Plant disease susceptibility-related TaCNGC13 gene, protein and its application
By cloning and silencing the wheat TaCNGC13 gene, Agrobacterium transformation technology is used to cultivate stripe rust-resistant varieties, which solves the problem of loss of stripe rust resistance in wheat, and achieves an efficient resistance to stripe rust bacteria.
Patent Information
- Application Number
- CN202510412453.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-04-03
AI Technical Summary
The existing technology is difficult to effectively prevent and control wheat stripe rust. The disease-resistant varieties lose resistance under climate change and variability of bacterial virulence. The sensory disease gene promotes bacterial infection and affects wheat yield.
The TaCNGC13 gene in water source 11 of wheat varieties was cloned and stabilized, and the TaCNGC13 gene was silenced through induced expression of rust bacteria to improve wheat's resistance to rust. Agrobacterium transformed silencing vector was used to cultivate rust resistant rust varieties.
It significantly improves the resistance of wheat to multiple physiological species of rust bacteria, reduces the number of spore piles and necrosis area, reduces the biomass of rust bacteria, and enhances the disease resistance of wheat.
Smart Images

Figure CN119913172B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering and relates to plant disease-related TaCNGC13 Genes, proteins and their applications. Background Art
[0002] Wheat stripe rust is caused by Puccinia striatum wheat-specific type ( Puccinia striiformis f. sp. Tritici The fungal disease caused by stripe rust (Pst) affects wheat yield. Stripe rust is an obligate vegetative parasite that relies on living wheat cells for survival and requires the absorption of intermediate products for growth and development. Its summer spores are transported to leaves by wind and, under suitable temperature and humidity conditions, germinate within 4-6 hours to form germ tubes, infecting wheat and establishing a parasitic relationship. Once in the host plant, stripe rust absorbs nutrients through haustoria and reproduces. During this process, the host plant exhibits symptoms such as chlorosis and necrosis, weakening its vitality and photosynthesis. This is accompanied by a decrease in key crop yield indicators such as tiller number, ear number, and seed number, leading to a reduction in yield.
[0003] Planting disease-resistant varieties is considered the most cost-effective measure to prevent and control stripe rust. However, changes in the climate and environment, unreasonable human cultivation practices, and mutations in virulent races of wheat stripe rust may lead to the loss of resistance in disease-resistant varieties. Host genes in plants that promote pathogen infection and support affinity interactions are considered susceptibility genes. Mutations or deletions in susceptibility genes limit the ability of pathogens to infect and cause disease, thereby enhancing the host's disease resistance. During the pathogen invasion period, susceptibility genes negatively regulate the plant's immune response; after pathogen invasion, susceptibility genes promote affinity interactions between the host and pathogen, including the absorption of nutrients from the host to meet the pathogen's metabolic and structural needs. Plant pathogens use the plant's susceptibility genes to promote infection. Interference and mutation of these susceptibility genes will block the affinity interactions between the host and pathogen, enhancing disease resistance.
[0004] Therefore, exploring a susceptible gene resource related to wheat stripe rust resistance is of great significance for green disease prevention and control and the breeding of disease-resistant wheat varieties. Summary of the Invention
[0005] In order to solve the above technical problems, the present invention provides a plant disease-related TaCNGC13 Genes, proteins and their applications. Plant disease related TaCNGC13 The gene comes from the wheat variety Shuiyuan 11 ( Triticum aestivum ), the nucleotide sequence of which is shown in SEQ ID NO: 1, and the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO: 2. TaCNGC13 Genes induced by stripe rust are stably silenced and related to plant susceptibility TaCNGC13The gene is expressed in wheat, and the resulting transgenic wheat has higher resistance to multiple physiological races of stripe rust than wild-type wheat. The invention provides a new germplasm material for green prevention and control of wheat stripe rust and cultivation of wheat stripe rust-resistant varieties.
[0006] In order to achieve the technical purpose of the present invention, on the one hand, the present invention provides a plant disease-related TaCNGC13 Genes related to plant disease susceptibility TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0007] On the other hand, the present invention provides a plant disease-related TaCNGC13 protein, which is TaCNGC13 Gene encoding; the amino acid sequence of the plant disease-related TaCNGC13 protein is shown in SEQ ID NO: 2.
[0008] A person skilled in the art can obtain a derived amino acid sequence by replacing, deleting and / or adding one or more amino acids to the plant disease-related TaCNGC13 protein as shown in SEQ ID NO: 2, and the derived amino acid sequence still has the activity of the plant disease-related TaCNGC13 protein.
[0009] To facilitate purification of the plant disease-associated TaCNGC13 protein, a tag can be attached to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID NO: 2. The tag can be any one of Poly-Arg, Poly-His, FLAG, Strep-tag II, and c-myc.
[0010] On the other hand, the present invention claims protection of plant disease related TaCNGC13 Application of genes in wheat resistance to stripe rust, said plants are susceptible to the disease TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. TaCNGC13 The gene expression is induced by stripe rust.
[0011] Specifically, the present invention analyzes TaCNGC13 Gene expression profiles in the interaction between wheat and stripe rust were found. TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the non-compatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.
[0012] Further, silencing the plant disease-related TaCNGC13 The silencing sequence of the gene improves the resistance of wheat to stripe rust, and the silencing sequence is a plant disease-related TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end.
[0013] Specifically, the present invention is to TaCNGC13 Analysis of the stripe rust resistance of genetically modified wheat revealed that under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, a large number of spores were observed on the leaves of all treated control Fielder plants, while the transgenic TaCNGC13 Genetic wheat T3 lines TaCNGC13 Stably silenced strains 9 and TaCNGC13 The number of summer spores on the leaves of the stable silenced wheat line 21 was significantly reduced, and the area of chlorosis and necrosis increased, indicating that the transgenic line TaCNGC13 The resistance of genetically modified wheat to stripe rust is significantly improved. TaCNGC13 The relative expression of the gene was always 20% to 40% of the control, and the biomass of stripe rust was significantly reduced, indicating that the transgenic TaCNGC13 The genetically modified wheat showed strong resistance to infection by stripe rust fungi CYR31, CYR32, CYR33, and CYR34.
[0014] On the other hand, the present invention claims a method for cultivating wheat stripe rust resistant varieties, which silences plant disease-related genes in plants. TaCNGC13 Genes related to plant disease susceptibility TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.
[0015] Furthermore, the present invention provides a method for cultivating wheat stripe rust resistant varieties, comprising constructing a silencing vector, transforming the silencing vector into Agrobacterium, and infecting wheat plants with the Agrobacterium carrying the recombinant vector to obtain the wheat stripe rust resistant variety. The silencing vector comprises a silencing sequence and an empty vector, and the silencing sequence is a plant disease-related TaCNGC13 The gene is from the 109th to the 315th nucleotides from the 5' end, and the empty vector is an RNAi vector.
[0016] Those skilled in the art can easily adopt known methods, such as directed evolution and point mutation, to modify the plant disease-related genes of the present invention. TaCNGC13 Gene mutation. Those artificially modified genes have the plant disease-related TaCNGC13 Nucleotides with 75% or higher nucleotide sequence identity to the gene, as long as they encode plant disease-related TaCNGC13 proteins and have the same function, are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.
[0017] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes sequences related to the plant disease of the present invention. TaCNGC13The nucleotide sequence of a gene has a nucleotide sequence with 75% or higher, or 85% or higher, or 90% or higher, or 95% or higher identity. Identity can be evaluated with the naked eye or with computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.
[0018] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.
[0019] The present invention also provides a plant disease-related TaCNGC13 Recombinant vector, expression cassette or recombinant bacteria of the gene.
[0020] In the present invention, the expression cassette refers to a gene that can express a plant disease-related protein as shown in SEQ ID NO: 1 in a host cell. TaCNGC13 The DNA of the gene may include not only a promoter for initiating transcription of the polynucleotide shown in SEQ ID NO: 1, but also a promoter for terminating the plant disease-related gene shown in SEQ ID NO: 1. TaCNGC13 A terminator for gene transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters useful in the present invention include, but are not limited to, constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus (CaMV) 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators.
[0021] In the present invention, existing expression vectors can be used to construct a recombinant vector containing the expression cassette. Such plant expression vectors include vectors suitable for plant microprojectile bombardment, such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1305, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb (CAMBIA). The plant expression vector may also contain the 3' untranslated region of the foreign gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylic acid to the 3' end of the mRNA precursor. For example, the 3' transcribed untranslated region of Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the nopaline synthase gene Nos) and plant genes (such as the soybean storage protein gene) all have similar functions. When using gene construction plant expression vector of the present invention, also can use enhancer, comprise translation enhancer or transcription enhancer, these enhancer regions can be ATG start codon or adjacent region start codon etc., but must be identical with the reading frame of coding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and start codon is extensive, can be natural, also can be synthetic.The translation initiation region can be from transcription initiation region or structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include genes encoding color-changing enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene or luciferase gene), antibiotic marker genes (such as the nptII gene, which confers resistance to kanamycin and related antibiotics; the bar gene, which confers resistance to the herbicide phosphinothricin; the hph gene, which confers resistance to the antibiotic hygromycin; the dhfr gene, which confers resistance to methotrexate; and the EPSPS gene, which confers resistance to glyphosate), chemical resistance marker genes (such as herbicide resistance genes), and the mannose-6-phosphate isomerase gene, which confers the ability to metabolize mannose. For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen transformed plants using stress.
[0022] The above-mentioned vector or expression vector can be a plasmid, cosmid, phage or viral vector.
[0023] The microorganisms may be yeast, bacteria, algae or fungi, such as Agrobacterium.
[0024] The above-mentioned transgenic plant cell lines do not include propagation materials.
[0025] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:
[0026] (1) The present invention cloned a plant disease-related gene from the wheat variety Shuiyuan 11 TaCNGC13 gene, the nucleotide sequence of which is shown in SEQ ID NO: 1, This The amino acid sequence of the gene encoding protein is shown in SEQ ID NO: 2, which is related to plant disease TaCNGC13 The gene is induced to express by stripe rust. TaCNGC13 Gene expression profiles in the interaction between wheat and stripe rust were found. TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the non-compatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.
[0027] (2) Silencing plant disease-related genes TaCNGC13 The present invention is to improve the resistance of wheat to stripe rust. TaCNGC13 Analysis of the stripe rust resistance of genetically modified wheat revealed that under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, a large number of spores were observed on the leaves of all treated control Fielder plants, while the transgenic TaCNGC13 Genetic wheat T3 lines TaCNGC13 Stably silenced strains 9 and TaCNGC13 The number of summer spores on the leaves of the stable silenced wheat line 21 was significantly reduced, and the area of chlorosis and necrosis increased, indicating that the transgenic line TaCNGC13 The resistance of genetically modified wheat to stripe rust is significantly improved. TaCNGC13 The relative expression of the gene was always 20% to 40% of the control, and the biomass of stripe rust was significantly reduced, indicating that the transgenic TaCNGC13 The genetically modified wheat showed strong resistance to infection by stripe rust fungi CYR31, CYR32, CYR33, and CYR34. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 for TaCNGC13 Gene expression profile analysis diagram in the interaction between wheat and stripe rust. “**” indicates that compared with 0h, p Significance at the <0.01 level.
[0029] Figure 2 For transfer TaCNGC13 PCR identification results of genetic wheat T3 generation lines. Figure 2 A in TaCNGC13 Figure 1 shows the PCR identification results of the stable silenced strain 9; Figure 2 B in TaCNGC13 PCR identification results of stable silenced strain 21.
[0030] Figure 3 For transfer TaCNGC13Figure 1 shows the results of identification of stripe rust resistance of genetically modified wheat T3 generation lines. Figure 3 A in the figure is the phenotype diagram 14 days after inoculation of stripe rust physiological races CYR31, CYR32, CYR33 and CYR34; Figure 3 B is 120 hours after inoculation of stripe rust races CYR31, CYR32, CYR33 and CYR34 TaCNGC13 relative expression of genes; Figure 3 Figure C is a biomass analysis of stripe rust 5 days after inoculation with stripe rust physiological races CYR31, CYR32, CYR33 and CYR34. DETAILED DESCRIPTION
[0031] The technical solutions of the present invention are now described with reference to the following examples. However, the present invention is not limited to the following examples. The experimental methods and detection methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.
[0032] Example 1
[0033] This embodiment provides TaCNGC13 Acquisition of gene and protein TaCNGC13.
[0034] Wheat seedlings grown for 7 days were quickly frozen in liquid nitrogen and stored at -80°C. Total RNA from wheat leaves was extracted using a polysaccharide and polyphenol plant RNA extraction kit (purchased from Huayueyang Biotechnology Co., Ltd.). First-strand cDNA was synthesized using reverse transcriptase XL (AMV). cDNA was synthesized using the SMART method, and amplification primers were designed ( TaCNGC13 -F: 5'-ATGTCTAATAATCAGAAGTATGGTG-3'; TaCNGC13 -R: 5'-CATGTGGATCTTGGATTGCAGATAC-3'), PCR amplification was performed, and the PCR product was detected by 1.0% agarose gel electrophoresis. A 2265 bp PCR product was obtained. After sequencing, the PCR product had the nucleotide sequence shown in SEQ ID NO: 1. The PCR product was named TaCNGC13 Gene. TaCNGC13 The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 2, and is named plant disease-related protein TaCNGC13.
[0035] Example 2
[0036] This embodiment provides TaCNGC13 Expression profiling of genes in the interaction between wheat and stripe rust.
[0037] Wheat was inoculated with stripe rust at the one-leaf and one-heart stage. The inoculation method was based on the reference "Discovery of a New Normal-Temperature Pathogenic Bacteria Strain of Lovelin 10" (Kang Zhensheng, Li Zhenqi). Wheat water source 11 leaves were inoculated with non-compatible race CYR23 or compatible race CYR31 to form a non-compatible and compatible interactive combination, and sterile water was inoculated as the control group. Samples were taken at 0h, 6h, 12h, 24h, 48h, 72h, 96h, and 120h after inoculation, and the sampling time point of the control group was consistent with that of the treatment group. When sampling, fresh leaves were cut, wrapped in tin-platinum paper, and quickly frozen in liquid nitrogen, and then stored at -80℃ for later use. The total RNA of wheat leaves was extracted using the Trizol method (TianGen), and reverse transcriptase XL (AMV) was used for the first-strand cDNA synthesis. The cDNA was synthesized using the SMART method. According to the wheat TaCNGC13 elongation factor genes TaEF Specific reverse transcription-PCR primers were designed based on the sequence of the gene (GenBank accession number: U76744).
[0038] Before use, the reverse transcription PCR primers must be tested for their specificity and amplification efficiency (≥90%). TaEF It was used as an internal reference gene in RT-PCR analysis. Real-time quantitative PCR amplification was performed using AceQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China) and a Bio-Rad CFX Manager quantitative PCR instrument (Bio-rad, Hercules, California) with cDNA from each treatment sampling point as a template. Each reaction was repeated at least three times, and the Ct value of each repeat, as well as its mean and standard deviation, was generated by the quantitative PCR instrument by manually adjusting the baseline. Each reaction was repeated three times, and the Ct value was averaged. The experimental data were analyzed using the Delta Delta Ct method to determine the TaCNGC13 The relative expression of genes, as shown in Figure 1 shown.
[0039] The RT-PCR primer sequences are:
[0040] TaCNGC13 -RT-F: 5'-ACCATCAGATGCGTAACAAATGTAG-3';
[0041] TaCNGC13 -RT-R: 5'-GCAGCTGCCTTCTTTCGCCTTTGAT-3'.
[0042] TaEF -RT-F: 5'-TGGTGTCATCAAGCCTGGTATGGT-3';
[0043] TaEF -RT-R:5'-ACTCATGGTGCATCTCAACGGACT-3'.
[0044] Depend on Figure 1 It can be seen that after wheat water source 11 was inoculated with non-compatible stripe rust race CYR23 or compatible stripe rust race CYR31, TaCNGC13 The gene was up-regulated in the early stage of infection after inoculation in both the non-compatible and compatible combinations, indicating that TaCNGC13 The gene expression was induced by stripe rust infection.
[0045] Example 3
[0046] This embodiment provides a TaCNGC13 Application of genetically modified wheat in improving plant resistance to stripe rust.
[0047] 1. Transfer TaCNGC13 Obtaining genetically modified wheat
[0048] (1) Construction of silencing vector
[0049] The amplified TaCNGC13 Gene as template, using primer pair TaCNGC13 -414-F (AAAAAAGCAGGCTCCGCGGCCGCCTGATCGTTCATACACCTACTCAAG) and TACNGC13 -414-R (CAAGAAAGCTGGGTCGGCGCGCCCCCCAAAGGTCCAGAAATCCTCAAG), the target fragment was obtained, specifically TaCNGC13 The target fragment is connected to the RNAi vector through LR reaction to obtain the recombinant vector. TaCNGC13 -RNAi. The LR reaction system includes: TaCNGC13 2 μL of -414 vector, 1 μL of RNAi vector, 1 μL of LR enzyme, and 1 μL of water were added, and the LR reaction was ligated at 25°C for 8 h.
[0050] (2) Transfer TaCNGC13 Acquisition and PCR Verification of Genetically Modified Wheat
[0051] Recombinant vector TaCNGC13 -RNAi was used to infect wild-type wheat Fielder callus with Agrobacterium tumefaciens to obtain T0 transgenic TaCNGC13 Genetic wheat. Cultivation of T0 generation transgenic wheat TaCNGC13 Genetic wheat until T3 generation TaCNGC13 Two genetic wheat lines ( TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stably silenced strain 21).
[0052] T3 transgenic plants were extracted using CTAB method. TaCNGC13 The genomic DNA of leaves of two transgenic wheat lines and wild-type control wheat (Fielder) was used to design primers F (TTTAGCCCTGCCTTCATACG) and R (CACGCAAGTCCGCATCTTCA) for molecular detection of transgenic T3 plants. Water was used as a blank control, and 10 plants were randomly selected from each line. The test results are shown in Figure 2. Figure 2 shown.
[0053] Depend on Figure 2 It can be seen that T3 generation TaCNGC13 The molecular detection results of genetically modified wheat showed obvious bands in the positive lines, indicating that the T3 generation of transgenic wheat TaCNGC13 Two genetic wheat lines ( TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stable silenced lines 21) were all positive lines.
[0054] 2. Transfer TaCNGC13 Analysis of stripe rust resistance in genetically modified wheat
[0055] The wild type wheat Fielder (material from the College of Plant Protection, Northwest Agriculture and Forestry University) and TaCNGC13 Stably silenced strains 9 and TaCNGC13 Stably silenced strain 21 was grown in an incubator at 25 / 23°C (daytime temperature / nighttime temperature) with a 16-hour light / 8-hour dark photoperiod. After the second leaf expanded, it was inoculated with stripe rust races CYR31, CYR32, CYR33, and CYR34, respectively. The inoculation method was based on the reference "Discovery of a New Mesophilic Pathogenic Strain of Lovelin 10" (Kang Zhensheng, Li Zhenqi). The disease phenotype was observed 14 days after inoculation ( Figure 3 A), 120h after inoculation, the leaves at the inoculation site were taken as samples to extract RNA, and the RT-PCR detection method in Example 2 was used for detection. TaCNGC13 The relative expression of genes ( Figure 3 B in the figure). The stripe rust biomass was detected 5 days after inoculation according to the method in "Stripe Rust Effector PstGSRE1 Disrupts Nuclear Localization of ROS-Promoting Transcription Factor TaLOL2 to DefeatROS-Induced Defense in Wheat". The results are as follows: Figure 3 As shown in C.
[0056] Depend on Figure 3As shown in A, a large number of spore piles were observed on the leaves of all treatments of the control Fielder plants under the infection of stripe rust fungi CYR31, CYR32, CYR33, and CYR34, while TaCNGC13 Stably silenced strains 9 and TaCNGC13 The number of summer spores on the leaves of the stable silenced wheat line 21 was significantly reduced, and the area of chlorosis and necrosis increased, indicating that the transgenic line TaCNGC13 The genetically modified wheat has significantly improved resistance to stripe rust. Figure 3 As shown in B, the stable silenced wheat material TaCNGC13 The relative expression of the gene is always 20%~40% of the control. [[ID= The C in the figure shows that the biomass of stripe rust in the stable silenced wheat material was significantly reduced. The genetically modified wheat showed strong resistance to infection by stripe rust fungi CYR31, CYR32, CYR33, and CYR34.
[0057] As described above, the basic principles, main features and advantages of the present invention are well described. The above embodiments and descriptions are merely descriptions of preferred embodiments of the present invention, and the present invention is not limited to the above embodiments. Various changes and improvements made to the technical solutions of the present invention by those skilled in the art without departing from the spirit and scope of the present invention should fall within the scope of protection determined by the present invention.
Claims
1. Plant disease related TaCNGC13 A gene characterized by The plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
2. Plant disease susceptibility-related TaCNGC13 protein, characterized in that: The plant disease-related TaCNGC13 Genetic coding; The amino acid sequence of the plant disease susceptibility-related TaCNGC13 protein is shown in SEQ ID NO:
2.
3. Plant disease related TaCNGC13 The application of the gene in wheat stripe rust resistance is characterized in that: The plant disease related TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; Silencing the plant disease-associated TaCNGC13 Genes improve wheat resistance to stripe rust.
4. The use according to claim 3, characterized in that The plant disease related TaCNGC13 The gene expression is induced by stripe rust.
5. A method for cultivating wheat stripe rust-resistant varieties, characterized in that: Silencing plant disease-associated genes in plants TaCNGC13 Genes related to plant disease susceptibility TaCNGC13 The nucleotide sequence of the gene is shown in SEQ ID NO:
1.
6. The cultivation method according to claim 5, characterized in that The method comprises constructing a silencing vector, transforming the silencing vector into Agrobacterium, and infecting wheat plants with the Agrobacterium carrying the silencing vector to obtain the wheat stripe rust resistant variety.
7. The cultivation method according to claim 6, characterized in that The silencing vector includes a silencing sequence and an empty vector; The silencing sequence is related to plant disease TaCNGC13 The gene is from nucleotides 109 to 315 from the 5' end; The empty vector is an RNAi vector.
Citation Information
Patent Citations
Application of disease-resistant related protein TaMYB22 in regulation and control of stripe rust resistance of plants
CN118256519A
Application of wheat disease-resistant factor TaCDPK28 in prevention and treatment of stripe rust
CN118878658A