SNP (Single Nucleotide Polymorphism) site of ABO blood group variant, B subtype variant blood group identification kit and method

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) site of an ABO blood group variant, and a B subtype variant blood group identification kit and method, and relates to the technical field of biology. The SNP (Single Nucleotide Polymorphism) sites of the ABO blood group variant comprise the 842th c.842Cgt from an initiation codon of an ABO * B.01 allele coding region of an ABO gene; mutation of T. A substance for detecting the SNP site of the ABO blood group variant can be applied to preparation of a B subtype variant blood group identification method and product, so that the substance can be effectively applied to rapid detection of patients and blood donors, the B subtype variant blood group of an individual can be defined, and potential possible blood transfusion reaction can be prevented in time.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a kit and method for identifying SNP sites of ABO blood type variants and B subtype variant blood types. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] In the fields of clinical medicine, organ transplantation, neonatal health and genetic research, accurate typing of the ABO blood type system is crucial. ABO It is determined by genes, which are located on chromosome 9 (9q34.1~34.2) and contain three multiple alleles: A, B and O. H antigen is the precursor of ABO antigen. N-acetylgalactosamine transferase (GTA) encoded by A allele converts H antigen into A antigen; galactosyltransferase (GTB) encoded by B allele converts H antigen into B antigen; O gene does not encode active enzyme, only retains H antigen, so ABO blood type can be divided into four phenotypes: A, B, O, and AB.

[0004] There are many ABO subtypes in the population, and the detection of these subtypes is crucial to the safety of blood transfusion. Before transfusion, a matching donor must be selected to avoid transfusion reactions caused by incompatible blood types. Subtypes such as Aw and Bw may cause ABO-incompatible blood transfusions to trigger acute immune hemolytic transfusion reactions, endangering the patient's life and health. Correct identification can avoid inconsistencies in positive and negative typing and changes in agglutination reactions in mixed fields due to antigen weakening, reducing the risks in transfusion.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to determine the B subtype blood type proband ABO The SNP sites on the gene are marked, and corresponding detection products are developed for the SNP sites, hoping that they can be used to clarify the ABO blood type genotype of other individuals to be tested, thereby improving the safety of blood transfusion.

[0007] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions: In a first aspect, a method for detecting a SNP site in the preparation of a B subtype variant blood type identification product is provided, wherein the SNP site is a SNP site of an ABO blood type variant, comprising ABO Gene ABO*B.01 The mutation of c.842C>T at position 842 from the start codon in the coding region of the allele.

[0008] In a second aspect, a kit for identifying subtype B variant blood types is provided, the kit comprising a substance for detecting the SNP site described in the first aspect.

[0009] In a third aspect, a method for identifying a B subtype variant blood type is provided, the method comprising obtaining a sample to be tested ABO The base type at the 842nd position from the start codon of the gene coding region, if the SNP site described in the first aspect exists, is determined to be a subtype B variant blood type.

[0010] In a fourth aspect, provided is a substance for detecting the SNP site described in the first aspect, or use of the kit described in the second aspect in preparing an immune hemolytic transfusion reaction identification product.

[0011] Compared with the prior art, the present invention has the following beneficial effects: The present invention discovered a new SNP site of the ABO blood group system, the mutation of which leads to ABO Gene ABO* B.01 Generation of allele variants. This SNP site was found in a proband with a B subtype ABO blood type variation. This SNP site is associated with immune hemolytic transfusion reactions, resulting in changes in the encoded B glycosyltransferase, affecting the connection of the substrate galactose to the precursor H antigen, causing its B antigen strength to be lower than the red blood cell B antigen of a normal B type or AB type individual, forming a B subtype variant. Individuals carrying this B subtype variant will produce allogeneic anti-B antibodies in their plasma after experiencing immune stimulation such as blood transfusion and pregnancy. Once normal B type blood is transfused, it will induce an acute hemolytic transfusion reaction. In order to achieve timely detection and prevention of hemolytic transfusion reactions, the present invention has developed an efficient ABO blood type B subtype variant individual diagnostic product based on this SNP site. The application effect shows that the product provided by the present invention ABO Gene SNP sites and detection products can quickly and accurately detect whether clinical patients and blood donors are caused by ABO Gene ABO*B.01 The B subtype variant caused by the allele c.842C>T mutation site helps to clarify the B subtype variant blood type in the individual ABO blood type, improve the accuracy of blood type identification, and is of great significance to the safety of clinical blood transfusion. Through this molecular detection method, this type of ABO blood type subtype can be more accurately identified and distinguished, providing more reliable blood type information for the clinic, thereby optimizing blood transfusion treatment plans, reducing transfusion-related complications, and improving patient safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0013] Figure 1 The proband in Example 1 ABO Gene ABO*B.01 Direct sequencing partial sequence map of exon 7 of the allele; Figure 2 The proband in Example 1 ABO Gene ABO*B.01 Partial sequence diagram of the haplotype clone sequencing of exon 7 of the allele.

[0014] Figure 3 For the proband in Example 2 ABO Gene ABO*B.01 Electrophoresis diagram of PCR-SSP amplification of allele c.842C>T. Lane 1 is the DNA molecule marker of DL2000, lanes 2~3 are the negative results of PCR-SSP detection of wild-type 842 nucleotide site; lane 4 is the positive result of PCR-SSP detection of mutant 842 nucleotide site. The positive bands shown in lanes 2~4 are the HGH internal controls. DETAILED DESCRIPTION

[0015] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0016] It should be noted that: In this document, unless otherwise specified, all implementation methods and preferred implementation methods mentioned in this document can be combined with each other to form a new technical solution; all technical features and preferred features mentioned in this document can be combined with each other to form a new technical solution.

[0017] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0018] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0019] As used herein, "and / or" is used to indicate that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0020] Unless otherwise specified, the professional and scientific terms used herein have the same meanings as those familiar to those skilled in the art. In addition, any method or material similar or equivalent to the described content may also be applied to the present invention.

[0021] The present invention discovered a pathogenic SNP site in a B subtype variant, and the SNP site is ABO Gene ABO*B.01 The mutation of c.842C>T at position 842 from the start codon of the coding region of the allele is: ABO Gene ABO*B.01 In this paper, the SNP site is the wild type with gene ID NG_006669.2. ABO Gene ABO*B.01 Allele is the reference. Wild type ABO Gene ABO*B.01 The nucleotide sequence of exon 7 and flanking exon 1 of the allele is shown in SEQ ID No. 7. The SNP site is located at position 476 (also ABO The SNP site is the 842nd position from the start codon of the gene coding region (such as the underlined base in SEQ ID No. 7), where the base C mutates to T.

[0022] SEQ ID No.7: CCTTGCAGATACGTGGCTTTCCTGAAGCTGTTCCTGGAGACGGCGGAGAAGCACTTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCAGCCGGCCGCGGTGCCCCGCGTGACGCTGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGGGCGCCTACAAGCGCTGGCAGGACGTGTCCATGCGCCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTC AGCGAGGTGGATTACCTGGTGTGCGTGGACGTCGACCATGTGGGCGTGGAGATCCTGACTCCGCTGTTCGGCACCCTGCACCCCAGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCCGGCCCCAGTCCCAGGCCTACATCCCCAAGGACGAGGGCGATTTCTACTACATGGGGGCGTTCTTCGGGGGGTCGGTGCAAGAGGTGCAGCGGCTCA T CAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGCATCGAGGCCGTGTGGCACGACGAGAGCCACCTGAACAAGTACCTACTGCGCCACAAACCCACCAAGGTGCTCTCCCCGAGTACTTGTGGGACCAGCAGCTGCTGG GCTGGCCCGCCGTCCTGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGAGCGGCTGCCAGGGGCTCTGGGAGGGCTGCCAGCAGCCCGTCCCCCTCCCGCCCTTGGTTTTAGCAGAACGGGT.

[0023] The c.842C>T mutation can cause changes in B glycosyltransferase, resulting in mutations in the surface antigen of red blood cells of type B individuals, which in turn causes their B antigen to be weaker than the normal B or AB type human red blood cell B antigen. After blood transfusion, pregnancy and other immune stimulation, such individuals can produce allogeneic anti-B antibodies in their plasma. Once normal type B blood is transfused, it will cause acute hemolytic transfusion reactions. In order to achieve timely detection and prevention, the following technical solutions are provided.

[0024] In a first aspect, a method for detecting a SNP site in the preparation of a B subtype variant blood type identification product is provided, wherein the SNP site is a SNP site of an ABO blood type variant, comprising ABO Gene ABO*B.01 The mutation of c.842C>T at position 842 from the start codon of the coding region of the allele. In this article, the B subtype variant includes the variation of the B antigen in the B blood type, and also includes the variation of the B antigen in the AB blood type.

[0025] In an optional embodiment, the substance for detecting SNP sites includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substance for detecting SNP sites includes, but is not limited to, primers, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing a sequencing library, and reagents for sequencing according to general and more specific teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0026] In an optional embodiment, the reagent for nucleic acid amplification includes a first reagent, and the first reagent includes a reagent for amplification ABO Gene ABO*B.01 Amplification primers and sequencing primers for the fragment within the 7th exon of the allele and the 7th exon flanking sequence. Those skilled in the art can obtain amplification primers and sequencing primers covering the above-mentioned target fragments according to the general rules and methods of primer design in the art. The amplification primers and the sequencing primers can be the same or different.

[0027] In an optional embodiment, in the first reagent, the amplification primers are selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0028] In an optional embodiment, in the first reagent, the sequencing primer is selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0029] In an optional embodiment, the reagent for nucleic acid amplification includes a second reagent, and the second reagent includes a c.842C>T mutation amplification primer pair. A mutation amplification primer pair (Mutation-Specific Primer Pair) refers to a primer pair designed to amplify a DNA fragment containing a specific mutation site. These primer pairs are generally used in PCR-SSP (Sequence Specific Primer) technology to detect gene mutations by specifically identifying mutation sites.

[0030] In an optional embodiment, the c.842C>T mutation amplification primer pair includes a c.842C>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0031] In an optional embodiment, the reagent for nucleic acid amplification further includes a primer pair for amplifying an internal reference gene. Optionally, the internal reference gene includes but is not limited to a conservative gene encoding at least one of the following proteins: HGH (Human Growth Hormone), G6PD (Glucose-6-Phosphate Dehydrogenase), GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) or β-actin.

[0032] In an optional embodiment, the reagent for nucleic acid amplification includes a primer pair for amplifying a gene encoding HGH, wherein the nucleotide sequences of the forward amplification primer and the reverse primer are the internal reference gene primer pair shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0033] In an optional embodiment, the second reagent includes the above-mentioned primer pair for amplifying the internal reference HGH gene.

[0034] In a second aspect, a kit for identifying subtype B variant blood types is provided, the kit comprising a substance for detecting the SNP site described in the first aspect.

[0035] In an optional embodiment, the kit includes the substance for detecting SNP sites described in the first aspect.

[0036] In an optional embodiment, the kit includes one or more of a reagent for nucleic acid amplification, a reagent for detecting a nucleic acid amplification product, a reagent for constructing a sequencing library, and a reagent for sequencing. More specifically, the substances for detecting SNP sites include, but are not limited to, primers, enzymes for nucleic acid amplification reactions, fluorescent markers, buffer reagents, dNTPs, salts, etc. Depending on the specific detection means, those skilled in the art can select the above-mentioned reagents for nucleic acid amplification, reagents for detecting nucleic acid amplification products, reagents for constructing a sequencing library, and reagents for sequencing according to general and more specific teaching materials, references, process manuals, product descriptions, and standard documents, etc., and the present invention does not limit this.

[0037] In an optional embodiment, the kit includes a first reagent, the first reagent includes a ABO Gene ABO*B.01 Amplification primers and sequencing primers for the fragments within exon 7 of the allele and the flanking sequence of exon 7.

[0038] In an optional embodiment, in the first reagent, the amplification primers are selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0039] In an optional embodiment, in the first reagent, the sequencing primer is selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are shown as SEQ ID No. 1 and SEQ ID No. 2, respectively.

[0040] In an optional embodiment, the kit includes a second reagent, which includes a c.842C>T mutation amplification primer pair.

[0041] In an optional embodiment, the c.842C>T mutation amplification primer pair includes a c.842C>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown as SEQ ID No. 3 and SEQ ID No. 4, respectively.

[0042] In an optional embodiment, the kit further comprises a primer pair for amplifying an internal reference gene. Optionally, the internal reference gene includes but is not limited to a gene encoding at least one of HGH, G6PD, GAPDH and β-actin.

[0043] In an optional embodiment, the kit further comprises an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are respectively shown as SEQ ID No. 5 and SEQ ID No. 6, and the target gene of the primer pair encodes HGH.

[0044] In an optional embodiment, the second reagent includes a c.842C>T mutation amplification primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively; and an internal reference gene primer pair whose nucleotide sequences of the forward amplification primer and the reverse primer are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively.

[0045] In a third aspect, a method for identifying a B subtype variant blood type is provided, the method comprising obtaining a sample to be tested ABO If the base type at position 842 from the start codon of the gene coding region contains the SNP site described in the first aspect, the sample to be tested is determined to be a subtype B variant blood type. It should be noted that the method for identifying the subtype B variant blood type is not for diagnosis and treatment purposes.

[0046] In an optional embodiment, the ABO Gene ABO Gene B allele. Further optionally ABO Gene ABO*B.01 Allele.

[0047] In an optional embodiment, the method comprises using the first reagent in the first aspect to amplify the sample to be tested. ABO The gene fragment including the 7th exon of the gene and the flanking sequence of the 7th exon is amplified, and then the SNP site in the amplified product is detected. Further optionally, the method comprises amplifying the sample to be tested using a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2, and then sequencing the amplified product using a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively as shown in SEQ ID No. 1 and SEQ ID No. 2.

[0048] In an optional embodiment, the method includes using the PCR-SSP method and the second reagent described in the first aspect to amplify the c.842C>T mutation site of the sample to be tested, and determining whether the blood sample to be tested is subtype B based on the corresponding amplification product results obtained, and if the amplification product is present, the sample to be tested is determined to be a subtype B variant blood type. Further optionally, PCR-SSP amplification is performed using a c.842C>T mutation amplification primer pair whose nucleotide sequences for the forward primer and the reverse primer are respectively shown as SEQ ID No. 3 and SEQ ID No. 4. Further optionally, an internal reference is amplified using a primer pair whose nucleotide sequences for the forward amplification primer and the reverse primer are respectively shown as SEQ ID No. 5 and SEQ ID No. 6.

[0049] In a fourth aspect, provided is a substance for detecting the SNP site described in the first aspect, or use of the kit described in the second aspect in preparing an immune hemolytic transfusion reaction identification product.

[0050] In an optional embodiment, the immune hemolytic transfusion reaction includes an acute or delayed hemolytic transfusion reaction.

[0051] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0052] Example 1 In this example, a gene test is performed on a proband of ABO blood type B subtype to confirm the gene mutation site. In this example, a PCR-SBT genotyping method is used, and the specific steps are as follows: (1) Prepare human genomic DNA for use as a template for subsequent PCR amplification.

[0053] Based on the informed consent of the proband, 200 µl of whole blood was collected for extraction of genomic DNA according to the instructions of Pre-Filled CartridgeReagent Kit (Cat. No.: 101@S4100-22157, RBC Bioscience), and the concentration and purity of the genomic DNA were determined by a spectrophotometer.

[0054] (2) Detection of the proband using the PCR-SBT method.

[0055] Synthesis includes ABO The amplification primers including the 7th exon of the gene and its flanking sequences, the specific primer sequences are shown in SEQ ID No. 1 and SEQ ID No. 2, and the amplification primers are diluted to 10 μmol / L with pure water.

[0056] SEQ ID No.1: 5'-ccttgcagatacgtggcttt-3'; SEQ ID No. 2: 5'-acccgttctgctaaaaccaag-3'.

[0057] Prepare LA Taq enzyme (Cat. No.: AM61864A, TaKaRa), RNase-free H2O, and the PCR amplification template prepared in step (1), and prepare the PCR reaction system according to Table 1.

[0058] Table 1 Amplification reaction system

[0059] The amplification conditions were as follows: 30 cycles of pre-denaturation at 95°C for 3 min, denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 1 min, and incubation of the amplified product at 4°C. After the PCR amplification was completed, 2 µl of the PCR product was subjected to agarose gel electrophoresis to determine the specificity of the amplified fragment.

[0060] The amplified product was digested with 1 μl shrimp alkaline phosphatase (Cat. No. 55953500, Roche) and 2 μl exonuclease I (Cat. No. AL90785A, TaKaRa) at 37°C for 30 min, and the enzyme was inactivated at 80°C for 15 min.

[0061] The purified PCR product was diluted with 10 µl of pure water and mixed. The two oligonucleotide sequencing primers (sequences shown in SEQ ID No. 1 and SEQ ID No. 2) were diluted to a concentration of 3.2 μmol / L with pure water and sequenced using BigDye terminator v3.1 sequencing kit (Cat. No. 4336699, ABI). The two sequencing primers were used for sequencing. The proband's genotype was ABO*B.01 / ABO*O.01.02 Heterozygotes, in addition to the characteristic mutation sites of the two alleles, a C / T heterozygous mutation occurred at the 842nd base from the start codon in the coding region of exon 7. Figure 1 The black box indicates the proband ABO The gene coding region has a C / T heterozygous mutation at the 842nd base from the start codon.

[0062] In order to further clarify the location of the allele where the mutation site is located, ABO Haplotype sequencing was performed on exon 7 of the gene.

[0063] The PCR amplification reaction system and procedure are the same as (2).

[0064] After amplification, 1 µl of PCR product was cloned into pCR™4-TOPO® TA vector using TOPO TA cloning kit (Cat. No. 2581734, invitrogen), and multiple colonies were selected for haplotype sequencing. The haplotype sequencing primers were the same as the amplification primers to determine the haplotype sequence of the proband. The results showed that the c.842C>T mutation was located at ABO*B.01 Alleles, such as Figure 2 As shown, the red box marks the proband ABO*B.01 On an allele basis, the coding region has a mutation from C to T at the 842nd base from the start codon.

[0065] After multiple sequencing results, it was shown that the mutation site was not caused by amplification or sequencing errors. Thus, a SNP site marker that can be used for B subtype blood type detection was obtained.

[0066] The results showed that the mutation was a newly discovered mutation, and the allele formed by the new mutation has not yet been included in the International Society of Blood Transfusion (ISBT) blood group gene mutation database (Names for ABO (ISBT 001) blood group alleles v1.1171023), indicating that the mutation is very rare. ABO An allele is a new gene. ABO* B.01 The allele coding region changes from C>T at position 842 from the start codon, resulting in the change of amino acid 281 from threonine to isoleucine (p.Thr281Ile). This amino acid change causes changes in the expression of B glycosyltransferase in type B individuals, resulting in a weakening of the B antigen, thus forming the B subtype. However, no mutation was found in the mutation screening of this site in peripheral blood genomic DNA samples of 199 normal local populations.

[0067] Through the above analysis, it is proved that the ABO The SNP marker sites of the gene are used to detect whether the individual's ABO blood type gene has mutated, thereby determining whether the individual is subtype B, whether there is a potential risk of transfusion hemolytic reaction, and to screen the corresponding matching donors to find matching compatible blood for the patient.

[0068] Example 2 This example uses the SNP site obtained in Example 1 to perform PCR-SSP detection to verify the feasibility of using the SNP site as a marker for B subtype identification, which specifically includes the following steps: (1) Prepare human genomic DNA as a template for PCR amplification in subsequent steps.

[0069] In accordance with relevant national policies and regulations and based on the informed consent of the proband, 200 µl of whole blood was collected for testing. Genomic DNA was extracted according to the instructions of the Pre-Filled Cartridge Reagent Kit (Cat. No.: 101@S4100-22157, RBC Bioscience), and the concentration and purity of the genomic DNA were determined. The DNA concentration was diluted to 30 ng / µl.

[0070] (2) Synthesize 2 pieces ABO Specific amplification primers for the SNP sites of the gene and two internal reference primers HGHAmplification primers, specific primer sequences are shown in Table 2, see the gene sequences in the content of the invention and the sequence table, and the amplification primers are diluted to 10 μmol / L with pure water.

[0071] Table 2 Primer sequences used for PCR-SSP detection

[0072] (3) PCR-SSP amplification for detection of subtype B in this type of proband ABO Gene mutation site Prepare GoTaq® DNA Polymerase reagent (Cat. No.: M3005, Promega), RNase-free H2O, the PCR amplification template prepared in step (1) and the primers prepared in step (2), and prepare the PCR reaction system according to Table 3.

[0073] Table 3 Amplification system

[0074] After the above PCR reaction system was mixed, amplification was performed on the ABI PCR instrument (ABI9700) according to the following program: 95°C pre-denaturation for 2 min; 95°C denaturation for 30 s, 62°C annealing for 30 s, 72°C extension for 30 s, reaction for 30 cycles; 72°C, 5 min. Then cooled to 4°C.

[0075] After PCR amplification, 2 µl of the PCR product was taken from each of the amplified fragments of the test sample for agarose gel electrophoresis to qualitatively determine whether the target amplified fragment exists. The results show whether the test sample has a SNP mutation site. Figure 3 Blood samples for testing ABO Electrophoresis diagram of the gene mutation at position 842. Figure 3 Lane 1 is the DNA marker of DL2000, lanes 2 to 3 are the PCR-SSP detection results of the wild-type 842 nucleotide site, and the amplification result is negative; lane 4 is the PCR-SSP detection result of the mutant 842 nucleotide site, and the amplification result is positive; the positive bands shown in lanes 2 to 4 are the HGH internal controls.

[0076] Example 3 The proband ABO Gene ABO*B.01 The c.842C>T mutation of the allele starting from the start codon causes changes in the expression of glycosyltransferase and changes in the expression of B antigen on the red blood cell surface. The resulting B subtype can be verified by analyzing the serological results of A, B, and H antigens on the red blood cell surface and antibodies in the serum.

[0077] (1) Preparation of the proband's red blood cell suspension: Take 100 μl of the proband's red blood cells, wash them three times with 0.9% saline, and prepare a 2-5% red blood cell suspension.

[0078] (2) Identification of A, B, and H antigens on the surface of red blood cells by saline test tube method: Add 1 drop of each of IgM anti-A, anti-B, anti-AB, and anti-H (anti-A clone number: 9113D10, SRBC-B3; anti-B clone number: 9621A8, SRBC-C1; anti-H clone number: H5B12; anti-AB clone number: 9113D10, 152D12; Shanghai Blood Biotechnology Co., Ltd.) to 4 test tubes, then add 1 drop of 2-5% red blood cell suspension, mix well, centrifuge at 1000g for 30s, gently shake the cell buckle, and examine under a microscope. It was found that the red blood cells had no agglutination with anti-A and anti-AB antibodies, but had suspicious weak agglutination with anti-B antibodies under the microscope, and anti-H showed strong agglutination of 4+. This indicates that the proband's red blood cells may express very weak B antigens, which requires further confirmation by absorption and emission tests.

[0079] (3) Identification of antibodies in the proband's serum by saline test tube method: Add 2 drops of the proband's serum to each of the three test tubes, and then add 1 drop of 2-5% A, B, and O anti-typing reagent red blood cell suspension (Shanghai Blood Biotechnology Co., Ltd.), mix well, centrifuge at 1000g for 30s, gently shake the cell buckle, and observe under a microscope. It was found that the serum showed a strong agglutination of 4+ with type A red blood cells, 1+ with type B red blood cells, and no agglutination with type O cells. This indicates that the proband's serum contains anti-B antibodies. To further confirm the antibodies in the serum, the B-type red blood cell test tube was placed in a 4℃ refrigerator for 15 minutes to enhance the reaction, then centrifuged at 1000g for 30s, gently shake the cell buckle, and observe under a microscope. It was found that under the reaction conditions of 4℃, the serum showed a strong agglutination of 3+ with type B anti-typing cells, thus confirming the presence of IgM anti-B antibodies in the proband's serum. (4+: red blood cells are aggregated into a large mass, and the serum is clear and transparent; 3+: red blood cells are aggregated into several small masses, and the serum is still clear; 2+: the red blood cell clots are dispersed into many small masses, and free red blood cells can be seen around them; 1+: large particles can be seen with the naked eye, and there are many free red blood cells around them; ±: several red blood cells can be seen aggregated together under the microscope, and there are many free red blood cells around them; -: no red blood cell aggregation is seen under the microscope, and the red blood cells are evenly distributed).

[0080] (4) Absorption-radiation test confirms the expression of B antigen on the red blood cell surface of the proband.

[0081] The absorption and emission test was used to further detect the expression of cell B antigen. Take 1 ml of the washed packed red blood cells of the proband and mix them with 1 ml of anti-B reagent, place them in a 37°C water bath for 30 minutes, and shake the test tube once every 5 to 10 minutes to allow them to be fully absorbed. Wash the absorbed cells 3-4 times with normal saline to remove all unbound antibodies. Add an equal amount of normal saline to the absorbed cells, place them in a 56°C water bath and shake them continuously for 6-8 minutes, take them out and centrifuge them at 56°C, 3000rpm, for 3 minutes, and absorb the supernatant as the emission fluid. Prepare a new test tube, add 2 drops of emission fluid, add 1 drop of 2-5% B-type anti-stereotyped red blood cell suspension, mix well, centrifuge at 1000×g for 15 seconds, gently shake the cell buckle, and examine under a microscope. It was found that the absorption and release results were positive, confirming that the proband's red blood cell surface expressed very weak B antigens.

[0082] Therefore, the serological results determined that the proband's red blood cell phenotype was Bel subtype, and anti-B antibodies were present in the serum.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of a substance for detecting SNP sites in the preparation of a B subtype variant blood type identification product, wherein the SNP sites are SNP sites of ABO blood type variants, including ABO Gene ABO*B.01 The mutation of c.842C>T at position 842 from the start codon in the coding region of the allele.

2. The use according to claim 1, characterized in that: The SNP site is ABO Gene ABO*B.01 The nucleotide sequence in the allele is shown in SEQ ID NO.7, in which position 476 is mutated from C to T.

3. A kit for identifying subtype B variant blood types, characterized in that: The kit comprises a substance for detecting the SNP site described in claim 1 or 2.

4. The kit according to claim 3, characterized in that The substance for detecting SNP sites includes one or more of a reagent for nucleic acid amplification, a reagent for detecting nucleic acid amplification products, a reagent for constructing a sequencing library, and a reagent for sequencing.

5. The kit according to claim 4, characterized in that The reagents for nucleic acid amplification include a first reagent and / or a second reagent; The first reagent includes a reagent for amplification ABO Amplification primers and sequencing primers for the fragment within exon 7 of the gene and the flanking sequence of exon 7; The second reagent includes a c.842C>T mutation amplification primer pair.

6. The kit according to claim 5, characterized in that In the first reagent, the amplification primer and the sequencing primer are independently selected from a primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID No. 1 and SEQ ID No. 2; and / or, The c.842C>T mutation amplification primer pair includes a c.842C>T mutation amplification primer pair whose nucleotide sequences of the forward primer and the reverse primer are respectively shown as SEQ ID No. 3 and SEQ ID No.

4.

7. The kit according to claim 5 or 6, characterized in that The reagent for nucleic acid amplification also includes a primer pair for amplifying an internal reference gene.

8. A method for identifying B subtype variant blood types, characterized in that: Including obtaining samples to be tested ABO The base type at the 842nd position from the start codon of the gene coding region, if the SNP site described in claim 1 or 2 exists, then the sample to be tested is determined to be a B subtype variant blood type.

9. The method according to claim 8, characterized in that A method comprising amplifying a sample to be tested using the first reagent described in any one of claims 5 to 7 ABO The gene fragment including the 7th exon of the gene and the flanking sequence of the 7th exon, and then the SNP site in the amplified product is detected; Or, comprising using the PCR-SSP method and the second reagent described in any one of claims 5 to 7 to amplify the c.842C>T mutation site of the sample to be tested, and if an amplification product is present, the sample to be tested is determined to be a subtype B variant blood type.

10. Use of a substance for detecting the SNP site described in claim 1 or 2, or a kit described in any one of claims 3 to 7 in the preparation of an immune hemolytic transfusion reaction identification product.

Images