turn, mixed thoroughly, and digested at 37°C for 4 hours. After the digestion was completed, the digestion effect was detected by gel electrophoresis, and the 650 bp fragment after digestion was recovered using a gel recovery kit.

[0088] Table 6 CRISPR / Cas9 vector linearization system

[0089] Enzyme digestion system components Addition amount CRISPR / Cas9 Plasmids 15ul SpeⅠ 1.5ul CutSmartBuffer 6ul <![CDATA[ddH 2 The]]> 37.5ul

[0090] Add each component of the above enzyme digestion system to a 1.5 ml centrifuge tube in turn, mix thoroughly, and perform enzyme digestion at 37°C for 4 hours. After the end, detect the enzyme digestion effect by gel electrophoresis, recover the linearized fragment of the plasmid with a gel recovery kit, and then treat with CIP for dephosphorylation.

[0091] Table 7 Construction of CRISPR / Cas9 vector carrying gRNA

[0092] Connection system components Addition amount Linearize CRISPR / Cas9 fragments 2ul sgRNA cassette 1ul 10XT4DNAligasebuffer 1ul T4DNAligase 0.5ul <![CDATA[ddH 2 The]]> 5.5ul

[0093] Add the components of the above ligation system into a 1.5 ml centrifuge tube in sequence, mix thoroughly, and react at 16°C for 1 hour.

[0094] Transformation of DH5α competent cells

[0095] Take out the DH5α competent cells from the -80 refrigerator and slowly thaw them on ice. After the competent cells are completely thawed, use a pipette to draw 100ul of the competent cells and add them to the centrifuge tube containing the ligation product, slowly pipette and mix, place the centrifuge tube on ice for 5min, then heat shock at 42℃ for 80s, and put it back in the ice box for 5min after the heat shock treatment. After the standing period, add 500ml of LB medium to the centrifuge tube, resuscitate and culture at 37℃200r for 30min, draw 100ul and evenly spread it on LB+Kan solid medium, and culture at 37℃ for 12h.

[0096] Monoclonal identification

[0097] Single clone identification was performed by single colony PCR, with the single clone colony as template and the primers as

[0098] SEQ ID NO.7(1300-gRNA-F):CCAGTCACGACGTTGTAAAAC

[0099] SEQ ID NO.8 (1300-gRNA-R): CAATGAATTTCCCATCGTCGAG. Use the tip of a white (10ul) pipette to pick up a monoclonal bacterium. First, gently dip it in the "colony PCR premix" three to four times, and then insert the pipette tip into a shaking tube filled with LB+Kan liquid culture medium.

[0100] Table 8 Components and addition amounts of colony PCR premix for monoclonal identification

[0101] Colony PCR master mix components Addition amount 2XPCRMix 12.5ul 1300-gRNA-F 1ul 1300-gRNA-R 1ul <![CDATA[ddH 2 The]]> 10.5ul

[0102] Table 9 PCR reaction program for monoclonal identification

[0103]

[0104] The length of the amplified target fragment is about 750bp. It is detected by 1% agarose gel electrophoresis at 220V for 20min. The shaking tube corresponding to the correctly identified monoclonal clone is selected and 5ml LB+Kan liquid culture medium is added. It is cultured at 37℃200r for 12 hours. The plasmid is extracted using the "Plasmid Mini Extraction Kit" and sent for sequencing to further confirm the correct connection.

[0105] 2. Agrobacterium transformation of CRISPR / Cas9-FLC plasmid

[0106] Take out the GV3101 Agrobacterium competent cells from the -80℃ refrigerator and slowly thaw them on ice. After the competent cells are completely thawed, use a pipette to draw 100ul of competent cells and add them to the centrifuge tube containing the ligation product, slowly pipette and mix, put the centrifuge tube into liquid nitrogen for 5min, take it out and heat shock it at 37℃ for 80s, put it back in the ice box after the heat shock treatment and let it stand for 5min. After the standing period, add 500ml of LB culture medium to the centrifuge tube, resuscitate and culture it at 30℃ and 200r for 90min, draw 100ul and evenly spread it on LB+Kan+Rif solid culture medium, and culture it at 37℃ for 48h. The single colony PCR method was used to identify Agrobacterium monoclones, with monoclonal colonies as templates, primers SEQ ID No. 5 (1300-gRNA-F): CCAGTCACGACGTTGTAAAAC, SEQ ID No. 6 (1300-gRNA-R): CAATGAATTTCCCATCGTCGAG, and a monoclonal bacterium was gently picked up with a white (10ul) gun tip, and first gently dipped in the "colony PCR premix" three to four times. The length of the amplified target fragment was about 750bp, and it was detected by 1% agarose gel electrophoresis, electrophoresis at 220V voltage for 20min, and the shaking bacteria tube corresponding to the correctly identified monoclonal was selected, and 5ml LB+Kan+Rif liquid culture medium was added, and cultured for 18 hours at 30℃200r.

[0107] 3. Agrobacterium-mediated genetic transformation of Cyperus rotundus

[0108] 1. Inoculate the glycerol stock of Agrobacterium tumefaciens (GV3101) containing CRISPR-Cas9_Hyg plasmid into 3 mL of LB (50 mg / L kanamycin, 25 mg / L rifampicin) medium and culture overnight at 28°C. Then inoculate the cultured bacterial liquid into 250 mL of LB (50 mg / L kanamycin, 25 mg / L rifampicin) medium and culture overnight at 28°C.

[0109] 2. Centrifuge the overnight cultured Agrobacterium at 3500 g for 10 minutes, discard the supernatant, resuspend the bacteria with 5% (w / v) sucrose + 0.02% (v / v) Silwet L-77 solution, and adjust the OD of the suspension to 0.8.

[0110] 3. Prepare the plants of Cyperus rotundus, use the inflorescence of the plants that have been in bloom for about 5 days, immerse them in the Agrobacterium suspension, and vacuum for 5-10 minutes.

[0111] 4. Wrap the infected inflorescence part with plastic wrap, seal the stem with a rubber band, put the plant back into the environmental growth room, and remove the plastic wrap the next day.

[0112] 5. After the plants grow and mature normally, harvest the seeds.

[0113] 6. Screening of positive seedlings

[0114] ① Move the washed seeds into the clean bench and light the alcohol lamp;

[0115] ② Rinse twice with sterile water in the clean bench (rinse by injecting and absorbing distilled water with a pipette);

[0116] ③ Use a pipette to add about 4.5 mL of 75% alcohol to a 5 mL centrifuge tube to soak the seeds, shake and invert for 2 minutes, and then rinse with sterile water 3 times;

[0117] ④ Use a pipette to add about 4.5 mL of 10% sodium hypochlorite solution to the centrifuge tube, soak it, shake it upside down for 10 minutes, and then rinse it with sterile water three times;

[0118] ⑤ Use a pipette to add about 4.5 mL of 0.1% agar solution to the centrifuge tube to suspend the seeds and shake evenly;

[0119] ⑥ Use a 1.25 mL pipette with the tip of the gun cut off to suck up the seeds and inoculate them into the positive screening medium (MS + 50 mg / L cephalosporin antibiotics + 60 mg / L hygromycin), inoculating about 100 seeds in each dish;

[0120] ⑦ Seal the inoculated culture dish with 3M breathable sealing film and mark it;

[0121] ⑧ Move into the incubator. The incubator setting program is divided into two sections. The temperature is 22°C and the humidity is 50%. The first section has a light intensity of 9000LUX for 16 hours and the second section has a light intensity of 0LUX for 8 hours.

[0122] ⑨ After inoculation, the seeds are continuously observed to screen for positive seedlings that grow normally. After the seeds grow on the screening medium for about 3 weeks, their growth conditions are observed. If there are plants that grow similarly to the control, are significantly better than other plants, and have well-developed roots, they can be considered positive seedlings for transplanting and awaiting later identification. The phenotype of the positive seedlings is as follows: Figure 2 shown.

[0123] 7. Identification of positive seedlings

[0124] 1) DNA extraction from seedling leaves

[0125] Instrument and reagent preparation

[0126] ●Grinding machine, centrifuge, water bath, ice maker, Adele's new plant genomic DNA rapid extraction kit, etc.

[0127] ●Young plant tissue (leaves 150 mg).

[0128] ●When using for the first time, you need to add a certain amount of anhydrous ethanol to WB and buffer AP3 in advance as required, mix thoroughly, and mark the bottle in time (check the box) to avoid adding multiple times.

[0129] The steps include:

[0130] (1) Prepare a 2 mL centrifuge tube for each sample, add 600 μL of buffer AP1 and 150 mg of fresh leaves, put in one 5 mm steel ball and two 3 mm steel balls, and grind at 45 Hz for 180 s.

[0131] (2) Add 6 μL RNase A (10 mg / mL) to the grinding solution and vortex to mix thoroughly and accelerate lysis.

[0132] (3) Incubate in a 65°C water bath for 10 minutes. Invert the tube 2-3 times to mix the sample.

[0133] (4) After centrifugation, transfer the mixture to a new 1.5 mL centrifuge tube, discard the steel beads, add 195 μL of buffer AP2, vortex for 1 minute to mix, and place on ice for 5 minutes. After centrifugation at 13,000 rpm for 10 minutes, transfer the supernatant to a new 1.5 mL centrifuge tube, taking care not to aspirate the interface material.

[0134] (5) Calculate the amount of supernatant, add 1.5 times the volume (about 900 μL) of AP3 / E, and immediately vortex to mix.

[0135] Note: After adding AP3 to the supernatant, mix by pipetting or shaking immediately.

[0136] (6) Add the mixture obtained in the previous step (including any precipitate) to an adsorption column AC (the adsorption column is placed in a collection tube) and centrifuge at 13,000 rpm for 60 seconds. Pour away the waste liquid in the collection tube (first add 750 μL and centrifuge, discard the waste liquid, then add the remaining solution and centrifuge again).

[0137] (7) Add 600 μL of washing buffer (WB), centrifuge at 13,000 rpm for 30 seconds, and discard the waste liquid.

[0138] (8) Repeat step (7).

[0139] Note: If the adsorption column membrane still shows a lot of green pigment, you can add this step of rinsing. Add 500 μL of anhydrous ethanol to the adsorption column AC, centrifuge at 13,000 rpm for 30 seconds, and discard the waste liquid.

[0140] (9) Place the adsorption column AC back into the empty collection tube and centrifuge at 13,000 rpm for 2 min to remove as much rinse solution as possible to prevent ethanol residue from inhibiting downstream reactions.

[0141] (10) Take out the adsorption column AC and place it in a clean centrifuge tube. Add 50 μL of elution buffer EB to the middle of the adsorption membrane, leave it at room temperature for 3-5 minutes, and centrifuge it at 13,000 rpm for 1 minute. Add the resulting solution back to the adsorption column, leave it at room temperature for 2 minutes, and centrifuge it at 13,000 rpm for 1 minute.

[0142] (11) DNA can be temporarily stored at 2-8°C, but needs to be stored at -20°C for long periods of time.

[0143] 2) PCR amplification and gel running

[0144] (1) Preparation of instruments and reagents

[0145] ●Ice maker, PCR instrument, PCR tubes and small yellow plates, pipettes and tips, electrophoresis instrument, gel imaging system, UV instrument, 2mL centrifuge tubes.

[0146] ●The above DNA samples, 2×HiFi Master Mix, corresponding primers, sterile water.

[0147] FLC-NGS-F1 (SEQ ID No. 9):

[0148] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCATCTCGTCAGCTTTCTGTTCTC

[0149] FLC-NGS-R1 (SEQ ID No. 10):

[0150] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTACGcccagaagaggagaagtcg

[0151] The steps include:

[0152] (a) Prepare the sample mixture in the following proportions in a PCR tube, mix well, and collect the residue on the tube wall by centrifugation;

[0153] Table 10 PCR amplification system

[0154]

[0155] (b) The PCR reaction procedure is shown in the following table:

[0156] Table 11 PCR reaction procedure for positive seedling identification

[0157]

[0158] ×33 cycles;

[0159] (c) Prepare 1% agarose electrophoresis gel, such as 1 g agarose + 100 mL 1× TBE + 7 μL nucleic acid dye, pour into the gel tank and cool for more than 30 min;

[0160] (d) Sample loading (Note: 6× Loading Buffer needs to be added in proportion in advance);

[0161] (e) Run the gel for about 20 min. Adjust the time appropriately according to the size of the band.

[0162] (f) Take photos and cut the gel: Under the UV mode of the gel imaging system, take photos to record the experiment of the day; prepare a clean 2 mL centrifuge tube, put the gel block into the UV instrument, cut the target band with a tissue culture knife, put it into a 2 mL centrifuge tube, and mark the name.

[0163] (g) Recovering the gel.

[0164] 3) Recover product and sequence

[0165] The above gel recovery product was packaged into 20 μL, and the following primers were prepared and sent to the sequencing company. Then the sequencing results were analyzed and compared with the wild type to confirm whether base insertion or deletion occurred.

[0166] In terms of plant height, the plant heights of wild-type plants and the flc mutant plants of Example 1 at the final maturity (i.e., the plant height at the end of the entire growth period) were calculated.

[0167] 10 wild-type control plants and 20 flc mutant plants of the present invention were randomly selected for plant height statistics, as shown in Table 12 and Table 13, respectively. The height comparison diagram of the flc mutant plant (right) and the wild-type plant (left) is shown in Fig. 9 shown.

[0168] Table 12 Plant height of wild type plants

[0169]

[0170] Table 13 Plant height of flc mutant plants

[0171] Plant number Plant height(cm) 1200000004-152 55.1 1200000004-158 57.7 1200000004-161 53.6 1200000004-167 58.4 1200000004-172 54.8 1200000004-179 57.5 1200000004-181 56.1 1200000004-186 54.8 1200000004-195 58.3 1200000004-198 55.7 1200000005-156 54.6 1200000005-159 57.5 1200000005-164 56.1 1200000005-167 58.2 1200000005-174 54.4 1200000005-178 57.6 1200000005-182 55.3 1200000005-186 57.8 1200000005-192 56.4 1200000005-199 54.2 average value 56.2

[0172] In addition, in terms of seed yield, 10 wild-type plants for control and 10 flc mutant plants of the present invention were randomly selected to perform statistics on the seed yield of each plant. It is worth noting that the statistics in this embodiment are the seed yield of each plant at final maturity (i.e., the seed yield of each plant at the end of the entire growth period), as shown in Tables 14 and 15, respectively.

[0173] Table 14 Seed yield per plant of wild type plants

[0174]

[0175] Table 15 The seed yield per plant of flc mutant plants

[0176]

[0177] Result analysis: 1. Compare the sequencing results with the wild-type sequence. The red boxes represent the bases or sequences that are inserted or deleted compared with the wild-type (such as Figure 3 and Figure 4 The phenotype of the flc mutant plant of the present invention (as shown) Figure 3 (a), (b), (c), (e), (f)) and wild-type plants (as shown in Figure 3 Compared with (d) in the figure, the flc mutant of Pennisetum cyrtonema blooms one month earlier and the entire growth period is shortened to about 80 days. This will provide the necessary conditions for Pennisetum cyrtonema to become an emerging model plant. Compared with the current entire growth period of about 140 days, the plant growth cycle is greatly shortened.

[0178] 2. From the statistical results of plant height and seed yield, it can be seen that the plant height of the flc mutant plant of the embodiment of the present invention is about 56 cm on average, and the plant height of the wild-type plant of the control is about 77 cm on average. Compared with the plant height of the wild-type plant, the plant height of the plant is significantly reduced. The plant height is reduced, the body size is reduced, and the lodging resistance is reduced. The plant of the flc mutant of the present invention is suitable for dense planting. At present, the planting density of the wild-type is 30,000 plants / mu, and the planting density of the flc mutant of the present invention can reach 150,000-200,000 plants / mu. Therefore, although the seed yield per plant is reduced, the flc mutant of the present invention can be suitable for dense planting, and the seed yield per mu can be increased by at least about 2 times.

[0179] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and do not constitute a limitation on the content of the present invention. Within the technical concept of the present invention, the technical solutions of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A modified FLC gene of Cyperus rotundus, characterized in that: The modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

2. The modified FLC gene of Cyperus rotundus according to claim 1, characterized in that: The modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 20 bp upstream and downstream of the target sequence.

3. A kind of iris flc A mutant characterized in that The modified target sequence comprises a modified target sequence, wherein the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence.

4. The herb of claim 3 flc A mutant characterized in that The modified target sequence is a nucleotide sequence obtained by inserting and / or deleting at least one nucleotide within the target sequence shown in SEQ ID NO. 2 and / or within 20 bp upstream and downstream of the target sequence.

5. The pennywort according to claim 3 or 4 flc A method for constructing a mutant, characterized in that: The following steps are involved: (1) Constructing a CRISPR / Cas9 vector for the modified FLC gene of P. cyrtonema; (2) transforming Agrobacterium with the vector obtained in step (1); (3) transforming the inflorescence part of the target Imbricata plant mediated by Agrobacterium obtained in step (1); (4) Screening and / or identification of positive Cyperus rotundus plants.

6. A method for improving a variety of Cyperus rotundus, comprising: The method comprises making the antler cyperus contain a modified antler cyperus FLC gene with decreased activity or inactivation, so as to obtain a gene-edited antler cyperus variety, wherein the modified antler cyperus FLC gene contains a modified target sequence, and the modified target sequence is a nucleotide sequence obtained by inserting and / or deleting and / or replacing and / or adding and / or inverting and / or modifying at least one nucleotide within the target sequence shown in SEQ ID NO.2 and / or within 30 bp upstream and downstream of the target sequence; The gene-edited iris variety includes at least one of the following changes: early flowering and fruiting, shortened growth period, dwarfing of plants, resistance to lodging, facilitation of dense planting and increased seed yield.

7. The method for improving the variety of Cyperus rotundus according to claim 6, characterized in that: The method comprises using gene editing technology to modify the target sequence shown in SEQ ID NO.2 to obtain a modified FLC gene of Cyperus rotundus, so that the activity of the FLC gene of Cyperus rotundus is reduced or inactivated.

8. The method for improving and cultivating the variety of Cyperus rotundus according to claim 7, characterized in that: The gene editing includes at least one of gene knockout, gene knockdown, gene insertion, base substitution, gene mutation, and gene recombination.

9. An expression vector, host cell or recombinant bacterium comprising the modified FLC gene of claim 1.

10. The modified FLC gene of Cyperus rotundus according to claim 1 or 2, or the Cyperus rotundus according to claim 3 or 4 flc The mutant, the antler of claim 5 flc A method for constructing a mutant, a method for improving an antler variety according to any one of claims 6 to 8, and the use of an expression vector, a host cell or a recombinant bacterium comprising the modified antler FLC gene according to claim 1 according to claim 9 in at least one of the following changes: early flowering and fruiting of antler, shortening of the growth period, dwarfing of the plant, resistance to lodging, facilitation of dense planting and increase in seed yield.

Images