Application of endophytic fungus HKL06 in increasing paclitaxel content

Abstract

The invention discloses an application of an endophytic fungus HKL06 in increasing the content of paclitaxel, the endophytic fungus HKL06 is named as Diapothelium cells HKL06 in taxonomy, the endophytic fungus HKL06 is preserved in the China Center for Type Culture Collection (CCTCC) on January 26, 2024, and the preservation number is CCTCC NO: M2024234. According to the application, the biosynthesis process of paclitaxel in plants can be remarkably promoted, and gene expression related to paclitaxel synthesis is enhanced. According to the method, the yield of paclitaxel is increased, and the production process of paclitaxel is optimized, so that the method has a remarkable practical value and a wide market prospect in the field of medicines.

Description

Technical Field

[0001] The invention relates to the field of microorganism and plant secondary metabolism regulation, and in particular to application of endophytic fungus HKL06 in increasing the content of paclitaxel. Background Art

[0002] Paclitaxel is a natural compound with significant anti-cancer activity. It was originally discovered by researchers at the National Cancer Institute (NCI) in the 1960s when screening potential anti-cancer substances. It can be used to treat many types of cancer, including breast cancer, ovarian cancer, lung cancer, pancreatic cancer, head and neck cancer, and certain types of leukemia. It prevents the proliferation of cancer cells by interfering with the microtubule structure during cell division.

[0003] Paclitaxel is mainly found in the bark of yew plants. Therefore, paclitaxel was initially obtained by extracting it directly from the bark of yew trees, but this method caused great damage to the trees and the extraction efficiency was very low. With the development of biotechnology, scientists have developed a variety of methods to produce paclitaxel, including:

[0004] ① Semi-synthetic method: extracting precursor compounds from other Taxus plants and then chemically converting them into paclitaxel; ② Plant tissue culture: Cultivate Taxus plant cells under laboratory conditions and increase the production of paclitaxel through biotechnology; ③Genetic engineering: By introducing genes of the paclitaxel synthesis pathway into microorganisms or plants, they are enabled to produce paclitaxel.

[0005] Currently, paclitaxel and its derivatives (such as docetaxel) have become indispensable drugs in many cancer treatment programs. With the advancement of biotechnology, the production method of paclitaxel is also being optimized to reduce the impact on the environment and improve production efficiency.

[0006] Endophytic fungi refer to symbiotic fungi that exist in disease-free tissues. Since they live in symbiosis with host plants throughout their entire life cycle, they are often able to produce a variety of large quantities of novel and highly active secondary metabolites. The endophytic fungus Taxomyces andreana isolated from the bark of Taxus brevifolia can produce paclitaxel analogs, which has attracted great attention. The active ingredients produced by endophytic fungi are both drug precursors and important partners in plant growth and development. Some endophytic fungi can promote the growth of host plants, enhance the host's stress resistance, and promote the synthesis and accumulation of active ingredients in host plants, which can play a positive role in improving plant yield and quality. Summary of the invention

[0007] The first object of the present invention is to provide an application of an endophytic fungus HKL06 in increasing the content of paclitaxel. The endophytic fungus HKL06 is isolated and purified from Taxus chinensis, a plant of the genus Taxus, and is taxonomically named Diaporthe celeris HKL06. The strain has a preservation number of CCTCC NO: M2024234, a preservation date of January 26, 2024, a preservation unit: China Center for Type Culture Collection (CCTCC), and a preservation address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0008] Preferably, the ITS base sequence of the endophytic fungus HKL06 is shown as SEQ ID NO.1.

[0009] Preferably, the endophytic fungus HKL06 increases the expression level of key genes in the paclitaxel synthesis pathway and promotes paclitaxel synthesis.

[0010] The second object of the present invention is to provide a method for increasing the content of paclitaxel in the needles of Taxus chinensis var. mairei, comprising the following steps: The spores of the endophytic fungus HKL06 were sprayed on the seedlings of Taxus chinensis var. mairei; The preparation process of the spore liquid is as follows: the endophytic fungus strain HKL06 of Taxus chinensis needles is inoculated into a culture medium for cultivation, and after spores are generated, the spore liquid is obtained by vacuum filtration.

[0011] Preferably, the culture medium is PDA solid culture medium (potato dextrose broth).

[0012] Preferably, the culture conditions are: constant temperature 25-30°C in the dark for 5-7 days.

[0013] The third object of the present invention is to provide a composition for increasing the paclitaxel content in needles of Taxus chinensis var. mairei, comprising: endophytic fungus HNU21, or cell culture, cell metabolites, cell culture supernatants or cell lysates thereof.

[0014] The beneficial effects of the present invention are: The present invention provides an application of endophytic fungus strain HKL06 of Taxus chinensis in increasing the content of paclitaxel, and specifically involves spraying a filtered spore suspension directly on the seedling twigs of Taxus chinensis. This method can significantly promote the biosynthesis process of paclitaxel, an important medicinal ingredient, in the plant body, and enhance the gene expression related to paclitaxel synthesis. The present invention not only increases the yield of paclitaxel, but also helps to optimize its production process, thereby having significant practical value and broad market prospects in the field of medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1:The colony morphology of Diaporthe celeris HKL06 on solid culture medium.

[0016] Figure 2 :Mycelial and spore morphology of Diaporthe celeris HKL06 under optical microscope.

[0017] Figure 3 :Agarose gel electrophoresis of the ITS sequence of Diaporthe celeris HKL06.

[0018] Figure 4 :Phylogenetic tree of Diaporthe celeris HKL06.

[0019] Figure 5 : Bar graph showing that infection of Diaporthe celeris HKL06 increases the content of paclitaxel in leaves of Taxus chinensis var. mairei.

[0020] Figure 6 : Diaporthe celeris HKL06 infection increases the expression of key genes in the paclitaxel pathway in the leaves of Taxus chinensis var. mairei. DETAILED DESCRIPTION

[0021] The specific implementation methods of the present invention are described in detail below with reference to the embodiments.

[0022] Example 1: Isolation, identification and preservation of Diaporthe celeris HKL06: Endophytic fungi were obtained as follows: (1) Rinse the healthy two-year-old stem segments of freshly picked southern yew under tap water for 30 minutes to remove the visible sludge on the surface, dry the surface moisture with filter paper, and place them on a clean workbench. Soak and disinfect in 75% alcohol for 1 min. During the process, shake the beaker continuously to ensure that the yew tissue is in full contact with the alcohol. Then wash three times with sterile water to remove the residual alcohol on the tissue surface. Then use 0.1% HgCl 2 For 5 min, the plant material was placed in a clean beaker and washed 4 to 5 times to remove the residual HgCl on the tissue surface. 2 To verify whether the disinfection is thorough, 100 μL of sterile water from the last wash is applied as a control. If no bacteria grow after culturing at 26°C for 3 to 5 days, the disinfection is considered effective.

[0023] (2) Use a scalpel to peel the disinfected stem nodes and cut the stem bark into 5 mm small sections; spread the processed plant materials flat on the PDA culture medium, place three to four pieces of material in each culture dish, and culture them at a constant temperature of 26°C in the dark. Mycelium will grow from the tissue blocks after three to seven days of culture. After inoculation, use an inoculation needle to transfer from the edge of the stem bark wound to a new PDA plate every 12 hours. Observe the phenotypic characteristics of the transferred fungal colonies, pick the hyphae at the edge of a single colony, and streak culture on a new PDA plate. After continuous purification for 3 times, pick a small amount of hyphae and observe under a microscope. If there are no other bacteria, it can be considered a single strain. After obtaining a single strain, inoculate it on a PDA slant and store it at 4°C. Figure 1 As shown in Figure 1, the solid culture characteristics of HKL06 are white colonies. Under the microscope, the morphological characteristics are transparent hyphae with bifurcations, such as Figure 2 shown.

[0024] The PDA culture medium of the present invention is formulated as follows: 200.0 g / L potato, 50.0 g / L glucose, and NH 4 NO 3 6.0g / L, anhydrous MgSO 4 0.3 g / L, KH 2 PO 4 0.5 g / L, Vitamin B 1 0.05 g / L.

[0025] (3) DNA of endophytic fungi strains of Taxus chinensis was extracted using the TIANGEN Plant Genomic DNA Extraction Kit and used as a template to amplify the ITS sequence. The primers were ITS4 (SEQ ID NO.2: 5'-TCCTCCGCTTTATTGATATGC-3') and ITS5 (SEQ ID NO.3: 5'-GGAAGTAAAGTCGTAACAAGG-3'). The PCR reaction system was 2×Taq MasterMix (Dye), 25 μL; ITS5 (10 μM), 2 μL; ITS4 (10 μM), 2 μL; Template DNA, 3 μL; ddH 2 O, 18 μL. The PCR reaction program was 94℃ pre-denaturation for 2 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 30 s, denaturation-annealing-extension cycle for 30 times, and 72℃ final extension for 2 min. 1% agarose gel electrophoresis was used to detect whether the amplification was successful. Figure 3 The successful PCR product was sent to Zhejiang Shangya Biotechnology Co., Ltd. for sequencing. The ITS sequence of the endophytic fungus HKL06 described in the present invention was amplified by PCR, and the gel electrophoresis of the product was shown in Figure 3The sequence obtained by sequencing is shown in SEQ ID NO.1. The sequencing results were compared using the NCBI website and the similarity with the known Diaporthe celeris NR_158433 was 99.28%.

[0026] SEQ ID NO1: HKL06 gtcctacctgatccgaggtcaattttcagaagttgggggtttaacggcagggcaccgccagggccttccagagcgagggtttaactactgcgctcggggtcctggcgagctcgccactgaatttcagggcctgcttcttg ggtaagaagcagtgccccatcaccaagccaggcttgagggttgaaatgacgctcgaacaggcatgccctccggaataccagagggcgcaatgtgcgttcaaagattcgatgattcactgaattctgcaattcacattactt atcgcatttcgctgcgttcttcatcgatgccagaaccaagagatccgttgttgaaagttttgattcatttatgttttgtgctcagagtttcagtgtaaaaacaagagttgggttggccgccggcgggccgtctcaacaccc gggggtgaggggccccggaggaccagctagcgccgaggcaacagtaaggtataagttcacaaagggtttctgggtgcgcctggggcgcgttccagcaatgatccctccgctggttcaccaacggagaccttgttacgatct Example 2: Construction and analysis of homologous evolutionary tree of endophytic fungus HKL06 The ITS sequence of the endophytic fungus HKL06 was used as the target sequence, and the homologous sequences were searched in the GenBank database of NCBI. The sequence closest to the ITS sequence of the endophytic fungus HKL06 was downloaded as the reference sequence, and the phylogenetic tree was constructed using MEGA 11 software. It was highly homologous to the known fungi of the genus Metaspore. Figure 4 .

[0027] Example 3: Preparation and application of spore solution of endophytic fungus HKL06 of Taxus chinensis (1) Use an inoculation needle to pick up a 5 mm × 5 mm endophytic fungus block of Taxus chinensis preserved on the upper of a shoe, invert it on a V8 medium, and culture it at a constant temperature of 26°C in the dark for 5 to 7 days until the fungus produces spores. Add 2 mL of sterile water to the solid plate, scrape the hyphae and spores with a coating stick to obtain a mixed solution, fold three layers of gauze into a funnel shape, and filter the mixed solution at the ninth layer to obtain a spore solution (all the above steps are completed on a clean bench). Count the spores under an optical microscope, and adjust the concentration of the obtained fungal spore solution to 1×10 6 pcs / mL for future use.

[0028] (2) Place soaked sterile filter paper on a tray, cut stems and leaves of Taxus chinensis var. mairei of similar age and length about 20 cm, wash them 2-3 times with sterile water, and place the leaves with the lower epidermis facing up on the filter paper. Spray 20 mL of fungal spore solution evenly on the leaf surface, and spray the same amount of sterile water on the control group. Wrap the tray with plastic wrap and let it stand for 48 hours, then cut the leaves, wash them with sterile water, and freeze them in liquid nitrogen and place them in a -80℃ refrigerator for later use.

[0029] Example 4: Effect of endophytic fungus HKL06 on the content of paclitaxel in leaves of Taxus chinensis (1) All extraction reagents were precooled at -20°C before use. Weigh 60 mg of leaves into a 1.5 mL centrifuge tube, add an appropriate amount of small steel beads and 600 μL of methanol-water (V:V=7:3, containing mixed internal standard, 4 μg / mL); precool in a -40°C refrigerator for 2 min, put into a grinder, grind at 60 Hz for 2 min; ultrasonic extraction in an ice water bath for 30 min, stand at -40°C overnight; centrifuge at 12000 rpm for 10 min, draw 150 μL of supernatant with a syringe, filter with a 0.22 μm organic phase pinhole filter, transfer to an LC injection vial, and store at -80°C for later use; mix equal volumes of the extracts of all samples to make quality control samples (QC).

[0030] (2) The samples were detected using a Waters ACQUITY UPLC I-Class plus ultra-high performance liquid phase tandem high-resolution mass spectrometer. Chromatographic conditions: Chromatographic column: ACQUITY UPLC HSS T3 (100 mm×2.1 mm, 1.8 μm); column temperature: 45°C; mobile phase: water (containing 0.1% formic acid), acetonitrile; flow rate: 0.35 mL / min; injection volume: 3 μL; elution gradient: 0 min water: acetonitrile volume ratio of 95:5, 4 min water: acetonitrile volume ratio of 70:30, 8 min water: acetonitrile volume ratio of 50:50, 10 min water: acetonitrile volume ratio of 20:80, 14 min water: acetonitrile volume ratio of 0:100, 15.1 min water: acetonitrile volume ratio of 95:5. The separated samples were subjected to mass spectrometry analysis. Mass spectrometry conditions: The sample mass spectrometry signal was acquired by scanning positive and negative ions separately, and the specific acquisition mode was DDA (data dependent acquisition) data dependent scanning mode.

[0031] (3) The change of the mass-to-charge ratio (m / z) between 876.4→308.1 was used for the quantitative analysis of paclitaxel, and the change of the mass-to-charge ratio (m / z) between 876.4→531.2 and 876.4→591.4 was used for the verification analysis of paclitaxel. Paclitaxel (≥99%; CAS: 33069-62-4) standard was purchased from Aladdin Biochemical Technology (Shanghai, China) Co., Ltd. Figure 5 As shown, CK is the control group and HNU21 is the experimental group.

[0032] Example 5: Effect of endophytic fungus HKL06 on the expression levels of taxol synthesis-related genes in leaves of Taxus chinensis var. mairei (1) Total RNA from the HKL06 experimental group and the control group was extracted using the TIANGEN RNAprep Pure Plant Kit. After passing the quality inspection, the transcriptome library was constructed and sequenced. The integrity of the total RNA of the samples was detected using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA), and the transcriptome library was constructed using the VAHTS Universal V5 RNA-seq Library Prep Kit. The library was sequenced using the Illumina Novaseq 6000 sequencing platform to generate 150 bp double-end reads; fastp software was used for processing to obtain clean reads for subsequent data analysis.

[0033] (2) HISAT2 software was used to align the genome of Taxus chinensis and calculate gene expression (FPKM). HTSeq-count was used to obtain the read counts of each gene. R (v 3.2.0) was used to perform PCA analysis and plot the samples to evaluate the biological replication of the samples. DESeq2 software was used to perform differentially expressed gene analysis, and differentially expressed genes (DEGs) were defined as genes that met the thresholds of P value < 0.05 and foldchange > 2 or foldchange < 0.5.

[0034] (3) The taxol biosynthesis-related genes and their IDs to be detected are: TS (ctg5306_gene.4), TS (ctg7747_gene.1), T13OH (ctg593_gene.12), TBT (ctg4165_gene.7), T5OH (ctg11276_gene.1), DBTNBT (ctg195_gene.25) and T7OH (ctg12564_gene.1). The expression levels of taxol biosynthesis-related genes in taxus chinensis treated with endophytic fungus HKL06 are shown in the figure. Figure 6 shown.

Claims

1. The use of endophytic fungus HKL06 in increasing the content of paclitaxel, characterized in that: The taxonomic name of the endophytic fungus HKL06 is Diaporthe celeris HKL06, the preservation number is CCTCC NO: M2024234, and the preservation date is January 26, 2024.

2. The use according to claim 1, characterized in that: The ITS base sequence of the endophytic fungus HKL06 is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: The endophytic fungus HKL06 increases the expression level of key genes in the paclitaxel synthesis pathway and promotes the synthesis of paclitaxel.

4. A method for increasing the content of paclitaxel in the needles of Taxus chinensis var. mairei, characterized in that: The method comprises the following steps: Spraying the spore liquid of the endophytic fungus HKL06 on the seedlings of Taxus chinensis var. mairei; the taxonomic name of the endophytic fungus HNU21 is Diaporthe celeris HKL06, the deposit number is CCTCC NO: M2024234, and the deposit date is January 26, 2024; The preparation process of the spore liquid is as follows: the endophytic fungus strain HKL06 of Taxus chinensis needles is inoculated into a culture medium for cultivation, and after spores are generated, the spore liquid is obtained by vacuum filtration.

5. The method according to claim 4, characterized in that The culture medium is PDB solid culture medium.

6. The method according to claim 4, characterized in that The culture conditions are: constant temperature of 26~28℃ and dark culture for 5~7 days.

7. A composition for increasing the paclitaxel content in needles of Taxus chinensis var. mairei, characterized in that: It comprises: endophytic fungus HNU21 or its cell culture, cell metabolites, cell culture supernatant or cell lysate; the taxonomic name of the endophytic fungus HNU21 is Diaporthe celeris HKL06, the preservation number is CCTCC NO: M2024234, and the preservation date is January 26, 2024.

Images