Primer probe combination, kit and identification method for differential diagnosis of head and neck tumors

Abstract

The invention belongs to the technical field of in-vitro diagnosis, and particularly relates to a primer probe combination, a kit and an identification method for differential diagnosis of head and neck tumors. Methylation of a gene mir124-3 fragment specifically screened in the invention is related to occurrence of head and neck tumors, primer and probe sequences are screened for the specific gene fragment, and a kit and an identification method are further designed. The kit can be used for detecting the methylation state of the gene mir124-3 promoter region, and the methylation state of the gene mir124-3 promoter region can be used as a marker for differential diagnosis of head and neck tumors and is used for differential diagnosis of the head and neck tumors. A multiple fluorescent quantitative PCR (qPCR) detection method is adopted, the specificity and the sensitivity are high, the repeatability is good, the operation is simple, the clinical feasibility is high, and the current situation that no effective tumor marker exists in head and neck tumors can be effectively made up. The method can help clinicians to diagnose the head and neck tumors more accurately, improves the treatment effect, and provides new strategies and methods for diagnosis and treatment of the head and neck tumors.

Description

Technical Field

[0001] The present invention belongs to the technical field of in vitro diagnosis, and more specifically, the present invention relates to a primer-probe combination, a kit and an identification method for differential diagnosis of head and neck tumors. Background Art

[0002] Head and neck cancer is the seventh most common malignant tumor in the world. According to the latest statistics, there were more than 1.4 million new cases and more than 480,000 deaths in 2020. In the past decade, the incidence of root of tongue and tonsil cancer has increased due to the increase in human papillomavirus infection, changes in sexual behavior and the increase in the number of sexual partners. The main treatments for initial treatment of head and neck cancer include surgery, radiotherapy, chemotherapy and targeted therapy. Radical surgery is the cornerstone of the treatment of head and neck cancer. After surgery, radiotherapy or synchronous radiotherapy and chemotherapy are performed according to whether there are high-risk factors in the pathology. However, even after systemic treatment, 40%-60% of patients will eventually relapse and metastasize, which seriously affects the survival prognosis and quality of life of patients with head and neck cancer. At this stage, follow-up of patients with head and neck cancer mainly includes physical examination, direct or indirect endoscopic examination, primary lesion or neck imaging examination, and PET-CT examination for patients with clinically suspected tumor recurrence. There are currently no effective biomarkers for differential diagnosis and monitoring of head and neck tumors in clinical practice. There is an urgent need for efficient and simple monitoring methods to assist in the diagnosis of head and neck tumors and predict the recurrence / metastasis of head and neck tumors.

[0003] With the development of biomedicine, the importance of DNA methylation markers in cancer diagnosis, treatment selection and prognosis assessment has become increasingly prominent. DNA methylation is a covalent modification of DNA, specifically the process in which DNA methyltransferases (DNMTs) add methyl groups to the 5' carbon position of cytosine in the DNA CpG sequence to form 5-methylcytosine. Clustered CpGs are called CpG islands (CGIs), which are mainly located in the promoter and first exon regions of structural genes. DNA methylation markers are abnormal DNA methylation changes in cancer cells, and this abnormal methylation runs through the entire process of cancer occurrence and development. Compared with traditional tumor markers, DNA methylation markers have the advantages of being earlier, more non-invasive and more accurate. Therefore, DNA methylation markers can be detected in samples such as sputum, plasma, serum or urine obtained in a non-invasive manner. Some DNA methylation abnormalities occur in the initial stage of tumor formation. By detecting methylation markers related to tumor development, it can assist in the early diagnosis of cancer and assess the risk of progression. The increase or decrease of DNA methylation marker methylation level is closely related to tumor prognosis and can be used to evaluate tumor minimal residual disease (MRD) and monitor recurrence after treatment or radical surgery. In addition, DNA methylation markers can also be used as a marker of chemotherapy sensitivity. The methylation of certain specific genes may indicate the response of cancer to treatment and can be used to judge the efficacy of chemotherapy drugs to better guide treatment plans.

[0004] However, for head and neck tumors, there is currently a lack of highly sensitive and effective DNA methylation markers for convenient diagnosis, which urgently need to be developed. Summary of the invention

[0005] The technical problems to be solved by the present invention are: there is a lack of DNA methylation markers with high sensitivity and significant effects for head and neck tumors, and the identification and detection process is complicated.

[0006] The technical solution of the present invention to solve the above technical problems is: providing a primer-probe combination for differential diagnosis of head and neck tumors, wherein the primer-probe combination is designed for a specific region of the gene mir124-3, the primer sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, and the probe sequence is shown in SEQ ID NO:3.

[0007] SEQ ID NO:1 Nucleotide sequence of mir124-3-F

[0008] ATACGAGTTTAGGGGCGC.

[0009] SEQ ID NO:2 Nucleotide sequence of mir124-3-R

[0010] GAACAAACTAAATCTCCCCAACG.

[0011] SEQ ID NO:3 Nucleotide sequence of mir124-3-P

[0012] ACTCAATCTCACCACTCCGCGC.

[0013] Wherein, in the primer-probe combination for differential diagnosis of head and neck tumors, the 5' end of the mir124-3-P probe is labeled with FAM fluorescein.

[0014] Among them, in the primer-probe combination for differential diagnosis of head and neck tumors, the 3' end of the mir124-3-P probe is labeled with a fluorescent quenching group BHQ1.

[0015] Among them, in the above-mentioned primer-probe combination for differential diagnosis of head and neck tumors, the nucleotide sequence of the specific region of the gene mir124-3 is shown in SEQ ID NO:4.

[0016] SEQ ID NO:4 Nucleotide sequence of the specific region of gene mir124-3

[0017] ATACGAGTTTAGGGGCGCGGAGGGGCGGGTAGCGCGCCGGAGTGGTGAGATTGAGT CGCGATGGAACGCGTTGGGGAGATTTAGTTTGTTC.

[0018] The present invention designs a specific region of the detection gene mir124-3, wherein the specific region sequence contains multiple CpG dinucleotide structures, and the C base of the CpG dinucleotide structure is modified by a methylation group, and this methylation modification is closely related to the progression of head and neck tumors. The specific region of the specific detection gene mir124-3, the sequence of which is modified by one of bisulfite, bisulfite or trap salt is shown in SEQ ID NO:4.

[0019] Furthermore, the present invention also provides a kit for differential diagnosis of head and neck tumors, comprising the above primer-probe combination for differential diagnosis of head and neck tumors, and also comprising primers and probes of an internal reference gene ACTB.

[0020] Furthermore, the primer sequences of the internal reference gene ACTB are shown in SEQ ID NO:5 and SEQ ID NO:6, and the probe sequence is shown in SEQ ID NO:7.

[0021] SEQ ID NO:5 Nucleotide sequence of ACTB-R

[0022] GTAATGTTAGGAGTATTTTGTGGATA.

[0023] SEQ ID NO:6 Nucleotide sequence of ACTB-F

[0024] CTAACCCAAAAAAACCCAATCCTA.

[0025] SEQ ID NO:7 Nucleotide sequence of ACTB-P

[0026] AGAAGAAGGGAGGGGTGTTAGGAGAGG.

[0027] Wherein, in the above-mentioned kit for differential diagnosis of head and neck tumors, the 5' end of the ACTB-P probe is labeled with a fluorescent reporter group CY5.

[0028] Wherein, in the above-mentioned kit for differential diagnosis of head and neck tumors, the 3' end of the ACTB-P probe is labeled with a fluorescence quenching group BHQ2.

[0029] In particular, the above kit further comprises at least one of a nucleic acid extraction reagent, a nucleic acid conversion reagent PCR MIX, a positive control or a negative control.

[0030] The internal reference gene ACTB can be used to indicate the total human genome content in the sample to be tested, and can be used to monitor the extraction efficiency and quality, as well as the effectiveness of the entire detection process.

[0031] Preferably, the probe for each gene in the kit is connected to a specific fluorescent group; preferably, the probe for the human mir124-3 gene is labeled with FAM fluorescein, and the probe for the human ACTB gene is labeled with CY5 fluorescein, thereby achieving methylation detection of multiple gene regions in a single-tube reaction.

[0032] Preferably, the kit also includes a fully methylated positive control and an unmethylated negative control to monitor the effectiveness of the entire methylation status detection.

[0033] The present invention also provides a method for detecting methylation of the gene mir124-3 in vitro, comprising the following steps:

[0034] a. Nucleic acid extraction: extract DNA from peripheral plasma or tissue;

[0035] b. Nucleic acid conversion: treating the DNA in step a with one of bisulfite, bisulfite or trap salt and purifying it to obtain a modified DNA sample to be tested;

[0036] c. Target amplification: Multiplex fluorescence quantitative PCR amplification using a kit for differential diagnosis of head and neck tumors;

[0037] d. Interpretation of results: FAM and CY5 signal channels were tested simultaneously, and the number of cycles required to reach the set threshold was read as the Ct value as the judgment standard; if the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid; under the premise of validity, the CT value of the FAM signal channel is less than 45, and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

[0038] The beneficial effects of the present invention are:

[0039] The present invention is designed for a specific region of mir124-3, and a primer probe combination and a kit that can be used for differential diagnosis of head and neck tumors are screened and obtained, and a method for detecting methylation of gene mir124-3 in vitro is provided. The primer probe combination and the kit of the present invention have high detection sensitivity, and can be used to detect the methylation status of multiple CpGs in at least one region in the specific region of gene mir124-3, and realize the detection of head and neck tumors with high characteristics and sensitivity in plasma samples, and can significantly distinguish cancerous tissues from normal tissues (paracancerous tissues) in tissue samples. The identification method of the present invention is simple and efficient, and provides a new method for the identification of head and neck tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Shown is a comparison of promoter methylation groups of the gene mir124-3 in head and neck tumor samples of different stages.

[0041] Figure 2 Shown is the ROC curve for the diagnosis of head and neck cancer blood samples.

[0042] Figure 3 Shown is the ROC curve for staging diagnosis of head and neck cancer blood samples. DETAILED DESCRIPTION

[0043] The present invention provides a primer-probe combination for differential diagnosis of head and neck tumors. The primer-probe combination is designed for a specific region of gene mir124-3. The primer sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, and the probe sequence is shown in SEQ ID NO:3.

[0044] Furthermore, the present invention also provides a kit for differential diagnosis of head and neck tumors, comprising the above primer-probe combination for differential diagnosis of head and neck tumors, and also comprising primers and probes for an internal reference gene ACTB. The primer sequences for the internal reference gene ACTB are shown in SEQ ID NO:5 and SEQ ID NO:6, and the probe sequence is shown in SEQ ID NO:7.

[0045] The present invention discovers for the first time that the methylation level of a specific region of the gene mir124-3 can be used as a marker to indicate head and neck tumors, and can quickly and efficiently predict head and neck tumors.

[0046] The present invention specifically selects a specific region of the gene mir124-3 and modifies the region to obtain a target gene sequence as shown in SEQ ID NO: 4. The present invention screens the methylation state of the CpG site through a large amount of data comparison to obtain a specific nucleotide sequence containing multiple CpG dinucleotide structures, and the C base of the CpG dinucleotide structure is modified by a methylated group. And for this sequence, after modification with at least one of bisulfite, bisulfite or trap salt, the target gene sequence SEQ ID NO: 4 for designing a primer probe is finally obtained.

[0047] Furthermore, when designing primers and probe sequences for the target gene of the above-mentioned specific sequence, the present invention also takes into account multiple factors such as the length of the amplified fragment, the length of the primer, the primer TM, the maximum number of consecutive single nucleotides allowed in the primer sequence (except "T"), the minimum number of non-CpG "C" in the primer, the maximum number of consecutive "T" (or "A" in the reverse primer) allowed in the primer sequence, the number of C+G at the 3' end, the minimum number of CpG sites in the primer, the maximum Tm value difference between the primer pairs (methylated primers and unmethylated primers), the probe Tm value, etc. With comprehensive consideration of such multiple factors, the aforementioned primer pairs and probe sequences are finally obtained, and the primers and probes have the optimal amplification length and the best amplification effect, which can quickly predict the occurrence of head and neck tumors.

[0048] The specific implementation modes of the present invention will be further explained below through examples, but it is not intended to limit the protection scope of the present invention to the scope of the examples.

[0049] Example 1 Screening of target genes and design of primer and probe sequences

[0050] The following steps are involved:

[0051] (1) The 450K methylation chip data of head and neck squamous cell carcinoma were downloaded from the online database Xena browser (https: / / xenabrowser.net / ). A total of 580 sample data were collected, including 530 tumor samples and 50 normal samples. The data used β-values ​​to display the methylation status of specific CpG sites, with the β-value range from 0 (non-methylated) to 1 (fully methylated).

[0052] (2) Identification of differentially methylated CpG sites. The Wilcoxon Rank Sum Test was performed on the original data of tumor samples and normal samples. P < 0.01. In normal samples, the upper quartile of β-values ​​was < 0.2, while in tumor samples, the lower quartile of β-values ​​was > 0.3.

[0053] (3) The CpG sites obtained by screening were mapped to genes to obtain suitable genes with continuous CpG sites and a coverage range greater than or equal to 200 bp. After screening and comparison, cg15699267 (chr20: 61809557) - cg15028514 (chr20: 61809841) of the gene mir124-3 met the above screening conditions, and the total length of the region was 284 bp.

[0054] (4) Modifying a specific region of the above gene to obtain a modified gene sequence shown in SEQ ID NO: 4, wherein the region of SEQ ID NO: 4 is: chr20: 61809744-61809834.

[0055] (5) Design primer probes for the gene sequence of SEQ ID NO: 4. Design parameters are: Since plasma free DNA detection is required, the length of cfDNA is ~180bp, and it will be treated with bisulfite during the detection process, resulting in cfDNA breakage. Therefore, the designed primer amplification fragment should be as short as possible to improve the detection efficiency in the blood. The amplified fragment length is 80-120bp. Primer length: 18-30bp, 20bp is optimal. GC%: 30-80, 50 is optimal. Primer TM: 50-60 degrees, 58 degrees is optimal. The maximum number of consecutive single nucleotides allowed in the primer sequence (except "T"): 5. The minimum number of non-CpG "C" in the primer: 4. The maximum number of consecutive "T" (or "A" in the reverse primer) allowed in the primer sequence: 8. The number of C+G at the 3' end: 2. The minimum number of CpG sites in the primer: 1. Maximum Tm difference between primer pairs (methylated and unmethylated primers): 3 degrees. Probe Tm value: 10 degrees higher than primers.

[0056] (7) After screening and comparison, the primer sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the probe sequence is shown in SEQ ID NO: 3.

[0057] Example 2: Using the above primer probe to detect the sample to be tested

[0058] The following steps are involved:

[0059] 1. Extraction of plasma cfDNA:

[0060] (1) Transfer 200 μl of proteinase K to a 15 ml centrifuge tube;

[0061] (2) Transfer 2 ml of plasma sample to a centrifuge tube containing proteinase K and shake gently to mix;

[0062] (3) Add 1.6 ml of buffer ACL (containing 1 μg of carrier RNA) to the sample and vortex for 15 seconds. Incubate in a 60°C water bath for 30 minutes, occasionally inverting several times to mix;

[0063] (4) Add 3.6 ml of buffer ACB to the sample. Vortex to mix for 15 seconds. Place on ice for 5 minutes. (You can place it in a -20°C refrigerator for 10 minutes or a 4°C refrigerator for 20-30 minutes).

[0064] (5) Assemble the centrifuge device and place it in a 50 ml collection tube;

[0065] (6) Pour the buffer ACB and sample mixture from step 4 into a centrifuge and centrifuge at 2000 x g for 5 minutes;

[0066] (7) Open the lid of the centrifuge tube, remove the recovery column, and discard the centrifuge device and the 50 ml centrifuge tube;

[0067] (8) Place the recovery column in step 7 into a 2 ml collection tube. Add 600 μl of Wash Buffer I to the recovery column. Centrifuge at 13,000 x g for 30 seconds.

[0068] (9) Discard the filtrate and put the recovery column back into the collection tube. Add 600 μl of Wash Buffer II to the column. Centrifuge at 13,000 x g for 30 seconds;

[0069] (10) Discard the filtrate and put the recovery column back into the collection tube. Add 600 μl of anhydrous ethanol to the column. Centrifuge at 13,000 x g for 30 seconds;

[0070] (11) Discard the filtrate and put the recovery column back into a new collection tube. Centrifuge at 13,000 x g for 2 minutes;

[0071] (12) Take out the recovery column, put it in a 1.5 ml centrifuge tube, open the lid of the column and dry it for 10 minutes;

[0072] (13) Add 53 μl of enzyme-free water to the recovery column. Allow to stand for 3 minutes. Centrifuge at ≥13,000 × g for 1 minute.

[0073] (14) The cfDNA recovered by centrifugation is immediately subjected to subsequent sulfite conversion.

[0074] 2. Sulfite conversion of cfDNA

[0075] (1) Add 100 μl of pre-prepared sulfite solution to each sample (50 μl), vortex gently to mix and centrifuge;

[0076] (2) Place in PCR instrument and run the program as shown in Table 1:

[0077] Table 1: Sulfite conversion procedure

[0078] step temperature time 1 98℃ 10 minutes 2 64℃ 2.5 hours 3 4℃ No more than 20 hours

[0079] (3) Prepare a purification column for each sample, add 600 μl of M binding buffer to each purification column, and place it in a collection tube;

[0080] (4) After the transformation process is completed, remove the reaction tube from the PCR instrument, centrifuge it briefly, and then transfer 150ul of the transformation mixture in the reaction tube to the device in step 3 and mix it upside down;

[0081] (5) Cover the tube and centrifuge at 10,000 x g for 30 seconds;

[0082] (6) Discard the filtrate, put the purification column back into the collection tube, add 100 μl of M wash buffer, and centrifuge at 13,000 x g for 30 seconds;

[0083] (7) Add 200 μl of M de-etiolation buffer to the column, incubate at room temperature for 15-20 min, and centrifuge at 13,000 × g for 30 s;

[0084] (8) Add 200 μl of M wash buffer to the column and centrifuge at 13,000 x g for 30 seconds.

[0085] (9) Repeat step (8) once, discard the filtrate, put the purification column back into the collection tube, and centrifuge at 14000xg for 2 minutes;

[0086] (10) Take out the purification column, put it into a 1.5 ml centrifuge tube, leave it at room temperature for 3 minutes with the lid open, add 23 μl of eluent, leave it at room temperature for 3 minutes, and centrifuge at 14000 x g for 1 minute;

[0087] (11) The converted cfDNA is recovered by centrifugation and immediately subjected to subsequent PCR testing.

[0088] 3. Methylation-specific fluorescence quantitative PCR detection

[0089] The above-mentioned cfDNA purified after sulfite sulfation was used as a template for methylation-specific fluorescent quantitative PCR, and the primers and probes of the gene mir124-3 and the internal reference gene ACTB were placed in the same tube for fluorescent quantitative PCR amplification reaction (instrument: ABI7500). The reaction system is shown in Table 2, and the reaction conditions are shown in Table 3.

[0090] Table 2: Methylation-specific fluorescence quantitative PCR reaction system:

[0091] Reagent component name Dosage 2XPCRMIX 12.5ul mir124-3-F(10uM) 0.5ul mir124-3-R(10uM) 0.5ul mir124-3-P(5uM) 0.25ul ACTB-F(10uM) 0.5ul ACTB-R(10uM) 0.5ul ACTB-P(5uM) 0.25ul Converted cfDNA 10ul Total volume 25ul

[0092] Table 3: Methylation-specific fluorescence quantitative PCR reaction conditions:

[0093]

[0094] 4. Interpretation of results

[0095] The FAM and CY5 signal channels are detected at the same time, and the Ct value of the number of cycles required to reach the set threshold is used as the judgment standard. If the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid. Under the premise of validity, the CT value of the FAM signal channel is less than 45, and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

[0096] Example 3: Detection of head and neck tumor samples (plasma samples) using the composition of the present invention

[0097] 161 clinical plasma samples of head and neck tumors were tested, including 41 plasma samples of head and neck tumor patients before treatment in stage I, 20 in stage II, 42 in stage III, and 58 in stage IV; 89 plasma samples of healthy people were taken as controls, extracted, transformed, and tested according to the method of Example 2, and the positive and negative results were judged according to the result interpretation criteria of Example 2. The test results were grouped and compared, and the results were as follows: Figure 1-3 As shown in Tables 4 and 5, mir124-3 methylation was significantly different in blood samples of patients with head and neck cancer compared with healthy control samples.

[0098] Figure 1 The results show that the methylation of the promoter of gene mir124-3 was compared among the head and neck tumor samples of different stages. It can be seen that the methylation of the promoter region of gene mir124-3 is a specific biomarker for head and neck tumors, p<0.001.

[0099] Table 4 shows that the overall detection sensitivity for preoperative plasma samples of patients with head and neck tumors is 78.261%, the specificity is 88.764%, the area under the curve is 0.909, and the cutoff is 8.251. This shows that mir124-3 gene methylation and the detection methodology used in the present invention can effectively detect blood samples of head and neck tumors, and methylation of the promoter region of gene mir124-3 is an effective marker for differential diagnosis of head and neck tumors.

[0100] Table 4

[0101] Group I Group II Adjusted P value Normal(n=89) HS(I,n=41) 1.79e-05 Normal(n=89) HS(I,n=20) 6.59e-05 Normal(n=89) HS(I,n=42) 1.03e-14 Normal(n=89) HS(I,n=58) 4.31e-26

[0102] Figure 2 Shown is the ROC curve for the diagnosis of head and neck cancer blood samples.

[0103] The ROC curve is a curve that reflects the relationship between the sensitivity and specificity of a diagnostic method. The horizontal axis X-axis is 1-specificity, also known as the false positive rate. The closer the X-axis is to zero, the higher the accuracy. The vertical axis Y-axis is called sensitivity, also known as the true positive rate (sensitivity). The larger the Y-axis is, the better the accuracy.

[0104] The area under the ROC curve (AUC) is often used to evaluate diagnostic tests. The AUC value range is generally between 0.5 and 1. The closer the AUC is to 1, the better the diagnostic effect of the variable in predicting the outcome.

[0105] The results showed that the methylation of the screened Mir124-3 gene was a good diagnostic marker for head and neck tumors. AUC: 0.909, indicating that the site screened by the present invention and the established detection method system have high accuracy in the differential diagnosis of head and neck tumors.

[0106] Figure 3 The ROC curve of head and neck tumor blood sample staging diagnosis is shown. According to the staging of head and neck tumors, the later the patient is, the higher the detection sensitivity.

[0107] The ROC curve is a curve that reflects the relationship between the sensitivity and specificity of a diagnostic method. The horizontal axis X-axis is 1-specificity, also known as the false positive rate. The closer the X-axis is to zero, the higher the accuracy. The vertical axis Y-axis is called sensitivity, also known as the true positive rate (sensitivity). The larger the Y-axis is, the better the accuracy.

[0108] The area under the ROC curve (AUC) is often used to evaluate diagnostic tests. The AUC value range is generally between 0.5 and 1. The closer the AUC is to 1, the better the diagnostic effect of the variable in predicting the outcome.

[0109] The results showed that the methylation of the screened Mir124-3 gene was a good diagnostic marker for head and neck tumors. In different stages: stage I: AUC: 0.833, stage II: AUC: 0.890, stage III: AUC: 0.941, stage IV: AUC: 0.952. This shows that the sites screened by the present invention and the established detection method system still have high sensitivity and specificity in head and neck tumor samples of different stages.

[0110] Table 5

[0111]

[0112] Under the condition of fixed specificity (88.76%), the detection sensitivity of the method used in the present invention in patients with head and neck tumors of different stages (I-IV) is ≥75% in patients II-IV. The mir124-3 methylation marker screened by the present invention and the method developed can be used for the differential diagnosis of head and neck tumors, filling the gap of no conventional diagnostic markers for head and neck tumors.

Claims

1. A primer-probe combination for differential diagnosis of head and neck tumors, characterized in that: The primer-probe combination is designed for a specific region of the gene mir124-3, the primer sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, and the probe sequence is shown in SEQ ID NO:

3.

2. The primer-probe combination for differential diagnosis of head and neck tumors according to claim 1, characterized in that: The 5' end of the mir124-3-P probe is labeled with FAM fluorescein.

3. The primer-probe combination for differential diagnosis of head and neck tumors according to claim 1, characterized in that: The 3' end of the mir124-3-P probe is labeled with a fluorescence quenching group BHQ1.

4. The primer-probe combination for differential diagnosis of head and neck tumors according to claim 1, characterized in that: The nucleotide sequence of the specific region of the gene mir124-3 is shown in SEQ ID NO:

4.

5. A kit for differential diagnosis of head and neck tumors, characterized in that: The invention comprises the primer-probe combination for differential diagnosis of head and neck tumors according to any one of claims 1 to 4, and also comprises primers and probes of the internal reference gene ACTB.

6. The kit for differential diagnosis of head and neck tumors according to claim 5, characterized in that: The primer sequences of the internal reference gene ACTB are shown in SEQ ID NO:5 and SEQ ID NO:6, and the probe sequence is shown in SEQ ID NO:

7.

7. The kit for differential diagnosis of head and neck tumors according to claim 5, characterized in that: The 5' end of the ACTB-P probe is labeled with a fluorescent reporter group CY5.

8. The kit for differential diagnosis of head and neck tumors according to claim 5, characterized in that: The 3' end of the ACTB-P probe is labeled with a fluorescence quenching group BHQ2.

9. The kit for differential diagnosis of head and neck tumors according to claim 5, characterized in that: It also includes at least one of a nucleic acid extraction reagent, a nucleic acid conversion reagent PCR MIX, a positive control or a negative control.

10. A method for detecting methylation of the gene mir124-3 in vitro, characterized in that: The following steps are involved: a. Nucleic acid extraction: extract DNA from peripheral plasma or tissue; b. Nucleic acid conversion: treating the DNA in step a with one of bisulfite, bisulfite or trap salt and purifying it to obtain a modified DNA sample to be tested; c. Target amplification: performing multiplex fluorescence quantitative PCR amplification using the kit described in any one of claims 5 to 9; d. Interpretation of results: FAM and CY5 signal channels were tested simultaneously, and the number of cycles required to reach the set threshold was read as the Ct value as the judgment standard; if the CT value of the CY5 signal channel of the sample to be tested is less than 31, the sample to be tested is valid; under the premise of validity, the CT value of the FAM signal channel is less than 45, and there is a typical S-shaped amplification curve, the sample to be tested is judged as positive, and the CT value is equal to 45 or no value, the sample to be tested can be judged as negative.

Images