Application of deubiquitinating enzyme inhibitor in preparation of medicine for preventing and treating acute ischemic stroke

Abstract

The invention discloses application of a deubiquitinating enzyme inhibitor in preparation of a medicine for preventing and treating acute ischemic stroke, and belongs to the technical field of biological medicines. A middle cerebral artery occlusion / reperfusion (MCAO / R) model is established to simulate in-vivo ischemic cerebral apoplexy, an oxygen-glucose deprivation / reoxygenation (OGD / R) model is established to simulate in-vitro cerebral apoplexy, and research finds that the pharmacological inhibitor LN5P45 of OTUB2 can relieve ischemic brain injury of mice and reduce neuronal death induced by ischemia of human brain organs; the invention adopts polyacrylamide gel electrophoresis (SDS-PAGE), 2, 3, 5-triphenyl tetrazole chloride (TTC) staining, immunofluorescence staining (IF) and other technologies for characterization analysis, and the result shows that the LN5P45 can significantly alleviate neuronal necrosis caused by cerebral arterial thrombosis, and shows a potential drug prospect for treating cerebral arterial thrombosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to the use of a deubiquitinase inhibitor in the preparation of a drug for preventing and treating acute ischemic stroke. Background Art

[0002] Stroke is divided into ischemic stroke and hemorrhagic stroke. It is a disease caused by damage to cerebral blood vessels due to various reasons, which in turn causes focal or global brain tissue damage. Ischemic stroke is the main cause of disability and death, with high incidence, high recurrence rate, high mortality rate and serious economic burden. About 3 million people die from this disease every year worldwide. At present, tissue plasminogen activator (tPA) thrombolytic therapy and mechanical thrombectomy are the two main methods to restore blood supply to ischemic stroke. However, due to the narrow treatment time window and the risks of blood reperfusion injury, new treatment options are urgently needed to alleviate the treatment pressure.

[0003] Blood reperfusion may induce secondary brain injury, known as cerebral ischemia / reperfusion (CI / R) injury. CI / R injury involves multiple mechanisms, including calcium overload, excitotoxicity, mitochondrial dysfunction, oxidative stress, blood-brain barrier disruption, and inflammatory response, which ultimately lead to neuronal death and neurological deficits. Among them, programmed cell death (PCD) mediated by TNF receptor type 1 (TNFR1) and FAS plays a key role after the interruption of neuronal oxygen and glucose supply. In the PCD mechanism, necroptosis can be rapidly induced after ischemic stroke. During the necrosis process, cells rupture and release proinflammatory contents, which in turn activate immune cells resident or infiltrating in the brain, triggering a neuroinflammatory response.

[0004] During neuronal necrosis, there is a close regulatory relationship between the RIPK1-RIPK3-MLKL necroptosis signaling pathway and ubiquitination (an important post-translational modification). Ubiquitination refers to the process in which ubiquitin molecules are covalently bound to target proteins under the catalysis of a series of enzymes. This process involves three synergistic enzymes: E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme and E3 ubiquitin ligase. Ubiquitination participates in the regulation of various biological processes by regulating the stability, localization, activity and other functions of protein substrates. It is worth noting that ubiquitination is a reversible process, and deubiquitinating enzymes (DUBs) can reverse ubiquitination modification by hydrolyzing peptide bonds or isopeptide bonds between ubiquitin molecules or between ubiquitin and substrate proteins. Otubain2 (OTUB2) is a deubiquitinating enzyme that belongs to the ovarian tumor (OTU) protein superfamily. It is highly expressed in neurons and plays a key regulatory role in the process of neuronal death. LN5P45 is a small molecule inhibitor of OTUB2, which inhibits the function of OTUB2 by covalently reacting with cysteine ​​51 in the active site of OTUB2. This study aims to explore the therapeutic effect of LN5P45 in stroke; by inhibiting the activity of OTUB2 and regulating the neuronal necroptosis signaling pathway, it provides new strategies and potential treatments for the prevention and treatment of acute stroke. Summary of the invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a deubiquitinase inhibitor for use in the preparation of a drug for preventing and treating acute ischemic stroke.

[0006] In order to achieve the above object, the present invention is implemented through the following technical solutions:

[0007] A use of a deubiquitinase inhibitor in the preparation of a drug for preventing and treating acute ischemic stroke, wherein the deubiquitinase is OTUB2; the deubiquitinase inhibitor is a compound LN5P45, and its structural formula is:

[0008] The deubiquitinase OTUB2 inhibitor LN5P45 increases the k48 ubiquitination of RIPK3 by inhibiting the activity of OTUB2 protein, thereby reducing the RIPK3 protein level and the phosphorylation levels of RIPK3 and MLKL, thereby alleviating ischemia-induced neuronal death.

[0009] The deubiquitinase inhibitor LN5P45 is used alone or in combination with other drugs.

[0010] The present invention also includes the use of a deubiquitinase inhibitor in the preparation of a drug for preventing and treating acute ischemic stroke.

[0011] The inhibitor LN5P45 of the present invention achieves the effect of inhibiting OTUB2 by covalently reacting with cysteine ​​51 at the active site of the deubiquitinating enzyme OTUB2, and is used in the preparation of a drug for treating or alleviating ischemic stroke.

[0012] Compared with the prior art, the present invention has the following advantages:

[0013] The present invention proposes for the first time that LN5P45, a small molecule inhibitor of the deubiquitinase OTUB2, can be used to treat stroke. LN5P45 reduces the level of RIPK3 protein in neuronal HT22 cells in a dose-dependent manner and reduces necroptosis of neuronal HT22 cells by increasing K48 ubiquitination of RIPK3, clarifying the potential functional effects of LN5P45 on neurons in vitro.

[0014] The present invention simulates ischemic stroke in vivo by establishing a middle cerebral artery occlusion / reperfusion (MCAO / R) model, and simulates in vitro stroke by an oxygen-glucose deprivation / reoxygenation (OGD / R) model. The study found that LN5P45 can pass through the mouse blood-brain barrier, show a good mitigation effect in transient ischemic stroke, and significantly reduce cerebral ischemic injury and neurological damage. In addition, after LN5P45 was given to human brain organoids differentiated from H9-hESC cells, immunofluorescence analysis showed that it significantly reduced oxygen-glucose deprivation-induced MLKL phosphorylation and neuronal loss. Therefore, LN5P45 has important application prospects in the preparation of drugs for the treatment of acute ischemic stroke.

[0015] The present invention uses polyacrylamide gel electrophoresis (SDS-PAGE), 2,3,5-triphenyltetrazolium chloride (TTC) staining and immunofluorescence staining (IF) and other techniques for characterization and analysis. Studies have shown that LN5P45 can significantly reduce neuronal necrosis caused by ischemic stroke, showing potential as a drug for the treatment of ischemic stroke. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The immunoblot images and quantitative statistical graphs of LN5P45 in HT22 cells in vitro; (A) is the immunoblot image and statistical analysis of LN5P45 acting on HT22 cells, n=3 / group; (B) is the immunoblot image of LN5P45 on RIPK3 ubiquitination; (C) is the statistical analysis of CCK-8 detection of cell viability, n=12 / group;

[0017] Figure 2 The chromatogram of LN5P45 passing through the blood-brain barrier; (A) is a schematic diagram of sample processing;

[0018] (B) LC-MS chromatogram obtained for MRM scan;

[0019] Figure 3 The in vivo MCAO model was established by LN5P45 administration; (A) is the experimental flow chart of LN5P45 administration; (BC) are representative TTC staining images (B) and cerebral infarction volume percentage images (C) on the third day after gradient administration of MCAO, n = 5 mice / group; (D) is the neurological function image evaluated by mNSS score on the third day after MCAO, n = 5 mice / group;

[0020] Figure 4 The figures are immunofluorescence analysis of the ischemic penumbra of mice; (A) is the immunofluorescence analysis of RIPK3 phosphorylation in the ischemic penumbra 6 h after MCAO; scale bar, 100 μm; (B) is the immunofluorescence analysis of MLKL phosphorylation in the ischemic penumbra 6 h after MCAO; scale bar, 100 μm; Figure 5 Figure 2 shows the application of LN5P45 in human brain organoids; (A) is a schematic diagram of the generation of human brain organoids and growth diagrams at different stages; scale bar, 100 μm; (B) is a flowchart of the experimental analysis of brain organoids; (CD) are OGD 6h, reoxygenation 12h; immunofluorescence analysis of brain organoids; representative images (C) and percentage of p-MLKL and neurons (D); scale bar, 50 μm; n = 3 organoids / group; (EF) are OGD 12h, reoxygenation 12h; immunofluorescence analysis of brain organoids; representative images (E) and quantified images (F); scale bar, 50 μm; n = 3 organoids / group. DETAILED DESCRIPTION

[0021] In order to better understand the technical solution of the present invention, the above content of the present invention is further described in detail below through specific implementation methods in the form of embodiments, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above content of the present invention belong to the scope of the present invention.

[0022] Animal origin and breeding

[0023] Experimental animals: C57BL / 6 mice and Otub2 + / - (C57BL / 6 background) provided by Saiye Biotechnology Co., Ltd. + / - Breeding of heterozygous mice to obtain Otub2 + / + and Otub2 - / - Homozygous mice in which Otub2 - / - Homozygous mice have exons 3 and 4 of Otub2 deleted. - / - The genotype of homozygous mice was determined by PCR identification of mouse tail genomic DNA. The PCR primer sequences were as follows:

[0024] Primer 1: forward primer 5′-CACCCCAGGCCTAGTAAAGAAG-3′, reverse primer 5′-TAACACCAGCCTGCTCACCTATC-3′;

[0025] Primer 2: forward primer 5′-TAGGCAACATTGGGGTGGGCAC-3′, reverse primer 5′-TAACACCAGCCTGCTCACCTATC-3′.

[0026] Otub2 was identified by agarose gel electrophoresis. + / + Mouse can amplify a 624bp band, Otub2 + / - Heterozygous mice can amplify 624bp and 434bp bands, Otub2 - / - Homozygous mice only amplified a 434 bp band. Primer 1 was used to detect the 434 bp band, and primer 2 was used to detect the 624 bp band.

[0027] Housing environment: Mice were housed in the Experimental Animal Resource Center of Wenzhou Medical University in a specific pathogen-free (SPF) environment with a temperature of 22-25°C, a humidity of 40-60%, and a 12-h light / dark cycle. All animal experiments were approved by the Animal Management and Ethics Committee of Wenzhou Medical University (approval number: wydw2023-0613). Adult male mice (weight 23-25 ​​g) were used in the in vivo experiments, and mice of the same genotype were randomly assigned to the experimental groups.

[0028] Cell source and culture

[0029] Experimental cells: HT22, NIH / 3T3 and 293T cells were purchased from the National Certified Cell Culture Center (Shanghai, China). - / - The HT22 cell line was constructed using CRISPR / Cas9 gene editing technology. The specific operation was as follows: OTUB2-gRNA (target sequence: GAACTGCACGATTCGGTCCG) was conjugated with a linearized lentiviral vector to construct a plasmid vector with the target sequence. Subsequently, psPAX2, pMD2.G, PEI, and a plasmid vector with an OTUB2 gene fragment were co-transfected into 293T cells and assembled into complete viral particles. The supernatant of 293T cells containing the virus was collected and infected with Otub2. + / + HT22 cells were screened and uninfected HT22 cells were removed by blasticidin. Finally, the expression level of OTUB2 protein was detected by polyacrylamide gel electrophoresis (SDS-PAGE).

[0030] Human embryonic stem cells (hESCs; H9 cell line) were also obtained from a nationally certified cell culture center.

[0031] Cell culture: HT22, NIH / 3T3 and 293T cells were cultured in DMEM medium (Gibco, 11965118) supplemented with 10% fetal bovine serum (FBS; Vazyme, F101-01) and 1% penicillin-streptomycin liquid (Solarbio, P1400). Human embryonic stem cells (hESCs; H9 cell line) were cultured using mTeSR matrix (Corning, 354277) TM Culture medium (STEMCELL Technologies, 85850).

[0032] Example 1 Study on the effect and mechanism of LN5P45 in neuronal HT22 cells

[0033] Previous studies have shown that OTUB2 protein can bind to RIPK3 protein in the necroptosis pathway and stabilize RIPK3 protein expression. OTUB2 is mainly expressed in neurons, and its loss reduces neuronal necrosis mediated by receptor-interacting protein kinase 3 (RIPK3). Considering the effect of OTUB2 small molecule inhibitor LN5P45 in target cells HT22, the following experimental steps are described:

[0034] Step 1: Observe the effect of different concentrations of LN5P45 on RIPK3 protein expression in HT22 cells

[0035] (1) The LN5P45 inhibitor (MedChemExpress, HY-149482) powder was dissolved in 1% DMSO and diluted to five concentrations of 0 μM, 5 μM, 10 μM, 20 μM and 40 μM and acted on Otub2 + / + HT22 cells;

[0036] (2) After culturing the cells for 6 hours, collect the cell protein lysate for polyacrylamide gel electrophoresis. The specific steps are as follows: Use protein extraction reagent (Boster Bio, AR0103) to extract total cell protein, and add protease inhibitors (APE×BIO, K4002) and phosphatase inhibitors (APE×BIO, K1015) for lysis. After incubation on ice for 30 minutes, use a scraper to scrape the protein lysate into a 1.5mL EP tube, centrifuge at 12000rpm for 15 minutes at 4°C, and collect the supernatant. Use QuickStart TM The protein concentration was determined by Bradford protein assay kit (BIO-RAD, 5000201).

[0037] The protein samples were mixed with 5×DualColor protein loading buffer (Fude Biotechnology, FD006), heated at 100°C for 10 minutes, and separated by SDS-PAGE electrophoresis. The proteins were then transferred to a PVDF membrane (Cytiva, 10600023) and blocked with 5% skim milk (Biofroxx, 1172GR500) for 1 hour. After blocking, the membranes were incubated with OTUB2 (Novus Biologicals, NBP2-03223, 1:1000), RIPK3 (Cell Signaling Technology, 95702S, 1:1000) and GAPDH (Proteintech, 60004-1-Ig, 1:1000) antibodies at 4°C overnight. The next day, the membranes were incubated with the corresponding secondary antibodies at room temperature for 1 hour.

[0038] Finally, protein bands were exposed using Ncm ECL Ultra chemiluminescent reagent (New Cell & Molecular Biotech, P10300), immunoblot images were acquired using The Fusion FX.EDGE system (Vilber), and band intensities were quantified using ImageJ software.

[0039] Step 2: Exploring the effect of LN5P45 inhibitor on RIPK3 K48 ubiquitination in vitro

[0040] (1) Plasmids encoding GFP-RIPK3 and HA-K48 Ub were constructed by GeneCare (Shanghai, China). All plasmid constructs were verified by DNA sequencing.

[0041] (2) GFP-RIPK3 and HA-K48 Ub plasmids were transfected into NIH / 3T3 cells using Lipofectamine 3000 (Thermo Fisher Scientific, L3000015). The transfection concentration of all plasmids was 1000 ng / μg / 6 cm 2 Opti-MEM was used for transfection TM Culture medium. DMEM culture medium (containing 10% fetal bovine serum and excluding 1% penicillin-streptomycin) was used throughout the cell culture process, and normal culture medium was replaced 8 hours after transfection. When the culture reached 18 hours, MG132 (5 μM) was added and cultured for another 6 hours.

[0042] (3) Cell protein lysates were collected and subjected to polyacrylamide gel electrophoresis, incubated with GFP tag (Proteintech, 50430-2AP, 1:1000), HA tag (Proteintech, 51064-2-AP, 1:1000) and GAPDH (Proteintech, 60004-1-Ig, 1:1000) antibodies, and immunoblot images were analyzed using The Fusion FX.EDGE system.

[0043] Step 3: Detect the effect of LN5P45 inhibitor on apoptosis in HT22 cells

[0044] (1) Otub2 + / + HT22 and Otub2 - / - HT22 cells were cultured at 1-3×10 3 The cells were uniformly cultured in 96-well plates (12 wells / group) and cultured in a cell culture incubator containing 5% CO2 and 95% air.

[0045] (2) The next day, cells were pretreated with 50 μM Cycloheximide (CHX; Merck, 239763-M) and 20 μM Z-VAD-FMK (MedChemExpress, HY-16658B) for 0.5 h, and then 20 ng / ml Tumor necrosis factor-α (TNF-α; PeproTech, 315-01A) was added and cultured for another 6 h to induce cell death.

[0046] The CCK-8 kit (New Cell and Molecular Biotechnology, C6005) was diluted to a DMEM solution containing 10% CCK-8 using DMEM culture medium. The stimulant and culture medium in the culture dish were removed, and a DMEM solution containing 10% CCK-8 was added and cultured for 1-4 hours. Subsequently, the cell absorbance was measured at a wavelength of 450 nm using a Multiskan SkyHigh microplate spectrophotometer (Thermo Fisher Scientific).

[0047] The experimental results showed that after LN5P45 treatment of HT22 cells, the level of RIPK3 protein decreased in a dose-dependent manner (e.g. Figure 1 Mechanistic studies have shown that LN5P45 promotes RIPK3 degradation by increasing K48 ubiquitination (as shown in Figure 1 (B)). Under TNF-α+CHX+Z-VAD-FMK (TCZ) stimulation, LN5P45 treatment significantly reduced Otub2 + / + Cell necrosis (eg Figure 1These results elucidate the potential functional effects of LN5P45 on HT22 neuronal cells in vitro and lay the foundation for further in vivo studies.

[0048] Example 2: LN5P45 can cross the blood-brain barrier after stroke model

[0049] Step 1: Collect test samples for drug residue analysis

[0050] (1) Experimental groups: The samples were divided into the following four groups: ① LN5P45 standard solution ② Brain tissue of mice that survived 1 h after MCAO / R modeling without LN5P45 ③ Brain tissue of mice that survived 1 h after MCAO / R modeling with LN5P45 injected intraperitoneally ④ Brain tissue of mice that survived 3 h after MCAO / R modeling with LN5P45 injected intraperitoneally.

[0051] (2) Wild-type healthy mice were randomly divided into three groups, with 2 mice in each group. The first group of mice were anesthetized with isoflurane (RWD life science, R510-22-10) and then subjected to MCAO / R modeling. The brain tissue of the mice was obtained after 1 hour of survival. The second group of mice were anesthetized with isoflurane and then subjected to MCAO / R modeling. 1 hour later, 20 mg / kg LN5P45 was intraperitoneally injected. The brain tissue of the mice was obtained after 1 hour of survival. The third group of mice were anesthetized with isoflurane and then subjected to MCAO / R modeling. 1 hour later, 20 mg / kg LN5P45 was intraperitoneally injected. The brain tissue of the mice was obtained after 3 hours of survival. In the in vivo experiment, LN5P45 was dissolved and diluted with corn oil (MedChemExpress, HY-Y1888).

[0052] The mouse ischemic stroke experiment used the middle cerebral artery occlusion / reperfusion (MCAO / R) model. The specific steps are as follows: During the operation, mice were anesthetized with 2% isoflurane mixed with air, and the body temperature was maintained by an electric heating blanket. The hair on the left neck was shaved and disinfected with iodine, and the skin was incised along the left side of the midline of the neck. Blunt separation was performed to expose the common carotid artery (CCA), internal carotid artery (ICA) and external carotid artery (ECA). A slipknot was tied at the proximal end of the CCA, a dead knot was tied at the distal end of the ECA, and a virtual knot was tied at the bifurcation of the ECA and ICA. The ICA was clamped with an artery clamp to block the blood flow, a small cut was made at the proximal end of the ECA, and a mouse suture (RWD life science, MSMC21B120PK50) was inserted into the ICA. When the silicon-coated tip of the suture reached the middle cerebral artery (MCA), it indicated that the suture had successfully blocked most of the left hemisphere blood flow. Laser Doppler blood flow meter (Perimed) was used to monitor cerebral blood flow. When cerebral blood flow dropped below 25% of the baseline, the MCAO surgery was successful. After 70 minutes of occlusion, the suture was removed to restore cerebral blood flow to 50% of the baseline. The sham operation group was the same as the MCAO group except that the suture was not inserted.

[0053] Step 2: Prepare and purify biological samples for mass spectrometry

[0054] The mouse brain tissue sample was mixed with a sterile PBS solution and homogenized thoroughly using a tissue homogenizer, and 1 / 10 of it was used to prepare the biological sample. The brain tissue was mixed with a methanol and acetonitrile solution (UPLC grade, 1:1), ultrasonically treated for 15 minutes, and then centrifuged at 12000 rpm for 15 minutes at 4°C to collect the supernatant. The supernatant was concentrated to complete dryness in a vacuum concentrator and dried, and acetonitrile and purified deionized water (UPLC grade, 1:1) were added for re-dissolution. After ultrasonic treatment for 15 minutes, it was centrifuged at 12000 rpm for 15 minutes at 4°C, and the supernatant was collected again. The supernatant was filtered through a 0.22 μm filter membrane to collect the purified biological sample, and the sample was diluted to a concentration of less than 1 μg / mL and placed in a sample vial.

[0055] Step 3: Analyze the residual LN5P45 content in the sample by liquid chromatography-mass spectrometry (LC-MS / MS)

[0056] LC-MS / MS analysis was performed using a SCIEX Triple Quadrupole Mass Spectrometer. TM 4500MD) equipped with Kinetex C18 column ( 2.6μm, 100mm×2.1mm). Electrospray ionization (ESI) was performed in positive ion mode, with a scanning mass range of m / z 5-2000amu, a scanning speed of 12000amu / sec, and a detection mode of multiple reaction monitoring (MRM). Two mobile phases were used for sample analysis: phase A was purified deionized water containing 0.1% formic acid, and phase B was acetonitrile (UPLC grade). The UPLC-MS program was set as follows: the flow rate was 0.40mL / min, the running time was 10 minutes, and the initial conditions were 90% phase A and 10% phase B. The gradient program was as follows: the proportion of phase A gradually decreased within 1.0 minutes, and changed to 10% phase A and 90% phase B at 3.0 minutes, and maintained until 5.0 minutes; then it was restored to the initial conditions within 7.0 minutes. The MRM parameters were set as follows: Q1 was 267.200Da, Q3 was 188.900Da and 174.900Da, declustering potential (DP) was 134V, and collision energy (CE) was 13eV and 21eV, respectively. All data were acquired using MultiQuant TM The analysis was performed using SCIEX 3.0.3 mass spectrometry software.

[0057] Sample processing procedures such as Figure 2 (A) As shown. The experimental results showed that when LN5P45 was administered 1 hour after MCAO / R modeling, LN5P45 compounds were detected in the brain tissues of mice with early disease (surviving 1 hour and 3 hours), indicating that LN5P45 can pass through the blood-brain barrier and enter the brain tissues of MCAO / R model mice and exert its effects (such as Figure 2 (as shown in (B)).

[0058] Example 3 Administration of LN5P45 can alleviate acute ischemic stroke in mice

[0059] (1) Experimental grouping: Adult male healthy mice were randomly divided into the following four groups: ① Otub2 + / + Mouse MCAO / R model group②Otub2 - / - MCAO / R model group ③ Intraperitoneal injection of 10 mg / kg LN5P45 Otub2 + / + MCAO / R model group ④ Intraperitoneal injection of 20 mg / kg LN5P45 Otub2 + / + Mouse MCAO / R model group.

[0060] (2) Before the operation, the mice were tested and evaluated for three consecutive days to ensure that the mice's own neurological function was not damaged. 1 hour after the MCAO / R modeling surgery, 10 or 20 mg / kg LN5P45 and an equal amount of corn oil were intraperitoneally injected. And 24 hours after the modeling, the same drug and vehicle solution were also given.

[0061] (3) The modified neurological severity score (mNSS) was used to evaluate neurological function 72 hours after the modeling surgery. After the anesthesia treatment was completed, physiological saline was perfused along the left ventricle of the mouse heart to the lung white, kidney white, and liver white of the mouse to complete the mouse perfusion experiment. The intact mouse brain tissue was bluntly removed with forceps for TTC staining.

[0062] Modified Neurological Score (mNSS)

[0063] The mNSS score is used to evaluate the limb movement, sensation, balance and reflex function of mice, using a 0-18 point system, with higher scores indicating more severe neurological damage. Mice with a score of 0 one day after modeling were considered modeling failures and were not included in subsequent experiments. The specific scoring criteria are shown in Table 1.

[0064] The specific steps of 2,3,5-triphenyltetrazolium chloride (TTC) staining are as follows: the brain tissue was frozen at -80°C for 1 minute, and then each brain tissue was cut into 6 slices using a brain slice mold (RWD, 68707). The slices were immersed in 2% TTC solution (Sigma-Aldrich, T8877) and stained at 37°C in the dark for 15 minutes. After staining, the slices were fixed with 4% paraformaldehyde (Solarbio, P1110) and photographed. Finally, the infarct area of ​​each slice was calculated using ImageJ software (NIH Image).

[0065] Infarct area (%) = (contralateral area - ipsilateral non-infarct area) / contralateral area × 100%.

[0066] The experimental procedure of LN5P45 drug administration is as follows Figure 3 (A) As shown. The experimental results showed that administration of gradient concentrations (10 mg / kg and 20 mg / kg) of the OTUB2 inhibitor LN5P45 1 hour after modeling surgery could significantly reduce the expression of Otub2 + / + The cerebral infarction area of ​​mice (eg Figure 3 (BC)) and improve neurological deficits (such as Figure 3 (D) shows that its effect is similar to that of Otub2 - / - The cerebral infarction area and neurological deficit levels of the mice were basically the same. These results show that the OTUB2 inhibitor LN5P45 has a good therapeutic effect in the mouse acute ischemic stroke model.

[0067] Table 1mNSS scoring screening table

[0068]

[0069] Example 4 Administration of LN5P45 reduces MCAO / R-induced activation of RIPK3 and MLKL

[0070] Step 1: Collect brain tissue from early stroke mice

[0071] (1) Experimental grouping: Adult male healthy mice were randomly divided into the following three groups: ① Otub2 + / + Mouse MCAO / R model group②Otub2 - / - MCAO / R model group ③ Intraperitoneal injection of 10 mg / kg LN5P45 Otub2 + / + Mouse MCAO / R model group.

[0072] (2) The three groups of experimental mice were pre-medicated with intraperitoneal injection of 10 mg / kg LN5P45 and an equal amount of corn oil, and then underwent MCAO / R modeling surgery.

[0073] (3) After the operation, the mice were kept alive for 6 h and anesthetized. Physiological saline and 4% paraformaldehyde were perfused along the left ventricle of the mouse heart until the lung, kidney and liver were filled. The mouse perfusion experiment was completed and the intact mouse brain tissue was removed with forceps.

[0074] Step 2: Immunofluorescence staining of mice with early stroke disease

[0075] (1) The brain tissue was fixed with 4% paraformaldehyde overnight, dehydrated with 15% sucrose solution until precipitated, and then dehydrated with 30% sucrose solution until precipitated. The brain tissue was embedded with OCT glue and quickly frozen in a -80°C refrigerator.

[0076] (2) Cut the brain tissue into 5 μm (routine imaging) slices using a freezing microtome.

[0077] Brain sections were fixed in 4% paraformaldehyde for 15 minutes and then permeabilized with 0.5% Triton X-100 (Solarbio, T8200) for 30 minutes. After high-pressure antigen retrieval for 2 minutes, they were blocked with 5% BSA blocking buffer (Solarbio, SW3015) for 60 minutes. Then, they were incubated overnight at 4°C with NeuN (Proteintech, 66836-1-Ig, 1:200), p-RIPK3 (CellSignaling Technology, 91702S, 1:200), and p-MLKL (Abcam, ab196436, 1:200) antibodies. The next day, they were incubated at 37°C for 1 hour with a fluorescently conjugated secondary antibody of the same property (Yeasen Biotechnology). After samples were stained with DAPI (Solarbio, S2110) and sealed, fluorescence images were captured using a FV3000 confocal laser scanning microscope (Olympus) and analyzed using ImageJ software.

[0078] The experimental results showed that LN5P45 administration could significantly reduce the expression of Otub2+ / + Phosphorylation levels of RIPK3 and MLKL in the ischemic penumbra of mice (e.g. Figure 4 (A-B)), which has the same effect as Otub2 - / - Similar levels of phosphorylation were observed in mice.

[0079] Example 5 Administration of LN5P45 reduces OGD / R-induced MLKL phosphorylation and neuronal death

[0080] Step 1: Generation of human brain organoids

[0081] (1) Using STEMdiff TM The Brain Organoid Kit (STEMCELL Technologies, 08570) was used to differentiate H9 hESCs cells into human brain organoids.

[0082] (2) H9 hESCs (9000 cells / well) were seeded into each well of a round-bottom ultra-low attachment 96-well plate and cultured in a formation medium containing the selective ROCK inhibitor Y-27632 (STEMCELL Technologies, 72302); the formation medium contained two reagents: STEMdiff TM Brain Organoid Basal Medium 1 (STEMCELL Technologies, 08572) and STEMdiff TM Brain Organoid Basic Supplement A (STEMCELL Technologies, 08574).

[0083] (3) On day 5, embryoid bodies differentiated from H9 hESCs were transferred to 24-well ultra-low attachment plates containing induction medium; the induction medium had two reagents: STEMdiff TM Brain Organoid Basal Medium 1 and STEMdiff TM Brain Organoid Basic Supplement B (STEMCELL Technologies, 08575).

[0084] (4) After 2 days of culture, the embryoid bodies were embedded in The embryos were then transferred to a 6-well ultra-low attachment plate containing expansion medium (12-16 embryoids / well); the expansion medium contains three reagents: STEMdiff TM Brain Organoid Basal Medium 2 (STEMCELL Technologies, 08573), STEMdiff TM Brain Organoids Basic Supplement C (STEMCELL Technologies, 08576) and STEMdiff TMBrain Organoid Basic Supplement D (STEMCELL Technologies, 08577).

[0085] (5) On day 10, the medium was changed to maturation medium and the organoids were cultured on an orbital shaker (60-90 RPM); the maturation medium contained two reagents: STEMdiff TM Brain Organoid Basal Medium 2 and STEMdiff TM Brain Organoid Basal Supplement E (STEMCELL Technologies, 08578) was used to replace the maturation medium every 3-4 days until the organoids reached maturity on day 30.

[0086] Step 2: Immunofluorescence staining of brain organoids

[0087] (1) Experimental grouping: Mature brain organoids were randomly divided into the following four groups: ① DMSO-controlled oxygen-enriched group ② DMSO-controlled hypoxia group ③ 20 μM LN5P45-treated oxygen-enriched group ④ 20 μM LN5P45-treated hypoxia group

[0088] (2) The brain organoids cultured for 30 days were given 20 μM LN5P45 and DMSO solvent control 6 h in advance according to the above four groups, and then an oxygen glucose deprivation (OGD / R) experiment was performed, that is, the organoids were placed in glucose-free DMEM (Gibco, 11966025) and cultured in a hypoxic chamber (Billup-Rothenberg) filled with 95% N2 and 5% CO2, incubated at 37°C for 6 h, and then the cells were removed from the hypoxic chamber and replaced with standard culture medium. Subsequently, they were further cultured in a standard cell culture incubator containing 95% air and 5% CO2 for 12 h.

[0089] (3) The organoids were fixed overnight in 4% paraformaldehyde in mouse brain tissue, dehydrated with 30% sucrose solution until precipitated, covered with gelatin, transferred to an embedding mold and quickly frozen.

[0090] (4) Cut the brain tissue into 5 μm slices using a freezing microtome.

[0091] (5) Brain tissue sections were subjected to NeuN and p-MLKL co-localization immunofluorescence staining and the percentage of p-MLKL / Neurons was calculated.

[0092] (6) In order to analyze the effect of LN5P45 inhibitor on neuronal death in brain organoids, the experiment used OGD for 12 hours and reoxygenation for 12 hours, and the death of neurons and the quantitative statistics of death were analyzed by immunofluorescence.

[0093] Schematic diagram of the generation of human brain organoids and their growth status at different stages. Figure 5As shown in (A), the experimental analysis process is as follows Figure 5 (B) The experimental results showed that LN5P45 treatment significantly reduced the phosphorylation level of MLKL in brain organoids induced by oxygen-glucose deprivation (such as Figure 5 (CD) ) and neuronal loss (as Figure 5 (EF) These results suggest that pharmacological inhibition of OTUB2 has a significant effect in brain organoids, indicating its potential clinical application value in the treatment of ischemic stroke.

[0094] It can be seen from the experiments and results of Examples 1-5 that pharmacological inhibition of OTUB2 can improve brain damage after ischemic stroke. The LN5P45 drug has important application prospects in the clinical treatment of ischemic stroke and can be used to prepare drugs for preventing and treating acute ischemic stroke.

[0095] Although the above describes the specific implementation methods of the present invention, it does not limit the scope of protection of the present invention. Based on the technical solution of the present invention, various modifications or variations that can be made by those skilled in the art without creative work are still within the scope of protection of the present invention.

Claims

1. Use of a deubiquitinase inhibitor in the preparation of a drug for preventing and treating acute ischemic stroke, characterized in that: The deubiquitinase is OTUB2; the deubiquitinase inhibitor is compound LN5P45, whose structural formula is:

2. Use of a deubiquitinase inhibitor as claimed in claim 1 in the preparation of a drug for preventing and treating acute ischemic stroke, characterized in that: The deubiquitinase inhibitor LN5P45 is used alone or in combination with other drugs.

3. Use of the deubiquitinase inhibitor according to claim 1 in the preparation of a drug for preventing and treating acute ischemic stroke.

Images