SNP (Single Nucleotide Polymorphism) molecular marker of gene SbST1 related to sorghum stem diameter and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker of a gene SbST1 related to sorghum stem diameter and application of the SNP molecular marker. The invention relates to the technical field of molecular biology, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker of a gene SbST1 related to sorghum stem diameter and application of the SNP molecular marker. By detecting the polymorphism or genotype of SNP1 and SNP2 in the stem diameter gene SbST1 in the sorghum variety to be detected, it is found that the stem diameter mean value of the sorghum variety with the genotype of SNP1 being TT and the genotype of SNP2 being TT is significantly higher than that of the sorghum variety with the genotype of SNP1 being GG and the genotype of SNP2 being AA. The stem diameter of the sorghum variety of 78.05% of the haplotype SbST1-Hap1 is higher than 20 mm. It is shown that the sorghum stem diameter molecular marker of the haplotype SbST1-Hap1 can be used for assisting selective breeding, and the selection efficiency of sorghum high-stem-diameter varieties is remarkably improved.

Description

Technical Field

[0001] The invention belongs to the field of plants, and particularly relates to a SNP molecular marker of a gene SbST1 related to sorghum stem thickness and an application thereof. Background Art

[0002] Land salinization is a widespread problem worldwide. About 20% of available arable land has or is salinizing to varying degrees. The loss of land available for crop cultivation has become a serious problem for agricultural sustainability. Salt is one of the most important environmental stresses. It greatly reduces the area of ​​arable land and also reduces crop yield and quality. The use of salt-tolerant crops is an important strategy to alleviate this problem. Sorghum was previously considered to have moderate salt tolerance. The temperate regions in the west and northeast are the main areas for sorghum cultivation. It has strong drought resistance, waterlogging resistance, salt-alkali resistance, and high temperature resistance. It is suitable for planting on marginal land such as saline-alkali and drought. Sorghum is known for its strong stress resistance and wide adaptability. Salt tolerance is one of its main characteristics. Therefore, planting salt-alkali tolerant sorghum varieties is an effective measure to make full use of saline-alkali land resources and increase sorghum yields.

[0003] The yield and quality of plant biomass per acre are important factors in the economics of plant biofuel production. Stem diameter is the first choice for biomass yield, and stem diameter itself is an indicator for monitoring plant growth. There is a high correlation between stem weight and stem diameter. Varieties with higher stem diameters are less likely to lodging and can increase the aboveground biomass of plants to a certain extent. Studying the genes that regulate sorghum stem diameter, obtaining KASP molecular markers that are closely linked to stem diameter genes, locating and detecting the major gene loci for sorghum stem diameter, effectively regulating the stem diameter type of sorghum, and breeding new sorghum varieties with the expected stem diameter type are of great significance for improving sorghum yield and lodging resistance. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to identify or assist in identifying the stem thickness trait of sorghum or how to carry out sorghum breeding.

[0005] In order to solve the above technical problems, the present invention first provides the use of a material for detecting the polymorphism or genotype of SNP in the sorghum genome or a material for detecting the haplotype in any of the following:

[0006] (1) Identify or assist in identifying sorghum stem thickness;

[0007] (2) Screening or breeding sorghum plants, lines, strains or varieties with tall and thick stems;

[0008] (3) Sorghum breeding;

[0009] (4) preparing products for identifying or assisting in identifying sorghum stem thickness;

[0010] (5) preparing products for screening or breeding individual plants, strains, lines or varieties of sorghum with tall and thick stems;

[0011] (6) preparing sorghum breeding products;

[0012] The SNPs are named SNP1 and SNP2 in the sorghum genome, wherein SNP1 is the 3583rd nucleotide of SEQ ID No: 1 in the sequence list, and its nucleotide type is G or T; and SNP2 is the 7559th nucleotide of SEQ ID No: 1 in the sequence list, and its nucleotide type is A or T.

[0013] In the present application, the genotype of the SNP1 may be genotype GG, genotype TT or genotype GT, genotype GG is the homozygous type of SNP1 with G; genotype TT is the homozygous type of SNP1 with T; genotype GT is the heterozygous type of SNP1 with G and T; the genotype of the SNP2 may be genotype AA, genotype TT or genotype AT, genotype AA is the homozygous type of SNP2 with A; genotype TT is the homozygous type of SNP2 with T; genotype AT is the heterozygous type of SNP2 with A and T.

[0014] The haplotype is a polymorphic combination of SNP1 and SNP2 on one chromosome of sorghum.

[0015] The haplotypes include SbST1-Hap1, SbST1-Hap2, SbST1-Hap3, and SbST1-Hap4.

[0016] The genotype of the SbST1-Hap1 is TTTT, and the genotype of the SNP1 site of the sorghum with the genotype TTTT is TT, and the genotype of the SNP2 site is TT; the genotype of the SbST1-Hap2 is GGAA, and the genotype of the SNP1 site of the sorghum with the genotype GGAA is GG, and the genotype of the SNP2 site is AA; the genotype of the SbST1-Hap3 is GGTT, and the genotype of the SNP1 site of the sorghum with the genotype GGTT is GGCC, and the genotype of the SNP2 site is TT; the genotype of the SbST1-Hap4 is TTAA, and the genotype of the SNP1 site of the sorghum with the genotype TTAA is TT, and the genotype of the SNP2 site is AA.

[0017] The sorghum genome (BTx623 (v3.1) sequence is used as the reference genome, the SNP1 is located in the SbST1 gene, the SNP2 is located in the SbST1 gene, the SbST1 gene is located at positions 7684582-7694636 of chromosome 1 of sorghum, and is related to the sorghum stem thickness. The nucleotide sequence is the DNA molecule shown in SEQ ID No: 1 in the sequence table.

[0018] The present invention also provides a method for identifying or assisting in identifying the trait of sorghum stem thickness, wherein the method is method A or B:

[0019] The method A comprises detecting the genotypes of the SNP1 and SNP2 mentioned above in the sorghum to be tested, and identifying or assisting in identifying the sorghum stem thickness according to the genotype of the sorghum to be tested;

[0020] The method B is to detect the haplotypes described above in the sorghum to be tested, identify or assist in identifying the stem thickness of the sorghum according to the haplotypes of the sorghum to be tested, and the stem thickness of the sorghum of SbST1-Hap1 is higher than or is a candidate to be higher than that of the sorghum of SbST1-Hap2;

[0021] The genotype of the SbST1-Hap1 is TTTT, and the genotype of the sorghum with the genotype TTTT is that the genotype of the SNP1 site is TT and the genotype of the SNP2 site is TT; the genotype of the SbST1-Hap2 is GGAA, and the genotype of the sorghum with the genotype GGAA is that the genotype of the SNP1 site is GG and the genotype of the SNP2 site is AA.

[0022] Optionally, the method for identifying or assisting in identifying the sorghum stem thickness trait may be any of the following:

[0023] (1) The genotype of the SNP1 genotype TT and / or the SNP2 genotype TT of the sorghum to be tested (such as a sorghum inbred line) is or is a candidate for being a sorghum with a tall and thick stem.

[0024] (2) The average stem diameter of the sorghum to be tested (such as sorghum inbred line) of the haplotype SbST1-Hap1 (genotype is TTTT) is significantly higher than or significantly higher than that of the sorghum to be tested of the haplotype SbST1-Hap2 (genotype is GGAA).

[0025] As an embodiment, the method for identifying or assisting in identifying the sorghum stem thickness may include the following steps:

[0026] (1) Using the genomic DNA of the sorghum to be tested as a template, a primer combination F1 and a primer set F2 are used to perform KASP; the primer combination F1 may be composed of primer F1-A, primer F1-B, and primer F1-C; the primer set F2 may include primer F2-A, primer F2-B, and primer F2-C;

[0027] The primer composition F1 is composed of primer F1-A which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 2 or a single-stranded DNA having a nucleotide sequence of positions 22 to 46 of SEQ ID No: 2;

[0028] The primer composition F1 is composed of primer F1-B which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 3 or a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 3;

[0029] The primer composition F1 is composed of a single-stranded DNA molecule whose nucleotide sequence of primer F1-C is SEQ ID No: 4;

[0030] Primer F2-A in the primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 5 or a single-stranded DNA whose nucleotide sequence is positions 22 to 47 of SEQ ID No: 5;

[0031] Primer F2-B in the primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 6 or a single-stranded DNA whose nucleotide sequence is positions 22 to 47 of SEQ ID No: 6;

[0032] The primer F2-C in the primer set F2 is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 7.

[0033] (2) After completing step (1), performing fluorescence detection to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0034] (3) Identifying the stem thickness of the sorghum to be tested based on the genotype results: the average stem thickness of the sorghum to be tested (such as sorghum inbred line) with the SNP1 genotype of TT or the SNP2 locus genotype of TT is significantly higher than or significantly higher than the stem thickness of the sorghum to be tested (such as sorghum inbred line) with the genotype of GGAA.

[0035] The application of the above-mentioned method for identifying or assisting in identifying sorghum stem thickness in sorghum breeding also falls within the protection scope of the present invention.

[0036] The invention also provides a sorghum breeding method.

[0037] The sorghum breeding method provided by the present invention can be M1:

[0038] The M1 method includes detecting the genotypes of the SNP1 and the SNP2 in the sorghum genome, selecting sorghum whose genotypes of the two SNP sites, the SNP1 and the SNP2, are TTTT as parents for breeding, and the breeding purpose of the method includes breeding sorghum with tall and thick stems.

[0039] As an implementation method, the sorghum breeding method may include the following steps:

[0040] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP was performed using the primer set F1 and the primer set F2;

[0041] (2) After completing step (1), performing fluorescence detection to determine the genotypes of the SNP1 and SNP2 sites of the sorghum to be tested;

[0042] (3) Selecting sorghum whose SNP1 genotype is TT and / or whose SNP2 locus genotype is TT for breeding of tall stem thickness.

[0043] The sorghum breeding described above is to cultivate sorghum varieties with thicker stems.

[0044] The sorghum stem thickness mentioned above may specifically be the stem thickness of sorghum at a mature stage.

[0045] In the above applications and methods, the sorghum may be a pure sorghum inbred line. In the above applications and methods, a sorghum inbred line may be selected as a parent for breeding.

[0046] In the above applications and methods, the stem thickness of the sorghum variety with low stem thickness is relative to the hybrid parent sorghum. If the stem thickness of the two hybrid parent sorghums is the same, the stem thickness of the sorghum variety with high stem thickness can be equal to or greater than the stem thickness of the hybrid parent sorghum; if the stem thickness of the two hybrid parent sorghums is different, the stem thickness of the sorghum variety with high stem thickness can be equal to or greater than the hybrid parent sorghum with higher stem thickness among the two hybrid parent sorghums.

[0047] The present invention also provides a product for detecting the polymorphism or genotype of SNP in the sorghum genome.

[0048] The product for detecting the polymorphism or genotype of the SNP in the sorghum genome provided by the present invention is the above-mentioned substance for detecting the polymorphism or genotype of the SNP site in the sorghum genome, or a product containing the above-mentioned substance for detecting haplotype, and the product can be any one of the following:

[0049] C1) Products for detecting single nucleotide polymorphisms or genotypes related to sorghum stem thickness;

[0050] C2) Identify or assist in identifying products with thick sorghum stems;

[0051] C3) Products used for sorghum breeding;

[0052] C4) Screening or breeding products of sorghum plants, lines, strains or varieties with tall and thick stems.

[0053] In the above applications, methods and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction endonuclease reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescent molecule DNA binding reaction.

[0054] Optionally, the substance is the following D1), D2) or D3):

[0055] D1) the substances are primer combination F1 and primer set F2 for amplifying a sorghum genomic DNA fragment including the SNP1 and / or the SNP2;

[0056] D2) the substance is a PCR reagent containing the primer combination described in D1);

[0057] D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0058] Optionally, the primer combination for amplifying the sorghum genomic DNA fragment including the SNP1 may consist of primer F1-A, primer F1-B, and primer F1-C; the primer set for amplifying the sorghum genomic DNA fragment including the SNP2 may consist of primer F2-A, primer F2-B, and primer F2-C;

[0059] The primer composition F1 can be composed of primer F1-A which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 2 or a single-stranded DNA having a nucleotide sequence of positions 22 to 46 of SEQ ID No: 2;

[0060] The primer composition F1 can be composed of primer F1-B which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 3 or a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 3;

[0061] The primer composition F1 can be composed of a single-stranded DNA molecule whose nucleotide sequence of primer F1-C is SEQ ID No:4.

[0062] The primer composition F2 may be composed of primer F2-A which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 5 or a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 5;

[0063] The primer composition F2 may be composed of a primer F2-B which is a single-stranded DNA molecule having a nucleotide sequence of SEQ ID No: 6 or a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 6;

[0064] The primer composition F2 can be composed of a single-stranded DNA molecule whose nucleotide sequence of primer F2-C is SEQ ID No: 7.

[0065] In the above-mentioned applications, methods and products, the primer composition may be labeled or not labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be connected to a nucleic acid. Markers include but are not limited to dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or move the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly read the sequence) without a marker.

[0066] For example, the primer composition F1 may be a primer composition consisting of a single-stranded DNA having a nucleotide sequence of positions 22-46 of SEQ ID No: 2, a single-stranded DNA having a nucleotide sequence of positions 22-47 of SEQ ID No: 3, and a single-stranded DNA having a nucleotide sequence of SEQ ID No: 4. The primer composition F1 may also be a primer set consisting of a single-stranded DNA shown in SEQ ID No: 2, a single-stranded DNA shown in SEQ ID No: 3, and a single-stranded DNA shown in SEQ ID No: 4. SEQ ID No: 2 consists of 46 nucleotides, nucleotides 1-21 are FAM sequences (as markers), and nucleotides 22-46 are specific sequences; SEQ ID No: 3 consists of 47 nucleotides, nucleotides 1-21 are HEX sequences (as markers), and nucleotides 22-47 are specific sequences. The primer composition F2 may be a primer composition consisting of a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 5, a single-stranded DNA having a nucleotide sequence of positions 22 to 47 of SEQ ID No: 6, and a single-stranded DNA having a nucleotide sequence of SEQ ID No: 7, or a primer set consisting of a single-stranded DNA shown in SEQ ID No: 5, a single-stranded DNA shown in SEQ ID No: 6, and a single-stranded DNA shown in SEQ ID No: 7. SEQ ID No: 5 consists of 47 nucleotides, nucleotides 1 to 21 are FAM sequences (as markers), and nucleotides 22 to 47 are specific sequences; SEQ ID No: 6 consists of 47 nucleotides, nucleotides 1 to 21 are HEX sequences (as markers), and nucleotides 22 to 47 are specific sequences.

[0067] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence table.

[0068] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0069] (1) Identify or assist in identifying sorghum stem thickness;

[0070] (2) Screening or breeding sorghum plants, lines, strains or varieties with tall and thick stems;

[0071] (3) Sorghum breeding;

[0072] (4) preparing products for identifying or assisting in identifying sorghum stem thickness;

[0073] (5) preparing products for screening or breeding individual plants, strains, lines or varieties of sorghum with tall and thick stems;

[0074] (6) Prepare sorghum breeding products.

[0075] Optionally, in the above application, the DNA molecule is used as a detection target.

[0076] The material for detecting the SNP polymorphism and genotype or the haplotype can be combined with other materials (such as materials for detecting single nucleotide polymorphism or genotype of other molecular markers related to sorghum stem thickness) to prepare a product for identifying sorghum stem thickness varieties.

[0077] The present invention finds two SNPs through genetic variation analysis of the SbST1 gene in a sorghum inbred line associated population, wherein SNP1 is located in the SbST1 gene related to stem thickness in the sorghum genome, i.e., position 3583 of SEQ ID No: 1 in the sequence list, and SNP2 is located in the SbST1 gene related to stem thickness in the sorghum genome, i.e., position 7559 of SEQ ID No: 1 in the sequence list, and provides a primer combination for amplifying a sorghum genomic DNA fragment including the SNP1 and the SNP2 and a primer combination for amplifying a sorghum genomic DNA fragment including the SNP1 and the SNP2, and also provides a method for identifying or assisting in identifying the stem thickness of sorghum by using the primer combination.

[0078] The method established by the present invention can be used to predict the stem thickness phenotype of sorghum, can be used for early screening of sorghum to be screened, can be used for sorghum molecular marker-assisted breeding, and has important application value in the research of exploring sorghum germplasm resources with heavier stem thickness and breeding sorghum varieties with tall stem thickness. DETAILED DESCRIPTION

[0079] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0080] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0081] The 210 sorghum inbred line related populations in the following embodiments were provided by Jing Haichun's research group at the National Key Laboratory of Efficient Design and Utilization of Forage Germplasm, Institute of Botany, Chinese Academy of Sciences. The detailed information of the related population has been recorded in: Xiaoyuan Wu, et al..Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537-551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002), and its germplasm resource information can also be obtained from the SorGSD website (https: / / ngdc.cncb.ac.cn / sorgsd / ). The variety details are shown in Table 1.

[0082] Example 1: Discovery of SNP molecular markers associated with sorghum stem thickness

[0083] 1. Statistics of stem diameter of test materials

[0084] 1. Planting of test materials

[0085] In 2021, 210 sorghum inbred line-related population germplasm resources were planted in the farmland soil of the Agricultural High-tech Zone in Dongying City, Shandong Province, China. A randomized complete block design was adopted. The experimental plot was 3m long and 2m wide, with 5 rows planted, 10 plants in each row, 0.3m spacing between plants, 0.5m spacing between rows, and normal irrigation.

[0086] 2. Statistics of stem diameter of test materials

[0087] After the 210 sorghum inbred line related populations were fully mature, 3 plants were selected from each material, and the stem diameter of the main stem of each plant was counted. The average value of the three repetitions was taken as the final result of the stem diameter of the sample, as shown in the stem diameter in Table 1.

[0088] 2. Discovery of SNP molecular markers related to gene SbST1

[0089] 1. Whole genome sequencing of 210 sorghum inbred line association populations

[0090] The whole genome sequencing data of 210 sorghum inbred line-related populations were provided by Jing Haichun's research group at the National Key Laboratory of Efficient Design and Utilization of Forage Germplasm, Institute of Botany, Chinese Academy of Sciences.

[0091] 2. Discovery of SNP molecular markers related to gene SbST1

[0092] According to the results of genome-wide association analysis of the aboveground dry weight of sorghum inbred lines and their genotype data, a haplotype combination of the gene SbST1 related to sorghum stem thickness was screened out. The haplotype combination includes two SNP sites, SNP1 corresponds to the 7691104th position on chromosome 1 of sorghum inbred line BTx623, and its nucleotide is G or T, corresponding to the 3583rd position of SEQ ID No: 1 in the sequence list. SNP2 corresponds to the 7687128th position on chromosome 1 of sorghum inbred line BTx623, and its nucleotide is T or A, corresponding to the 7559th position of SEQ ID No: 1 in the sequence list. In the sequence list, k in SEQ ID No: 1 represents g or t, and w represents t or a.

[0093] The genotype detection results of each sorghum variety are shown in Table 1. The results show that there are two genotypes GG or TT at the SNP1 site, genotype GG is the homozygous type of SNP1 G, and genotype TT is the homozygous type of SNP1 T. There are two genotypes AA or TT at the SNP2 site, genotype AA is the homozygous type of SNP2 A, and genotype TT is the homozygous type of SNP2 T.

[0094] The haplotypes formed by SNP1 and SNP2 include SbST1-Hap1, SbST1-Hap2, SbST1-Hap3, and SbST1-Hap4.

[0095] Among them, the genotype of SbST1-Hap1 is TTTT, and the genotype of the SNP1 site of the sorghum with the genotype TTTT is TT, and the genotype of the SNP2 site is TT; the genotype of SbST1-Hap2 is GGAA, and the genotype of the SNP1 site of the sorghum with the genotype GGAA is GG, and the genotype of the SNP2 site is AA; the genotype of SbST1-Hap3 is GGTT, and the genotype of the SNP1 site of the sorghum with the genotype GGTT is GG, and the genotype of the SNP2 site is TT; the genotype of SbST1-Hap4 is TTAA, and the genotype of the SNP1 site of the sorghum with the genotype TTAA is TT, and the genotype of the SNP2 site is AA.

[0096] Therefore, the genotype of SNP1 or SNP2, or the haplotype formed by SNP1 and SNP2, is selected to identify or assist in identifying the stem thickness of different strains of sorghum. The specific criteria are as follows:

[0097] 1) The stem thickness of the sorghum to be tested (such as sorghum inbred line) whose SNP1 genotype is TT and / or whose SNP2 site genotype is TT is higher or has a higher potential than that of the sorghum to be tested (such as sorghum inbred line) whose SNP1 genotype is GG and / or whose SNP2 site genotype is AA.

[0098] 2) The stem thickness of the sorghum to be tested (such as sorghum inbred line) of SbST1-Hap1 (genotype is TTTT) is higher or has the potential to be higher than that of SbST1-Hap2 (genotype is GGAA), wherein the SNP1 genotype of the sorghum of SbST1-Hap1 is TT and the SNP2 locus genotype is TT, and the SNP1 genotype of the sorghum of SbST1-Hap2 is GG and the SNP2 locus genotype is AA.

[0099] 3. Design of primers for SNP molecular markers related to gene SbST1 and establishment of methods

[0100] 1. Design of genome-specific primers for haplotype combination-related SNP sites

[0101] The specific primer sequences of SNP1 (SEQ ID No: 2, SEQ ID No: 3, SEQ ID No: 4, SEQ ID No: 5, SEQ ID No: 6 and SEQ ID No: 7 in the sequence listing) were designed and synthesized by Zhongyujin Labeling (Beijing) Biotechnology Co., Ltd.

[0102] The primer set F1 for identifying the polymorphism of SNP1 site is as follows:

[0103] Specific primer F1-A (SEQ ID No: 2):

[0104] 5'- GAAGGTGACCAAGTTCATGCT CCGCTCCATAATTATATCCTTTGGC-3'

[0105] Specific primer F1-B (SEQ ID No: 3):

[0106] 5'- GAAGGTCGGAGTCAACGGATT GCCGCTCCATAATTATATCCTTTGGA-3'

[0107] Universal primer F1-C (SEQ ID No: 4):

[0108] 5'-TTGTCATCTATGGGAGGATCCTTTTTCAT-3'

[0109] The primer set F2 for identifying the polymorphism of SNP2 site is as follows:

[0110] Specific primer F2-A (SEQ ID No: 5):

[0111] 5'- GAAGGTGACCAAGTTCATGCT CTCACCTTCAGGGATATCATTTGTAT-3'

[0112] Specific primer F2-B (SEQ ID No: 6):

[0113] 5'- GAAGGTCGGAGTCAACGGATT CTCACCTTCAGGGATATCATTTGTAA-3'

[0114] Universal primer F2-C (SEQ ID No: 7):

[0115] 5'-TTACTCACATTTATGTTCTTCCATAGGGTT-3'

[0116] The primer set F1 for identifying the polymorphism of the SNP1 site is designed based on the antisense strand of the sequence SEQ ID No: 1, and the primer set F2 for identifying the polymorphism of the SNP2 site is designed based on the antisense strand of the sequence SEQ ID No: 1.

[0117] The underlined sequences in the above primers F1-A and F2-A are FAM sequences; the underlined sequences in F1-B and F2-B are HEX sequences.

[0118] The single-stranded DNA molecules shown in the above sequences SEQ ID No: 2 and SEQ ID No: 4 amplify the fragment whose complementary base corresponding to the G base at the SNP1 site in SEQ ID No: 1 is "C", and the fluorescent signal of the fluorescent group bound to the FAM sequence in the template can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0119] The single-stranded DNA molecules shown in the above sequences SEQ ID No:3 and SEQ ID No:4 amplify the fragment in which the complementary base corresponding to the T base at the SNP1 site of SEQ ID No:1 is "A", and the fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read using an ELISA reader or a fluorescent quantitative PCR instrument.

[0120] The single-stranded DNA molecule amplification sequence shown in the above sequences SEQ ID No:5 and SEQ ID No:7 has a fragment in which the complementary base corresponding to the SNP2 site in the antisense strand corresponding to SEQ ID No:1 in the sequence list is A, i.e., a fragment in which the SNP2 site in the sequence list is A. The fluorescent signal of the fluorescent group bound to the FAM sequence in the template can be read by an ELISA reader or a fluorescence quantitative PCR instrument;

[0121] The single-stranded DNA molecule amplification sequence shown in the above sequences SEQ ID No:6 and SEQ ID No:7 has a fragment in which the complementary base corresponding to the SNP2 site in the antisense strand corresponding to SEQ ID No:1 in the sequence list is T, i.e., a fragment in which the SNP2 site in the sequence list SEQ ID No:1 is T. The fluorescent signal of the fluorescent group bound to the HEX sequence in the template can be read using an enzyme marker or a fluorescent quantitative PCR instrument.

[0122] 2. Establishment of a method for detecting stem thickness of sorghum using KASP molecular markers

[0123] 1) DNA extraction

[0124] The genomic DNA of the tested sorghum varieties was extracted and dissolved in ddH2O as a template for PCR amplification.

[0125] 2) PCR amplification and fluorescence signal detection

[0126] Use SNP primer set F1 and primer set F2 in step 1 to perform PCR amplification on the template obtained in step 1) to detect the polymorphism (nucleotide type) and genotype of the SNP site; use Douglas-Araya high-throughput pipeline fluorescence signal scanner to read the fluorescence data of the PCR products of primer set F1 and primer set F2, and use Douglas dedicated software-Kraken for fluorescence signal processing.

[0127] Prepare primer mixture: dilute primer F1-A, primer F1-B, and primer F1-C to 100 mmol / L with ddH2O. -1 , respectively obtain primer F1-A solution, primer F1-B solution, primer F1-C solution. Take 60 μL of primer F1-A solution, 60 μL of primer F1-B solution, 150 μL of primer F1-C solution, add 230 μL of 10 mM Tris-HCL to obtain primer mixture F1. Use the above method to obtain primer F2-A solution, primer F2-B solution, primer F2-C solution, take 60 μL of primer F2-A solution, 60 μL of primer F2-B solution, 150 μL of primer F2-C solution, add 230 μL of 10 Mm Tris-HCL to obtain primer mixture F2.

[0128] The 2 μL PCR fluorescence quantitative instrument detection reaction system includes: 50 ng genomic DNA, 0.02 μL primer mixture, 0.6 μL 1× KASP Mix (Low Rox) from LGC, and the rest is ddH2O. According to the operating manual of Douglas-Nexar and Soellex water bath system, edit and run the program and save the data.

[0129] Use SNP1 primer set F1 and SNP2 primer set F2 in step 1 to perform PCR amplification on the template obtained in 2.1 to detect the polymorphism (nucleotide type) and genotype of SNP1 site and SNP2 site; use an ELISA reader or a fluorescence quantitative PCR instrument to read the fluorescence data of the PCR products of primer set F1 and primer set F2, and use the online software SNP decoder (http: / / www.snpway.com / snpdecoder01 / ) to process the fluorescence signal.

[0130] The results are as follows:

[0131] If the PCR product of the F1 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP1 site to be tested is GG (i.e., the SNP1 site in the sorghum genome is homozygous for G); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is TT (i.e., the SNP1 site in the sorghum genome is homozygous for T); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP1 site to be tested is GT (i.e., the SNP1 site in the sorghum genome is heterozygous for G and T).

[0132] If the PCR product of the F2 primer group shows only the fluorescent signal of the fluorescent group bound to the FAM sequence, the genotype of the sorghum SNP2 site to be tested is AA (i.e., the SNP2 site in the sorghum genome is the homozygous type of A); if it shows only the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is TT (i.e., the SNP2 site in the sorghum genome is the homozygous type of T); if it shows both the fluorescent signal of the fluorescent group bound to the FAM sequence and the fluorescent signal of the fluorescent group bound to the HEX sequence, the genotype of the sorghum SNP2 site to be tested is AT (i.e., the SNP2 site in the sorghum genome is the heterozygous type of A and T).

[0133] Determine the genotype associated with the gene SbST1 to identify or assist in identifying the stem diameter of the tested sorghum variety:

[0134] 1) The stem thickness of the sorghum to be tested (such as sorghum inbred line) whose SNP1 genotype is TT and / or whose SNP2 locus genotype is TT is higher or is a candidate to be higher than that of the sorghum to be tested (such as sorghum inbred line) whose SNP1 genotype is GG and / or whose SNP2 locus genotype is AA;

[0135] 2) The stem thickness of the sorghum to be tested (such as sorghum inbred line) of SbST1-Hap1 (genotype is TTTT) is higher or has the potential to be higher than that of SbST1-Hap2 (genotype is GGAA), wherein the SNP1 genotype of the sorghum of SbST1-Hap1 is TT and the SNP2 site genotype is TT, and the SNP1 genotype of the sorghum of SbST1-Hap2 is GG and the SNP2 site genotype is AA.

[0136] Example 2: Application of SNP molecular markers of the SbST1 gene significantly associated with sorghum stem thickness

[0137] Sorghum to be tested: 210 sorghum inbred line related populations

[0138] 1. Determination of sorghum stem diameter

[0139] The method is the same as Example 1. The results show that 210 sorghum inbred lines were planted in the farmland soil of the Agricultural High-tech Zone of Dongying City, Shandong Province, China. The stem diameters of different sorghum varieties vary significantly, ranging from 10.13 to 32.47 mm, of which 103 sorghum inbred lines have stem diameters exceeding 20 mm, accounting for about 49.05% of the association population.

[0140] 2. Molecular Identification or Assisted Identification of Stem Thickness of Sorghum Inbred Lines

[0141] Extract the genomic DNA of the sorghum to be tested, add ddH2O to dissolve it as a template. Use the genomic specific primers (SNP1 primer set F1 and primer set F2) of the haplotype combination (SNP1 and SNP2 sites) in Example 1 for PCR amplification to obtain the polymorphism information of the genotype related to the SbST1 gene, thereby determining the genotype related to the gene SbST1 of the sorghum to be tested, thereby identifying or assisting in identifying the stem thickness of the sorghum variety to be tested.

[0142] The genotypes of SNP1 and SNP2 in the 210 tested sorghums and the sorghum stem thickness are shown in Tables 1 and 2. The SNP1 of the tested sorghums contains two genotypes, GG and TT, and the SNP2 contains two genotypes, AA and TT.

[0143] The test results showed that among the 210 sorghum varieties, 32 varieties with genotype TTTT (haplotype SbST1-Hap1) had stem diameters higher than 20 mm, and 78.05% of varieties with genotype TTTT had stem diameters higher than 20 mm; among the 164 varieties with genotype GGAA (haplotype SbST1-Hap2), 95 varieties had stem diameters lower than 20 mm, and 57.93% of varieties with genotype GGAA had stem diameters lower than 20 mm, 4 varieties with genotype GGTT, and 1 variety with genotype TTAA. This indicates that it is effective to use genotype TTTT (haplotype SbST1-Hap1) to select sorghum varieties with high stem diameters, eliminate sorghum varieties with low stem diameters of genotype GGAA (haplotype SbST1-Hap2), and use SNP molecular markers for auxiliary selection of sorghum stem diameters.

[0144] Table 1. Stem thickness traits and genotypes of two SNP loci in 210 sorghum inbred lines

[0145]

[0146]

[0147]

[0148]

[0149]

[0150] Note: IS: Sweet Sorghum; IG: Grain Sorghum; LG: Grain Sorghum; AL: unknown; LB: Broom Sorghum.

[0151] Example 2 GraphPad Prism v8.0 statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated a very significant difference.

[0152] When the significance level is 0.05, mark the lowercase Latin letter a after the maximum average, and compare the average with other averages from large to small. If the difference with the maximum average is not significant, mark the same letter a until a significant average is marked with the letter b. Then compare the average marked with the letter b with the averages above it that are larger than it. If the difference is not significant, mark the letter b again until the difference is significant and mark the letter c. Repeat this process until all the averages are marked and compared. If there is one same letter between the averages, the difference is not significant; if there is no same letter, the difference is significant.

[0153] A significance analysis of the differences in stem diameter among the four haplotypes was performed. There was an extremely significant difference (P<0.001) between the homozygous sorghum genotype corresponding to SbST1-Hap1 (genotype TTTT) and the homozygous sorghum genotype corresponding to SbST1-Hap2 (genotype GGAA). There were only four homozygous sorghum genotypes corresponding to the genotype GGTT and only one homozygous sorghum genotype corresponding to the genotype TTAA, which are rare haplotypes. Due to the small number of materials, the differences were not statistically significant.

[0154] Table 2. Stem diameter and difference analysis of 210 sorghum inbred lines corresponding to different haplotypes of gene SbST1

[0155] Haplotype genotype Number of varieties Average stem diameter ± standard deviation (mm) SbST1-Hap1 TTTT 41 <![CDATA[22.73±4.792 a ]]> SbST1-Hap2 GGA 164 <![CDATA[19.10±3.958 b ]]> SbST1-Hap3 GGTT 4 19.51±5.93 SbST1-Hap4 TTAA 1 18.98

[0156] The results showed that there was an extremely significant difference in the stem diameter of sorghum with the homozygous genotype TT of SNP1 and that with the homozygous genotype GG (P<0.0001), and the stem diameter of sorghum corresponding to the genotype TT of SNP1 was extremely significantly higher or candidate higher than that of sorghum with the genotype GG of SNP1; there was an extremely significant difference in the stem diameter of sorghum with the homozygous genotype TT of SNP2 and that with the homozygous genotype AA (P<0.0001), and the stem diameter of sorghum with the genotype TT of SNP2 was extremely significantly higher or candidate higher than that of sorghum with the genotype AA of SNP2.

[0157] Table 3. Stem diameter and difference analysis of 210 sorghum inbred lines corresponding to different genotypes of two SNP loci of gene SbST1

[0158]

[0159] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of a substance for detecting polymorphism, genotype or haplotype of SNP in sorghum genome in any of the following: (1) Identify or assist in identifying sorghum stem thickness; (2) Screening or breeding sorghum plants, lines, strains or varieties with tall and thick stems; (3) Sorghum breeding; (4) preparing products for identifying or assisting in identifying sorghum stem thickness; (5) preparing products for screening or breeding individual plants, strains, lines or varieties of sorghum with tall and thick stems; (6) preparing sorghum breeding products; The SNPs are named SNP1 and SNP2 in the sorghum genome, respectively. The SNP1 is the 3583rd nucleotide of SEQ ID No: 1 in the sequence list, and its nucleotide type is G or T. The SNP2 is the 7559th nucleotide of SEQ ID No: 1 in the sequence list, and its nucleotide type is A or T. The haplotype is a polymorphic combination of SNP1 and SNP2 on one chromosome of sorghum.

2. A method for identifying or assisting in identifying the thickness of sorghum stems, the method being method A and method B: The method A comprises detecting the genotypes of SNP1 and SNP2 of claim 1 in the sorghum to be tested, and identifying or assisting in identifying the sorghum stem thickness according to the genotype of the sorghum to be tested; The method B is to detect the haplotype of claim 1 in the sorghum to be tested, identify or assist in identifying the stem thickness of sorghum according to the haplotype of the sorghum to be tested, and the stem thickness of the sorghum of SbST1-Hap1 is higher than or is a candidate to be higher than that of the sorghum of SbST1-Hap2; The genotype of the SbST1-Hap1 is TTTT, and the genotype of the sorghum with the genotype TTTT is that the genotype of the SNP1 site is TT and the genotype of the SNP2 site is TT; the genotype of the SbST1-Hap2 is GGAA, and the genotype of the sorghum with the genotype GGAA is that the genotype of the SNP1 site is GG and the genotype of the SNP2 site is AA.

3. The use according to claim 1 or the method according to claim 2, characterized in that: The sorghum is an inbred line of sorghum.

4. Application of the method according to claim 2 or 3 in sorghum breeding.

5. A method for sorghum breeding, characterized in that: The method comprises detecting the genotype of the SNP1 or / and the SNP2 in claim 1 in the sorghum genome, selecting the homozygous type of SNP1 being TT or / and the homozygous type of SNP2 being TT as parent breeding, and the breeding purpose of the method comprises breeding sorghum with tall and thick stems.

6. A product for detecting the polymorphism or genotype of SNP1 and SNP2 as claimed in claim 1, the product containing the substance as claimed in claim 1, the product being any one of: C1) Products for detecting single nucleotide polymorphisms or genotypes related to sorghum stem thickness; C2) Identify or assist in identifying products with thick sorghum stems; C3) Products used for sorghum breeding; C4) Screening or breeding products of sorghum plants, lines, strains or varieties with tall and thick stems.

7. The use according to claim 1 or the product according to claim 6, characterized in that: The substance is the following D1), D2) or D3): D1) the substance is a primer composition for amplifying a sorghum genomic DNA fragment including the SNP1 and / or SNP2; D2) the substance is a PCR reagent containing the primer combination described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The use or product according to claim 7, characterized in that: The primer composition for amplifying the sorghum genomic DNA fragment including the SNP1 consists of primer F1-A, primer F1-B, and primer F1-C; the primer composition for amplifying the sorghum genomic DNA fragment including the SNP2 consists of primer F2-A, primer F2-B, and primer F2-C: The primer F1-A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 46th position of SEQ ID No: 2 in the sequence list; The primer F1-B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 47th position of SEQ ID No: 3 in the sequence list; The nucleotide sequence of the primer F1-C is a single-stranded DNA molecule of SEQ ID No: 4 in the sequence list. The primer F2-A is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 5 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 47th position of SEQ ID No: 5 in the sequence list; The primer F2-B is a single-stranded DNA molecule whose nucleotide sequence is SEQ ID No: 6 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 47th position of SEQ ID No: 6 in the sequence list; The nucleotide sequence of the primer F2-C is a single-stranded DNA molecule of SEQ ID No: 7 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is SEQ ID No: 1 in the sequence listing.

10. Use of the DNA molecule according to claim 9 in any of the following: (1) Identify or assist in identifying sorghum stem thickness; (2) Screening or breeding sorghum plants, lines, strains or varieties with tall and thick stems; (3) Sorghum breeding; (4) preparing products for identifying or assisting in identifying sorghum stem thickness; (5) preparing products for screening or breeding individual plants, strains, lines or varieties of sorghum with tall and thick stems; (6) Prepare sorghum breeding products.

Images