RPA-PfAgo detection system for detecting mutton and application of RPA-PfAgo detection system

Abstract

The invention provides an RPA-PfAgo detection system for detecting mutton and application of the RPA-PfAgo detection system, and belongs to the technical field of food detection. The RPA-PfAgo detection system disclosed by the invention comprises an RPA specific primer pair, gDNA7-1 and gDNA7-2 sequences of a PfAgo protein and a probe, wherein the RPA specific primer pair is designed aiming at a mutton gene. According to the invention, the high efficiency and specificity of RPA are utilized, and Argonaute protein from extreme thermophilic archaea is combined, so that the detection capability is enhanced. And by optimizing an RPA-PfAgo detection system, the specificity and the sensitivity of mutton recognition are enhanced. By detecting meat products and artificially adulterated meat samples in a supermarket, the universal applicability of the system is tested. A practical solution is provided for rapid on-site detection, and verification of accurate identification of mutton in commercial and supervision environments is enhanced.

Description

Technical Field

[0001] The present invention belongs to the technical field of food detection, and in particular relates to an RPA-PfAgo detection system for detecting mutton and an application thereof. Background Art

[0002] As an important meat consumer product, lamb is deeply loved by consumers and its market demand continues to grow. Therefore, accurate identification of meat species is essential to protect consumer interests and comply with legal standards.

[0003] In recent years, progress in meat identification has evolved from morphological and protein-based detection methods to complex nucleic acid detection methods. In 2013, the European Union required member states to conduct DNA testing on meat products. Currently, standard methods for meat species identification generally rely on PCR, as well as DNA barcoding, droplet digital PCR (ddPCR), electronic nose and electronic tongue technology, enzyme-linked immunosorbent assay (ELISA), and spectral analysis. DNA barcoding provides high accuracy and sensitivity, but is less effective in detecting adulteration with closely related species. Although ddPCR provides absolute quantification, its high equipment and operating requirements limit rapid deployment. Electronic nose technology can provide results quickly, but its high cost and environmental sensitivity limit its widespread use. ELISA has high sensitivity and specificity, but the availability of specific antibodies is limited, and matrix effects may interfere with the results. Although detailed, spectroscopic methods are time-consuming and costly, and have strict equipment specifications, making them unsuitable for large-scale rapid field testing. These methods require a high level of operator expertise and complex equipment, which poses challenges for immediate field analysis. Therefore, there is an urgent need to develop fast, simple, and cost-effective meat identification methods. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide an RPA-PfAgo detection system for detecting mutton and its application. The present invention utilizes the high efficiency and specificity of RPA, combined with Argonaute protein from extremely thermophilic archaea, to achieve accurate identification of mutton.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an RPA-PfAgo detection system for detecting mutton, wherein the RPA-PfAgo detection system comprises an RPA specific primer pair designed for mutton genes, gDNA7-1 and gDNA7-2 sequences of PfAgo proteins, and a probe;

[0007] The RPA specific primer pair is SEQ ID NO.1 and SEQ ID NO.6, SEQ ID NO.2 and SEQ ID NO.5, or SEQ ID NO.2 and SEQ ID NO.6;

[0008] The gDNA7-1 sequence is shown in SEQ ID NO.9;

[0009] The gDNA7-2 sequence is shown in SEQ ID NO.10;

[0010] The sequence of the probe is shown in SEQ ID NO.11.

[0011] Preferably, the probe is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.

[0012] The present invention provides the use of the RPA-PfAgo detection system in detecting mutton, wherein the detection is the appearance of fluorescence indicating that the detected meat contains mutton.

[0013] The present invention also provides a kit for detecting mutton, comprising the RPA-PfAgo detection system, buffer, magnesium acetate, PfAgo enzyme, MnCl2, buffer, and water.

[0014] Preferably, the method for using the kit comprises the following steps:

[0015] (1) Extracting sample DNA;

[0016] (2) Amplifying the extracted sample DNA using RPA-specific primers to obtain RPA products;

[0017] (3) The RPA product obtained in step (2), the gDNA7-1 sequence, the gDNA7-2 sequence, the probe, the PfAgo enzyme, MnCl2, the buffer and water are mixed and subjected to a PfAgo enzyme digestion reaction. Fluorescence appears, indicating that the sample contains mutton.

[0018] Preferably, the amplification system in step (2) is calculated as 50 μL and includes 29.5 μL buffer, 2 μL each of the upstream and downstream primers of the RPA-specific primer pair with an initial concentration of 10 μM, 2 μL sample DNA, 1 to 3 μL of magnesium acetate with an initial concentration of 280 mM, and water to make up to 50 μL.

[0019] Preferably, the amplification temperature is 35-50° C., and the amplification time is 10-40 min.

[0020] Preferably, in step (3), the PfAgo enzyme digestion reaction system is 25 μL, the amount of the RPA product used is 1 to 10 μL; the concentration of the gDNA7-1 is 1 to 100 μM; the concentration of the gDNA7-2 is 1 to 100 μM; the concentration of the probe is 1 to 100 μM; the amount of MnCl2 used is 1 to 6 μL; and the amount of PfAgo enzyme used is 1 to 6 μL.

[0021] Preferably, the temperature of the PfAgo enzyme cleavage reaction is 90-100° C., and the time of the PfAgo enzyme cleavage reaction is 25-35 min.

[0022] Preferably, the excitation wavelength of the fluorescence is 470 nm or 525 nm.

[0023] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an RPA-PfAgo detection system for detecting mutton and its application. The present invention utilizes the high efficiency and specificity of RPA and combines the Argonaute protein (PfAgo) from the extremely thermophilic archaeon (Pyrococcus furiosus) to enhance the detection capability. The present invention enhances the specificity and sensitivity of mutton identification by optimizing the RPA-PfAgo detection system. The universal applicability of the system was tested by analyzing commercial meat products and artificially adulterated meat samples in supermarkets. It provides a practical solution for rapid on-site detection and enhances the verification of accurate identification of mutton in commercial and regulatory environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Design a flow chart for the RPA-PfAgo detection platform;

[0025] Figure 2 Results of RPA primer screening;

[0026] Figure 3 Gel electrophoresis analysis for RPA parameter optimization;

[0027] Figure 4 This is the gDNA screening result, which from top to bottom are MgAc, RPA reaction temperature and reaction time;

[0028] Figure 5 The multi-parameter optimization results of the RPA-PfAgo recognition platform, which are gDNA, MnCl2, probe, PfAgo and RPA product from top to bottom;

[0029] Figure 6Performance analysis of the RPA-PfAgo detection platform on lamb, where from top to bottom are repeatability (top 3), specificity, and sensitivity, the primary vertical axis (scale of 4) is for targeted meat, the secondary axis (scale of 0.01) is for non-targeted meat and negative controls (NCs), and sensitivity highlights the maximum fluorescence intensity (MFI) at each concentration;

[0030] Figure 7 The results of applying the RPA-PfAgo system to meat product recognition. DETAILED DESCRIPTION

[0031] The present invention provides an RPA-PfAgo detection system for detecting mutton, wherein the RPA-PfAgo detection system comprises an RPA specific primer pair designed for mutton genes, gDNA7-1 and gDNA7-2 sequences of PfAgo proteins, and a probe;

[0032] The RPA specific primer pair is SEQ ID NO.1 and SEQ ID NO.6, SEQ ID NO.2 and SEQ ID NO.5 or SEQ ID NO.2 and SEQ ID NO.6, specifically as follows:

[0033] SEQ ID NO.1: ACTATCAACACCCAAAGCTGAAGTTCTAC;

[0034] SEQ ID NO.6: TATGTTGGGTTTATGAACGCTCATGTCCGT;

[0035] SEQ ID NO.2: ACCAACCTCCCTAAGACTCAAGGAAGAAG;

[0036] SEQ ID NO.5:TTGTGCTTTTCTTGTATGGGTTGTTATGT;

[0037] The gDNA7-1 sequence is shown in SEQ ID NO.9, and is specifically as follows:

[0038] SEQ ID NO.9: TTGGGAGTTTTAGCAA;

[0039] The gDNA7-2 sequence is shown in SEQ ID NO.10, and is specifically as follows:

[0040] SEQ ID NO.10: TGTCCGTGTTGTATGT;

[0041] The sequence of the probe is shown in SEQ ID NO.11, and is as follows:

[0042] SEQ ID NO. 11: GTCCTGTTGTATGTTTGGGAGTTTTAGC.

[0043] In the present invention, the probe is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.

[0044] The present invention provides the use of the RPA-PfAgo detection system in detecting mutton, wherein the detection is that the appearance of fluorescence indicates that the detected meat contains mutton.

[0045] The present invention also provides a kit for detecting mutton, comprising the RPA-PfAgo detection system, buffer, magnesium acetate, PfAgo enzyme, MnCl2, buffer, and water.

[0046] In the present invention, the concentration of the RPA-PfAgo detection system is 10 μM for the RPA specific primer pair, 10 μM for the gDNA7-1 and gDNA7-2 sequences of the PfAgo protein, and 10 μM for the probe; the buffer is The Abuffer buffer in the Basic kit has a magnesium acetate concentration of 280 mM, a PfAgo enzyme concentration of 200 U / μL, a MnCl2 concentration of 40 mM, and a 10×Buffer.

[0047] In the present invention, the method for using the kit comprises the following steps:

[0048] (1) Extracting sample DNA;

[0049] (2) Amplifying the extracted sample DNA using RPA-specific primers to obtain RPA products;

[0050] (3) The RPA product obtained in step (2), the gDNA7-1 sequence, the gDNA7-2 sequence, the probe, the PfAgo enzyme, MnCl2, the buffer and water are mixed and subjected to a PfAgo enzyme digestion reaction. Fluorescence appears, indicating that the sample contains mutton.

[0051] In the present invention, sample DNA is extracted by taking commercially available meat as a sample, taking 25 mg of the sample, and extracting sample DNA according to the steps in the instruction manual of the Ezup column animal genomic DNA extraction kit.

[0052] In the present invention, the extracted sample DNA is amplified using an RPA specific primer pair to obtain an RPA product. The buffer, the RPA specific primer pair, the sample DNA, magnesium acetate and water are mixed and centrifuged to obtain a mixture, and the mixture is amplified in a PCR thermal cycler or an isothermal heating device to obtain an RPA product. The buffer is The Abuffer buffer in the Basic kit, the amplification system, in 50 μL, includes 29.5 μL of buffer, 2 μL of each of the upstream and downstream primers of the RPA specific primer pair with an initial concentration of 10 μM, 2 μL of sample DNA, 1 to 3 μL of magnesium acetate with an initial concentration of 280 mM, and water to 50 μL, wherein the amount of magnesium acetate is preferably 1.5 to 2.8 μL, and more preferably 2 μL; the amplification temperature is 35 to 50°C, preferably 37 to 48°C, and more preferably 45°C; the amplification time is 10 to 40 min, preferably 15 to 30 min, and more preferably 25 min.

[0053] In the present invention, the RPA product obtained in step (2), the gDNA7-1 sequence, the gDNA7-2 sequence, the probe, the PfAgo enzyme, MnCl2, the Buffer and water are mixed, and a PfAgo enzyme digestion reaction is performed, and fluorescence appears, indicating that the sample contains mutton. The PfAgo enzyme digestion reaction system is based on 25 μL, the initial concentration of the RPA product is 3 ng / μL, the amount of the RPA product used is 1 to 10 μL, preferably 2 to 5 μL, and more preferably 5 μL; the initial concentration of the gDNA7-1 is 1 to 100 μM, preferably 5 to 80 μM, and more preferably 10 μM, and the amount of gDNA7-1 used is 2 μL; the initial concentration of the gDNA7-2 is 1 to 100 μM, preferably 5 to 80 μM, and more preferably 10 μ M, the usage amount of gDNA7-2 is 2 μL; the concentration of the probe is 1-100 μM, preferably 5-80 μM, and more preferably 10 μM, and the usage amount of the probe is 1 μL; the initial concentration of MnCl2 is 40 mM, and the usage amount of MnCl2 is 1-6 μL, preferably 2-5.5 μL, and more preferably 5 μL; the initial concentration of PfAgo enzyme is 200 U / μL, and the usage amount of PfAgo enzyme is 1-6 μL, preferably 2-5.5 μL, and more preferably 5 μL.

[0054] In the present invention, the temperature of the PfAgo enzyme cleavage reaction is 90-100°C, preferably 93-97°C, and more preferably 95°C; the time of the PfAgo enzyme cleavage reaction is 25-35min, preferably 28-32min, and more preferably 30min; the excitation wavelength of the fluorescence is 470nm or 525nm.

[0055] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] Design of RPA primers, gDNA, and meat probes

[0058] The mitochondrial genome sequence of the sheep species used in the present invention was obtained from the National Center for Biotechnology Information (NCBI, https: / / www.ncbi.nlm.nih.gov): sheep (NC_001941.1). The conserved sequence downloaded from NCBI was synthesized into a plasmid by GENEWIZ (Suzhou, Jiangsu, China). Three sets of RPA primers were designed for lamb-specific conserved sequences according to the design principles listed in the DNA amplification kit instructions (TwistDx, Cambridge, UK). The specificity of the designed primers was verified by the Primer-BLAST tool of NCBI. Guide DNA (gDNA) was designed based on the cleavage characteristics of PfAgo protein, including sequences complementary to the RPA primers. Two gDNA sequences and their corresponding probes were designed, and the probes were labeled with 6-carboxyfluorescein (FAM) or 6-carboxy-X-rhodamine (ROX), and the 5' end of the gDNA was phosphorylated (see Table 1). The designed primers, gDNA, and probes were synthesized by GENEWIZ (Suzhou, Jiangsu, China).

[0059] Table 1 Detailed information of designed RPA primers, gDNA sequences and probes

[0060]

[0061] The RPA-PfAgo detection platform is based on specific design principles for meat species identification ( Figure 1). Initially, the length of the guide DNA (gDNA) was designed considering the nuclease activity of the PfAgo protein, which relies on its interaction with a specific gDNA sequence. Guide sequences shorter than 15 nucleotides (nt) generally lack the binding stability required for efficient target chain cleavage, while longer gDNAs may reduce cleavage efficiency due to steric hindrance. Therefore, a 16nt gDNA was selected to balance binding affinity and cleavage efficiency. To improve the detection sensitivity, RPA technology was used, which rapidly performs DNA amplification at ambient temperature, eliminating the need for thermal cycling inherent in traditional PCR methods. RPA utilizes a specific primer and enzyme mixture to promote DNA amplification in a short period of time, providing sufficient substrate for PfAgo-mediated cleavage. When selecting the target sequence for the PfAgo protein, the complementarity between the gDNA and the target DNA region was taken into consideration. The target sequence was carefully screened and verified to ensure that the PfAgo protein can effectively recognize and cleave the DNA sequence of a specific species, thereby improving the specificity of the detection.

[0062] Example 2

[0063] RPA Condition Optimization for Meat Inspection

[0064] Template DNA: The conserved sequence of sheep from the NCBI database was synthesized by GENEWIZ (Suzhou, Jiangsu, China) as a plasmid containing the conserved sequence of sheep from the NCBI database and used in subsequent experiments.

[0065] RPA amplification reaction: use RPA amplification was performed using the TwistDx Basic kit (TwistDx, Cambridge, UK). 29.5 μL of buffer A, 2 μL of forward primer and 2 μL of reverse primer, 2 μL of template DNA, and 2.5 μL of magnesium acetate (MgAc, 280 mM) were made up to a final volume of 50 μL with ddH2O. After mixing, centrifugation was performed and the mixture was incubated at 39°C for 30 min in a PCR thermal cycler or isothermal heating device. RPA products were analyzed by agarose gel electrophoresis. ddH2O was used as a negative control for the template.

[0066] 1. Optimization of primers in RPA amplification reaction

[0067] The primer combinations in Table 1 were evaluated. When other conditions of the RPA amplification reaction remained unchanged, only the primer pairs were changed for RPA amplification experiments. Quantitative gel analysis was performed using ImageJ software to select the three most effective primer pairs for mutton under standardized conditions based on band brightness and clarity. The results are shown in the figure. Figure 2 shown.

[0068] Depend on Figure 2It can be seen that the amplification products of the primer pairs F1R3, F2R2 and F2R3 are obvious and bright, indicating that the primer pairs F1R3, F2R2 and F2R3 are the best primer pairs.

[0069] 2. Optimization of the volume of magnesium acetate in RPA amplification reaction

[0070] The F2R3 primer pair was used as the forward primer and reverse primer in the RPA amplification reaction. In the amplification reaction, only the added volume of magnesium acetate was changed, and other parameters remained unchanged. The RPA amplification experiment was performed, wherein the added volumes of magnesium acetate were 2.0 μL, 2.3 μL, 2.5 μL, 2.8 μL, and 3.0 μL, respectively. Quantitative gel analysis was performed using ImageJ software to select the optimal volume of magnesium acetate under standardized conditions based on band brightness and clarity. The results are shown in FIG. Figure 3 shown.

[0071] Depend on Figure 3 It can be seen that when the added volume of magnesium acetate is 2.0 μL, the amplified band is the clearest and most obvious, indicating that the optimal added volume of magnesium acetate is 2.0 μL.

[0072] 3. Optimization of amplification reaction temperature in RPA amplification reaction

[0073] The F2R3 primer pair was used as the forward primer and reverse primer in the RPA amplification reaction. The added volume of magnesium acetate was 2.0 μL. The amplification reaction temperature was changed, and other parameters remained unchanged. The RPA amplification experiment was performed. The amplification reaction temperatures were 35°C, 37°C, 39°C, 42°C and 45°C, respectively. Quantitative gel analysis was performed using ImageJ software to select the optimal amplification reaction temperature under standardized conditions based on band brightness and clarity. The results are shown in Figure 2. Figure 3 shown.

[0074] Depend on Figure 3 It can be seen that when the amplification reaction temperature is 45°C, the amplification band is the clearest and most obvious, indicating that the optimal reaction temperature for amplification is 45°C.

[0075] 4. Optimization of amplification reaction time in RPA amplification reaction

[0076] The F2R3 primer pair was used as the forward primer and reverse primer in the RPA amplification reaction. The added volume of magnesium acetate was 2.0 μL, the temperature of the amplification reaction was 45°C, the amplification reaction time was changed, and other parameters remained unchanged. The RPA amplification experiment was performed, wherein the amplification reaction time was 10 min, 15 min, 20 min, 25 min, and 30 min, respectively. Quantitative gel analysis was performed using ImageJ software to select the optimal amplification reaction time under standardized conditions based on band brightness and clarity. The results are shown in FIG. Figure 3shown.

[0077] Depend on Figure 3 It can be seen that when the amplification reaction time is 25 minutes, the amplification band is the clearest and most obvious, indicating that the optimal reaction time for amplification is 25 minutes.

[0078] Example 3

[0079] Parameter optimization in the RPA-PfAgo detection system

[0080] PfAgo digestion reaction: The most suitable amplification reaction conditions in Example 2 were used to obtain RPA amplification products. Take 4 μL of RPA amplification product and 2 μL of gDNA7-1 (10 μM), 2 μL of gDNA7-2 (10 μM), 1 μL of probe (MB, 10 μM), 2 μL of PfAgo enzyme (200 U / μL), 4 μL of MnCl2 (40 mM), 3 μL of 10× Buffer, and use ddH2O to make up to a final volume of 25 μL. PfAgo digestion experiment was performed by The reaction was carried out at 95°C for 30 min using a 965 system (Hongshi, Shanghai, China), and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) using a GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). ddH2O was used as a negative control for the template.

[0081] 1. Optimization of gDNA in PfAgo digestion reaction

[0082] The three sets of primer pairs selected in Example 2 were paired with the two sets of gDNA designed in Table 1 to screen out the most suitable gDNA in the PfAgo enzyme digestion reaction. The results are as follows: Figure 4 shown.

[0083] Depend on Figure 4 It can be seen that the gDNA7 combination showed the highest fluorescence intensity in both the FAM channel and the ROX channel, indicating that gDNA7 is the most suitable guide DNA for lamb.

[0084] The F2R3 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction reaction. The other parameters in the PfAgo restriction reaction were kept unchanged, and only the concentration of gDNA7 (gDNA7-1 and gDNA7-2) was changed to perform the PfAgo restriction experiment. 965 system (Hongshi, Shanghai, China) at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The concentrations of gDNA7 were 10 μM, 20 μM, 40 μM, 60 μM, 80 μM and 100 μM. The results are shown in Figure 5 .

[0085] Depend on Figure 5 It can be seen that as the concentration of gDNA7 increased, the fluorescence signal initially increased but then decreased, indicating that 10 μM was the optimal concentration for lamb.

[0086] 2. Optimization of MnCl2 addition volume in PfAgo digestion reaction

[0087] The F2R3 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the added volume of MnCl2 was changed. The PfAgo restriction digestion experiment was performed by 965 system (Hongshi, Shanghai, China) at 95 °C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The added volumes of MnCl2 were 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL, and the results are shown in Figure 5 .

[0088] Depend on Figure 5 It can be seen that the optimal volume of MnCl2 added is 5 μL.

[0089] 3. Optimization of probe concentration in PfAgo digestion reaction

[0090] The F2R3 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the concentration of the probe was changed. The PfAgo restriction digestion experiment was performed by 965 system (Hongshi, Shanghai, China) at 95 °C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tube was imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The concentrations of the probe were 10 μM, 20 μM, 40 μM, 60 μM, 80 μM and 100 μM. The results are shown in Figure 5 .

[0091] Depend on Figure 5 It can be seen that the optimal concentration of the probe is 10 μM.

[0092] 4. Optimization of the amount of PfAgo enzyme added in the PfAgo digestion reaction

[0093] The F2R3 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction reaction. The other parameters in the PfAgo restriction reaction were kept unchanged, and only the amount of PfAgo enzyme added was changed. The PfAgo restriction experiment was performed. 965 system (Hongshi, Shanghai, China) at 95 °C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tube was imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). Among them, the amount of PfAgo enzyme added was 1 μL, 2 μL, 3 μL, 4 μL, 5 μL and 6 μL, and the results are shown in Figure 5 .

[0094] Depend on Figure 5 It can be seen that the optimal amount of PfAgo enzyme added is 5 μL.

[0095] 5. Optimization of the volume of RPA product added in PfAgo digestion reaction

[0096] The F2R3 primer pair was used as the RPA specific primer pair for amplification, and the obtained RPA product was used as the RPA amplification product used in the PfAgo restriction digestion reaction. The other parameters in the PfAgo restriction digestion reaction were kept unchanged, and only the added volume of the RPA product was changed. The PfAgo restriction digestion experiment was performed. 965 system (Hongshi, Shanghai, China) at 95 °C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tube was imaged under blue light (470 nm) and green light (525 nm) by GelView 6000Plus imaging station (Bo Lu Teng, Guangzhou, China). The added volume of RPA product was 1 μL, 2 μL, 3 μL, 4 μL, 5 μL and 6 μL, and the results are shown in Figure 5 .

[0097] Depend on Figure 5 It can be seen that the optimal volume for adding RPA product is 5 μL.

[0098] according to Figure 5 From the results, it can be seen that whether it is the gDNA concentration, the probe concentration, the MnCl2 addition volume, the PfAgo enzyme addition amount or the RPA product addition volume, when FAM and ROX are used as probes, consistent optimal conditions are shown, indicating that consistent optimal conditions can be observed in different systems.

[0099] Example 4

[0100] Evaluation of sensitivity, specificity and repeatability of the RPA-PfAgo recognition platform

[0101] Reproducibility: To evaluate the reproducibility, a fixed concentration of positive plasmid (1×10 7 The amplification was performed under the optimal conditions established in Example 2 and Example 3 to ensure the consistency of the reaction mixture, temperature and time. The procedure was repeated three times, and the coefficient of variation (CV) was calculated by the following formula:

[0102] CV = (standard deviation mean) × 100%

[0103] Specificity: Genomic DNA from chicken, duck, pig, cow and sheep was tested, with sheep genomic DNA as a positive control, and the fluorescent signal was captured to determine its specificity.

[0104] Sensitivity: From 1×10 0 to 1×10 7 The positive plasmid with 100 copies / μL was serially diluted as a template to evaluate the sensitivity. Figure 6 .

[0105] Depend on Figure 6 It can be seen that the repeatability was evaluated by testing genomic DNA from lamb under optimal conditions. The coefficient of variation in all tests remained below 10%, indicating that the detection method has high repeatability and reliability. Specificity evaluation was performed by using genomic DNA from duck, chicken, beef, pork, and lamb. The results showed that fluorescence was detected only in lamb samples, while no cross-reaction was observed in chicken, beef, pork, or duck samples. It shows that each meat-specific RPA-PfAgo platform successfully detected significant fluorescence signals only in its corresponding meat sample, while no signal was observed in non-targeted meat or blank controls. The sensitivity experiment was performed by serial dilution of meat genomic DNA (ranging from 1×10 0 to 1×10 7The results showed that the RPA-PfAgo detection system was able to detect different levels of fluorescence in mutton samples, and the detection limit of mutton was 1×10 3 copies / μL.

[0106] Experimental example

[0107] Duck, chicken, lamb, beef, and pork samples were randomly selected from major supermarkets, including 15 real meat samples and 5 artificial adulteration samples mixed in different proportions, see Table 2. These samples were tested by the RPA-PfAgo method under blind test conditions (i.e., using Basic kit (TwistDx, Cambridge, UK) was used for RPA amplification with F2R3 as the RPA-specific primer pair: 29.5 μL of buffer A, 2 μL of sample DNA, 2 μL of 10 μM forward and 2 μL of 10 μM reverse RPA primers, 12.5 μL of deionized water and 2.0 μL of 280 mM MgAc were mixed thoroughly, and the centrifuge tube was incubated at 45 °C for 25 min to obtain the amplified product. 5 μL of amplified product was mixed with 2 μL of 10 μM gDNA7-1, 2 μL of 10 μM gDNA7-2, 1 μL of 10 μM probe, 5 μL of 200 U / μL PfAgo enzyme, 5 μL of 40 mM MnCl2, 3 μL of 10×Buffer, and ddH2O was used to make up to a final volume of 25 μL. PfAgo enzyme digestion experiment was performed by The 965 system was run at 95°C for 30 min, and FAM fluorescence was recorded every 30 s. After the reaction, the tubes were imaged under blue light (470 nm) and green light (525 nm) by the GelView 6000 Plus imaging station. The extracted DNA was used as a template for verification by PCR. The total reaction mixture was 25 μL, containing 12.5 μL of 2× Taq PCR Master Mix (TIANGEN, Beijing, China), 1 μL of 10 μM forward primer and 1 μL of 10 μM reverse primer, 2 μL of DNA template, and 8.5 μL of water. The PCR program was: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95°C for 45 s, annealing at 54°C for 45 s, extension at 72°C for 30 s, and finally extension at 72°C for 10 min and holding at 4°C. The PCR products were analyzed by 1.2% agarose gel electrophoresis to confirm the amplification of the target band. Figure 7When performing PCR verification, the forward primer sequence used for chicken is TCGACCCAGCAAATTATAGACCCAC (SEQ ID NO.12), and the reverse primer sequence is GCAAGAGTATGATTGTTGGTAGGATGATCT (SEQ ID NO.13); the forward primer sequence used for duck is GCCCATCCTTCCCACAGTATCAATC (SEQ ID NO.14), and the reverse primer sequence is CGGCGGCTAGCAGGATAGATGAGTT (SEQ ID NO.15); the forward primer sequence used for pork is AAACACTCGCATTAACAATCACCTT (SEQ ID NO.16), and the reverse primer sequence is TGTAGAATGTGGTGTATTTTGGTAGCACGGA (SEQ ID NO.17); the forward primer sequence used for mutton is GCCTCTCCAGTATTAAACTTGC (SEQ ID NO.18), and the reverse primer sequence is GTACTCGTTTGCATGTTTAAGACAGAC (SEQ ID NO.19). NO.19); the forward primer sequence used for beef is ATTATACATCGCCTAGCTCCATACA (SEQ ID NO.20), and the reverse primer sequence is GGTTCTTTAGTGAAGAGGCCATAGGGA (SEQ ID NO.21).

[0108] Table 2 Randomly purchased meat samples and artificially adulterated samples

[0109]

[0110]

[0111] Depend on Figure 7 It can be seen that samples 7 and 9 in the market are not pure roast duck products and mutton kebab products, among which samples 7 is a mixture of duck and chicken, and samples 9 is a mixture of pork and mutton. The detection rate of the RPA-PfAgo method matches that of PCR, indicating that the RPA-PfAgo method effectively identifies different types of meat, such as duck, chicken, beef, pork and mutton, and clearly detects the source components. This shows that the method of the present invention has good accuracy.

[0112] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An RPA-PfAgo detection system for detecting mutton, characterized in that: The RPA-PfAgo detection system includes an RPA-specific primer pair designed for the mutton gene, gDNA7-1 and gDNA7-2 sequences of the PfAgo protein, and a probe; The RPA specific primer pair is SEQ ID NO.1 and SEQ ID NO.6, SEQ ID NO.2 and SEQ ID NO.5, or SEQ ID NO.2 and SEQ ID NO.6; The gDNA7-1 sequence is shown in SEQ ID NO.9; The gDNA7-2 sequence is shown in SEQ ID NO.10; The sequence of the probe is shown in SEQ ID NO.

11.

2. The RPA-PfAgo detection system according to claim 1, characterized in that: The probe is labeled with a fluorescent group, and the fluorescent group is FAM or ROX.

3. Application of the RPA-PfAgo detection system according to claim 1 or 2 in detecting mutton, characterized in that: The detection is the appearance of fluorescence indicating that the detected meat contains mutton.

4. A kit for detecting mutton, characterized in that: It comprises the RPA-PfAgo detection system according to claim 1, buffer, magnesium acetate, PfAgo enzyme, MnCl2, buffer, and water.

5. The kit according to claim 4, characterized in that The method for using the kit comprises the following steps: (1) Extracting sample DNA; (2) Amplifying the extracted sample DNA using RPA-specific primers to obtain RPA products; (3) The RPA product obtained in step (2), the gDNA7-1 sequence, the gDNA7-2 sequence, the probe, the PfAgo enzyme, MnCl2, the buffer and water are mixed and subjected to a PfAgo enzyme digestion reaction. Fluorescence appears, indicating that the sample contains mutton.

6. The kit according to claim 5, characterized in that The amplification system in step (2) is calculated as 50 μL and includes 29.5 μL of buffer, 2 μL of each of the upstream and downstream primers of the RPA-specific primer pair of claim 1 with an initial concentration of 10 μM, 2 μL of sample DNA, 1 to 3 μL of magnesium acetate with an initial concentration of 280 mM, and water to make up to 50 μL.

7. The kit according to claim 5, characterized in that The amplification temperature is 35-50° C., and the amplification time is 10-40 min.

8. The kit according to claim 5, characterized in that In step (3), the PfAgo enzyme digestion reaction system is based on 25 μL, the amount of the RPA product used is 1 to 10 μL; the concentration of the gDNA7-1 is 1 to 100 μM; the concentration of the gDNA7-2 is 1 to 100 μM; the concentration of the probe is 1 to 100 μM; the amount of MnCl2 used is 1 to 6 μL; and the amount of PfAgo enzyme used is 1 to 6 μL.

9. The kit according to claim 5, characterized in that The temperature of the PfAgo enzyme cleavage reaction is 90-100° C., and the time of the PfAgo enzyme cleavage reaction is 25-35 min.

10. The kit according to claim 5, characterized in that The excitation wavelength of the fluorescence is 470 nm or 525 nm.

Images