Application of salvianolate in preparation of medicine for improving or treating cardiac diastolic insufficiency

Abstract

The invention provides an application of salvianolate in preparation of a medicine for improving or treating cardiac diastolic insufficiency. It is found for the first time that the salvianolate can improve the diastolic function of a mouse suffering from pressure load type cardiac insufficiency, improve and correct calcium transient abnormality in myocardial cells of the mouse, improve the contraction and diastolic functions of sarcocytes of the myocardial cells, relieve myocardial interstitial fibrosis, relieve myocardial fibrosis and relieve myocardial apoplexy. Therefore, the salvianolate has a great application prospect in preparation of the medicine for improving or treating cardiac diastolic insufficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of biomedicine, and in particular to the application of salvianolic acid salt in the preparation of a medicine for improving or treating diastolic dysfunction. Background Art

[0002] Cardiac diastolic dysfunction (CDD) refers to a condition in which the heart's diastolic rate slows or is limited, and it cannot fully relax and effectively fill with blood during diastole. Typical symptoms and signs include exertional palpitations, varying degrees of dyspnea, jugular vein distention, hepatomegaly, edema, moist rales at both lung bases, alternating pulses, diastolic gallop rhythm, and fourth heart sound. Severe left ventricular diastolic dysfunction affects the right ventricle through the ventricular septum, leading to right ventricular diastolic dysfunction, which produces symptoms similar to those caused by systolic dysfunction. Chest X-ray examination shows increased pulmonary venous pressure, enhanced upper lung texture, thinned lower lung texture, enlarged hilar shadow, and pulmonary edema. Despite decades of clinical trial exploration, there is still a lack of effective therapeutic drugs, and the existing standard treatment options have limited clinical efficacy for patients.

[0003] Therefore, it is necessary to develop a drug for improving or treating cardiac diastolic dysfunction. Summary of the invention

[0004] The purpose of the present invention is to provide an application of salvianolate in the preparation of a medicament for improving or treating diastolic dysfunction. The present invention finds for the first time that salvianolate can improve the diastolic function of mice with pressure-load-type diastolic dysfunction, improve and correct abnormal calcium transients in mouse myocardial cells, and improve the contraction and relaxation function of the sarcomeres of mice with heart failure, indicating that salvianolate has great application prospects in the preparation of a medicament for improving or treating diastolic dysfunction.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The present invention provides application of salvianolic acid salt in preparing medicine for improving or treating diastolic dysfunction.

[0007] Salvia miltiorrhiza acetic acid (also known as Salvianolic acid B, SalB), Lithospermic acid (LA) and Rosmarinic acid (RA) are the main active ingredients of SMDS. The chemical structural formulas of Salvia miltiorrhiza acetic acid, Lithospermic acid and Rosmarinic acid are as follows:

[0008]

[0009] Furthermore, the medicine also includes pharmaceutically acceptable excipients and carriers.

[0010] Furthermore, the auxiliary material includes at least one of a filler, a disintegrant, a binder, an excipient, a diluent, a lubricant, a sweetener or a colorant.

[0011] Furthermore, the dosage form of the drug includes at least one of granules, tablets, pills, capsules, and injections.

[0012] Furthermore, the added concentration of salvianolic acid salt is 4 mg / ml.

[0013] The present invention also provides a medicine for improving or treating diastolic dysfunction, wherein the active ingredient of the medicine comprises salvianolic acid salt.

[0014] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0015] The present invention provides an application of salvianolate in the preparation of a medicament for improving or treating diastolic dysfunction. The present invention finds for the first time that salvianolate can improve the diastolic function of mice with pressure-load-type diastolic dysfunction, improve and correct abnormal calcium transients in mouse myocardial cells, and improve the contraction and relaxation function of the sarcomeres of mice with heart failure, indicating that salvianolate has great application prospects in the preparation of a medicament for improving or treating diastolic dysfunction. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0017] Figure 1 Salvia miltiorrhiza polyphenols (SMDS) improve the diastolic function of the heart in mice with heart failure. A: Schematic diagram of Doppler ultrasound of mice in each group (apical four-chamber heart section). B: Statistical analysis data of diastolic function indexes E / E' and E' in each group (N=6). ***: P<0.001 compared with the control group (Control), ##: P<0.01 compared with the diastolic dysfunction (CDD) group; #: P<0.05 compared with the CDD group. Control: sham-operated mice + saline; SMDS: sham-operated mice + SMDS; CDD: heart failure mice + saline; CDD+SMDS group: CDD mice + SMDS.

[0018] Figure 2The relative weight data of the heart and lung of each group of mice are statistically analyzed (N=6). A: heart weight / body weight; B: heart weight / tibia length; C: lung weight / body weight; D: lung weight / tibia length. ****: Compared with the control group mice, P < 0.0001; ####: Compared with the CDD group mice, P < 0.0001; #: Compared with the CDD group mice, P < 0.05. Control: sham-operated mice + saline; SMDS: sham-operated mice + SMDS; CDD: heart failure mice + saline; CDD+SMDS group: CDD mice + SMDS. Tibia length represents the growth and development of mice.

[0019] Figure 3 The expression levels of ANP and BNP mRNA in the myocardial tissue of mice in each group (N=6). ***: P<0.001 compared with the Control group, ###: P<0.001 compared with the CDD group; ##: P<0.01 compared with the CDD group.

[0020] Figure 4 Ca in myocardial cells 2+ Changes in concentration. A: Ca 2+ Concentration change diagram; B: Ca in myocardial cells 2+ Baseline level; C: Ca in myocardial cells 2+ Increased amplitude; D: Ca 2+ Maximum velocity of concentration increase (Departure velocity); E: Ca 2+ The maximum velocity of concentration reduction (Return velocity) N=10 per group; **: P<0.01 compared with the Control group, *: P<0.05 compared with the Control group; ## P<0.01 compared with the CDD group; # P<0.05 compared with the CDD group.

[0021] Figure 5 The sarcomere contraction and relaxation in myocardial cells. A: sarcomere length change diagram; B: initial length of sarcomere; C: sarcomere contraction amplitude; D: maximum velocity of sarcomere contraction (Departure velocity); E: maximum velocity of sarcomere relaxation (Return velocity). N = 10 per group; ***P < 0.001 compared with the Control group, #P < 0.05 compared with the CDD group, ##P < 0.01 compared with the CDD group, ###P < 0.001 compared with the CDD group;

[0022] Figure 6:SMDS alleviates myocardial interstitial fibrosis in SDD mice. More than 10 fields of view were selected for each slice for area measurement, and the observation area covered myocardial sections as much as possible. N=6 per group. ****P<0.0001 compared with the Control group, ##P<0.01 compared with the CDD group. DETAILED DESCRIPTION

[0023] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0024] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0025] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0026] The present application will be described in detail below with reference to embodiments and experimental data.

[0027] Example 1: SMDS improves diastolic function in mice with pressure-overload heart failure

[0028] 1. Establishment of the mouse model of diastolic dysfunction

[0029] 1. Preparation for surgery:

[0030] (1) Surgical grouping: Male C57 mice (weight 22-24 g) of good growth and development at about 6-8 weeks old were selected and divided into a surgical group and a sham operation group.

[0031] (2) Anesthesia: Weigh 100 mg of sodium pentobarbital on a balance and dissolve it in 100 ml of normal saline to prepare a 10 mg / ml sodium pentobarbital solution. According to the weight of the mouse, 80 mg / kg of sodium pentobarbital was injected intraperitoneally for anesthesia.

[0032] (3) Hair removal: After the mouse is fully anesthetized, use a depilatory cream to remove the hair on the chest area and wipe it dry with a cotton swab to keep the chest area of ​​the mouse dry.

[0033] (4) Surgical position: Use soft rubber bands to tie the mouse's limb joints and fix them on a homemade foam mouse board. Allow the mouse to relax naturally and lie in a supine position to expose the precordial area.

[0034] (5) Use iodine tincture to disinfect the mouse from the neck to the upper abdomen and from the left axillary line to the right axillary line.

[0035] Surgical procedure:

[0036] (6) Along the intersection of the mouse's two axillae and the sternum, hold the toothed forceps in the left hand to pick up the chest skin, and hold the surgical scissors in the right hand to cut the skin longitudinally about 0.5-0.8cm to expose the chest wall. Find the second rib on the left side of the mouse under the microscope, use the tip of the microtweezers to break through the chest wall muscle at the angle between the lower edge of the second rib and the sternum, and use the microtweezers to bluntly separate to open a sufficient surgical field. After simultaneously identifying the mouse's innominate artery and left common carotid artery, use ophthalmic forceps to separate the upper part of the aortic arch from the starting segment of the innominate artery, so that the aortic arch between the innominate artery and the left common carotid artery is completely freed. Hold the threader in the right hand (with 7-0 fine thread in advance) and enter from the bottom of the aortic arch to deliver the thin rope to the other side of the aortic arch. Hold the hemostatic forceps in the left hand to lift the thin rope, first tie a slipknot in advance, insert the 28G needle into the slipknot along the direction of the aortic arch, tighten the first knot, and then quickly tie the second knot. The needle was then pulled out. If there was bleeding during the process, a cotton swab was used to gently press for more than ten seconds to stop the bleeding. After the aortic arch was narrowed, the pulsation of the carotid arteries on both sides of the mouse was observed. If the pulsation of the right carotid artery was enhanced and the pulsation of the left carotid artery was weak, the operation was successful. The retractor was then withdrawn, and the chest wall skin was aligned and sutured with 6-0 fine thread. At the same time, a small amount of biological glue was used to glue the skin (for mice in the sham operation group, except that the aortic arch was not ligated with a thin rope, the other steps were the same as the above surgical steps).

[0037] 2. Postoperative treatment:

[0038] After the operation, the mouse skin was disinfected with iodine, and the mouse was placed in a 37°C rewarming box for recovery and oxygen was introduced to help recovery. After the mouse was fully awake, it was returned to the mouse cage and continued to be raised in an SPF environment for 2-3 weeks until diastolic dysfunction developed.

[0039] 2. Cardiac ultrasound detection of cardiac diastolic function in mice

[0040] 1. Preparation before operation: Stuff cotton balls into a centrifuge tube, pour isoflurane into it, and place it in a sealed plastic box to make a simple anesthesia induction box. Apply depilatory cream to the chest and upper abdomen of the mouse, and wipe the part to be depilated with a cotton swab (the depilatory part is from the neck to the upper abdomen, and from the left to the mid-axillary line on both sides), and wipe off the depilatory cream with wet gauze or wet tissue. Then put the mouse in the anesthesia induction box to induce anesthesia. After the mouse faints, fix the anesthetized mouse in a supine position on a homemade foam box. Stuff the mouse's nose into the anesthesia mask, turn on the oxygen cylinder and anesthesia device, and maintain anesthesia with isoflurane at a flow rate of 0.6-1L / min and a concentration of 1%-2%.

[0041] Apical four-chamber heart: Apply ultrasound coupling agent to the mouse's chest, adjust the probe angle so that the probe is facing the mouse's apex (roughly toward the mouse's right shoulder). Turn on B-mode ultrasound and slowly adjust the probe angle until the image is clear. At this time, the four chambers of the heart (left atrium, right atrium, left ventricle, and right ventricle) can be seen. Click PW Doppler, place the sampling frame under the mitral valve, adjust the angle parallel to the blood flow direction, and obtain the diastolic mitral blood flow velocity. Note that the isoflurane concentration needs to be adjusted at this time to control the mouse's heart rate at 350-400 beats / min. Click Tissue Doppler, place the sampling volume near the mitral valve and the interventricular septum, with the sampling direction pointing to the apex, and record the mitral valve ring movement velocity for left heart diastolic function analysis.

[0042] Diastolic function measurement: Open the saved Doppler ultrasound data. In the PW Doppler data, measure the peak velocity of mitral anterior blood flow in early diastole (MV E). In the Tissue Doppler data, measure the velocity of mitral annulus in early diastole (MV E') on the septal side. Evaluate the diastolic function of the mice by calculating MV E / E' (systolic function tests of mice in each group were the same as before).

[0043] 2. Settings for different groups

[0044] Preparation of SMDS solution: Salvia miltiorrhiza polyphenols (SMDS) are easily soluble in water. We dissolved it in normal saline to prepare a 4 mg / ml SMDS solution. According to the results of cardiac ultrasound, the sham-operated and diastolic dysfunction mice were divided into the following 4 groups:

[0045] 1) Control group (sham-operated mice, 8 mice)

[0046] 2) SMDS group (sham-operated mice + SMDS, 8 mice)

[0047] 3) Diastolic dysfunction (CDD) group (heart failure mice, 8 mice)

[0048] 4) CDD+SMDS group (heart failure mice + SMDS, 8 mice)

[0049] Treatment of mice in each group: CDD group was intraperitoneally injected with saline, CDD+SMDS group was intraperitoneally injected with SMDS solution (injection dose of 10 mg / kg); Control group was intraperitoneally injected with saline, SMDS group was intraperitoneally injected with SMDS solution (injection dose of 10 mg / kg). The concentration and dose of administration were formulated according to the results of our previous studies, and the injection lasted for 28 days. During this period, the mice were examined by echocardiography every week to monitor their cardiac function changes. The mice were killed on the second day after the last administration, and their hearts were removed for subsequent studies.

[0050] 3. Experimental Results

[0051] Cardiac ultrasound was used to detect the cardiac ultrasound function of mice. The evaluation of diastolic function mainly relied on the E / E' index measured by Doppler ultrasound.

[0052] The results are as follows Figure 1 As shown in the figure, compared with the control group mice, the E' of the diastolic dysfunction mice was significantly reduced (Control group: 2.81±0.14cm / s vs CDD group: 1.34±0.39cm / s; P<0.001), while the E / E' was significantly increased (Control group: 31.83±2.12 vs CDD group: 57.20±4.59; P<0.001). 28 days after intraperitoneal injection of SMDS, the E' (CDD+SMDS group: 1.83±0.34cm / s vs CDD group: 1.34±0.39cm / s; P<0.05) and E / E' (CDD+SMDS group: 49.97±2.24 vs CDD group: 57.20±4.59; P<0.01) of the diastolic dysfunction mice gradually recovered to near normal levels. It can be seen that SMDS significantly improved the diastolic function of heart failure mice.

[0053] Example 2: Salvia miltiorrhiza polyphenols can reduce cardiac hypertrophy and pulmonary congestion in mice with pressure-overload diastolic dysfunction

[0054] Decompensated cardiac hypertrophy and pulmonary congestion are important pathological changes of pressure-load diastolic dysfunction. We measured the body weight (BW), heart weight (HW), lung weight (LW), tibia length (TL) and other data of mice. Tibia length is an indicator of the growth status of mice. The degree of cardiac hypertrophy was evaluated by calculating HW / BW and HW / TL, and the degree of pulmonary congestion was evaluated by calculating LW / BW and LW / TL.

[0055] The results are as follows Figure 2 As shown in the figure, compared with the control group, the HW / BW and HW / TL of the heart failure mice were significantly increased, indicating that the relative mass of the heart increased and cardiac remodeling had occurred. In addition, the LW / BW and LW / TL of the heart failure mice were also significantly increased, indicating that there was obvious pulmonary congestion in their lung tissues. Compared with the CDD group, the relative mass of the heart and lungs of the mice treated with SMDS decreased, indicating that SMDS reduced cardiac hypertrophy and pulmonary congestion in heart failure mice, suggesting that diastolic function was significantly improved.

[0056] Example 3: Salvia miltiorrhiza polyphenols can reduce cardiac natriuretic peptide levels in mice with diastolic heart failure

[0057] We further detected the mRNA levels of ANP and BNP in myocardial tissue by qPCR. ANP and BNP are mainly derived from the atria and ventricles. When the filling pressure in the atrial and ventricular cavities increases, the expression of ANP and BNP will increase. A significant increase in the pressure of the left atrium and left ventricle is a significant feature of diastolic dysfunction. Therefore, the increase in the levels of these natriuretic peptides is an important indicator of diastolic dysfunction.

[0058] The primers used in the qPCR are shown in Table 1 below.

[0059] Table 1

[0060] Primer name Sequence (5' to 3') ANP-F AATCCTGTGTACAGTGCGGTG(SEQ ID NO.1) ANP-R GACCTCATCTTCTACCGGCAT(SEQ ID NO.2) BNP-F ACAGCTCTTGAAGGACCAAGG(SEQ ID NO.3) BNP-R CTATCTTGTGCCCAAAGCAGC(SEQ ID NO.4)

[0061] like Figure 3 As shown in the results, compared with the control group, ANP and BNP in heart failure mice were significantly increased (P < 0.001). SMDS treatment reduced ANP (P < 0.001) and BNP levels (P < 0.01) in the myocardial tissue of CDD mice, indicating that SMDS improved the diastolic function of CDD mice.

[0062] Example 4: Salvia miltiorrhiza polyphenols can improve and correct abnormal calcium transients in mouse myocardial cells

[0063] 1. Establishment of mouse model

[0064] Methods were the same as above, and all procedures were approved by the Institutional Animal Care and Use Committee of Wuhan University.

[0065] 2. Detection Method

[0066] Calcium transients in myocardial cells (Ca 2+ transient) and sarcomere length measurement

[0067] (1) Preparation of fluorescent dye: Under light-protected conditions, weigh 50 μg of Fura-2 / AM solid powder using a balance, mix with 50 μl of dimethyl sulfoxide (DMSO), and vortex to fully dissolve Fura-2 / AM.

[0068] (2) Fluorescent dye loading: Carefully aspirate the supernatant in the myocardial cell liquid, add about 1 ml of the benchtop liquid and mix well. Take out the fluorescent dye containing Fura-2 / AM, add all 1 ml of myocardial cell liquid in a light-proof manner, mix gently and let stand for 15 minutes to wait for the fluorescent dye to load.

[0069] (3) After loading, carefully remove the supernatant containing excess fluorescent dye, then add an appropriate amount of benchtop solution and gently mix. Pipette an appropriate amount of cardiomyocytes into the working bath, and turn on the perfusion system in the working bath after the cardiomyocytes adhere to the wall. The benchtop solution must be added to the perfusion system in advance, and the flow rate should be set to 200 ml / h to flush away dead cardiomyocytes.

[0070] (4) Turn on the IonOptix measurement system and give appropriate electrical stimulation to the cardiomyocytes. Adjust the appropriate objective lens magnification and find active cardiomyocytes in the field of view (cardiomyocytes are rod-shaped and striated muscles can be seen). Under the irradiation of the xenon lamp, Fura-2 / Ca 2+ The IonOptix and Fura-2 emit light of 340nm and 380nm wavelengths respectively. The IonOptix measurement system can indirectly obtain the calcium ion concentration level in the cardiomyocytes by measuring the intensity ratio of the two wavelengths of light. In addition, the CCD camera on the microscope will synchronously record the distance changes between the light band and the dark band in the sarcomere of the cardiomyocytes (the light band and the dark band reflect the length between the thick and thin filaments). The system will convert it into a signal of the sarcomere length, thereby observing the changes in the sarcomere length.

[0071] 3. Experimental Results

[0072] Ca 2+ Changes in concentration are related to the contraction and relaxation of myocardial cells. Figure 4 AB shows that compared with normal cells, the cytoplasmic Ca 2+ The baseline level of Ca2+ concentration was higher (P<0.05), indicating that Ca2+ increased during diastole and myofilament relaxation was limited. 2 The concentration level decreased (P<0.05), which indicated that SMDS reduced calcium leakage in heart failure cells, thereby improving the myofilament relaxation environment of cardiac muscle. Figure 2 As shown in C, compared with normal cells, the amplitude of calcium transients in heart failure cells was reduced (P<0.01), while SMDS treatment increased the amplitude of calcium transients in heart failure cells (P<0.05). 2+ The rising and falling speeds of calcium ions in the concentration curve mainly reflect the release and reuptake of Ca by the sarcoplasmic reticulum. 2+ The maximum rate of Figure 4 D and E show that compared with normal cells, the intracellular Ca 2+ The rate of increase (P<0.01) and decrease (P<0.05) of concentration slowed down, indicating that the function of sarcoplasmic reticulum was abnormal; SMDS significantly increased the intracellular Ca 2+ The increase and decrease rates of Ca concentration (P<0.01) improved the sarcoplasmic reticulum regulation of Ca 2+function, and promoted the recovery of myocardial cell diastolic function.

[0073] Example 5: Salvia miltiorrhiza polyphenols improve the contraction and relaxation function of the sarcomere in mice with heart failure

[0074] 1. Establishment of mouse model

[0075] The establishment of the mouse model is the same as in Example 2.

[0076] 2. Experimental testing method is the same as above

[0077] 3. Experimental Results

[0078] Intracellular Ca 2+ Changes in concentration trigger the relative sliding of thick and thin filaments in the sarcomere, thereby causing myocardial cell contraction and relaxation. Therefore, the sarcomere is the basic unit of cardiac contraction and relaxation. Figure 5 As shown in the figure, we found that compared with normal cells, the initial length of the sarcomere of heart failure cells was shortened (P < 0.001), which may be related to the inability of cardiomyocytes to relax completely due to calcium leakage in the cytoplasm. However, SMDS treatment increased the initial length of the sarcomere (P < 0.05) and improved the relaxation ability of the myocardium. The rising and falling speeds of the sarcomere reflect the maximum speed of the sarcomere during contraction and relaxation, respectively. Figure 5 As shown in D and E, we found that compared with the normal group, the maximum rate of contraction and relaxation of the sarcomere in heart failure cells was reduced (P < 0.001), while SMDS treatment improved the maximum rate of contraction (P < 0.001) and relaxation (P < 0.01) of the sarcomere in heart failure myocardial cells. These indicators all indicate that SMDS treatment can improve the sarcomere contraction and relaxation dysfunction in heart failure cells.

[0079] Example 6: Salvia miltiorrhiza polyphenols improve myocardial interstitial fibrosis in CDD mice

[0080] 1. Establishment of mouse model

[0081] The establishment of the mouse model is the same as in Example 2.

[0082] 2. Experimental testing methods:

[0083] Use Masson trichrome staining solution for staining. First, place the dewaxed sections in Masson A solution and soak overnight at room temperature (about 15 hours). Then soak the sections in Masson A solution and incubate in a 65℃ oven for 30 minutes, and wash with tap water for 30 seconds until the yellow on the tissue fades. At the same time, preheat Masson D solution and Masson F solution in a 65℃ oven. Mix equal volumes of Masson B solution and Masson C solution, add them to the sections for immersion for 1 minute, and wash with running water. The sections are differentiated with 1% hydrochloric acid alcohol (concentrated hydrochloric acid: anhydrous ethanol = 1:100) for about 1 minute, until the cell nucleus is gray-black and the background is almost colorless or light gray. Wash with tap water, drain the excess water on the sections, and soak the sections in Masson D solution for 6 minutes. At this time, the tissue appears bright red. If the red is too light, extend the staining time appropriately. Then rinse the sections with tap water for about 20 seconds until the water flowing down the sections is colorless. Drain the slices slightly (do not let them dry), and soak them in Masson E solution for about 1 minute. Drain the slices slightly from Masson E solution, and then directly stain them in Masson F solution for 30 seconds without washing. Rinse and differentiate the slices in three consecutive cylinders of 1% glacial acetic acid aqueous solution, each cylinder for about 7 seconds, in order to differentiate the excess aniline blue. During the third cylinder of 1% glacial acetic acid aqueous solution, examine under a microscope to avoid excessive differentiation of blue. Dehydrate the slices in three consecutive cylinders of anhydrous ethanol for about 3 seconds, 5 seconds, and 5 seconds. Transparentize with xylene for 5 minutes and seal with neutral gum. Take photos of the relevant parts of the sample under a microscope, and calculate the fibrosis area using Image J software.

[0084] 3. Experimental results:

[0085] like Figure 6 As shown in the figure, compared with the control group mice, the interstitial fibers of CDD mice increased significantly (P < 0.001). SMDS significantly improved the degree of interstitial fibrosis (P < 0.01). This result suggests that SMDS can reduce the degree of myocardial interstitial fibrosis in CDD mice, thereby improving the diastolic function of the heart.

[0086] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0087] Although preferred embodiments of the present invention have been described, additional changes and modifications may be made to these embodiments by those skilled in the art once the basic inventive concepts are known. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention. Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of salvianolic acid salt in the preparation of medicines for improving or treating diastolic dysfunction.

2. The use according to claim 1, characterized in that: The medicine also includes pharmaceutically acceptable excipients and carriers.

3. The use according to claim 1, characterized in that: The auxiliary materials include at least one of a filler, a disintegrant, a binder, a diluent, a lubricant, a sweetener or a colorant.

4. The use according to claim 1, characterized in that: The dosage form of the drug includes at least one of granules, tablets, pills, capsules and injections.

5. The use according to claim 1, characterized in that: The added concentration of the salvianolic acid salt is 4 mg / ml.

6. The use according to claim 1, characterized in that: The salvianolic acid salt improves the diastolic function of mice with pressure-load diastolic dysfunction.

7. The use according to claim 1, characterized in that: The salvianolic acid salt improves and corrects abnormal calcium transients in mouse cardiomyocytes.

8. The use according to claim 1, characterized in that: The salvianolic acid salt improves the contraction and relaxation function of the sarcomere of heart failure mice.

9. A drug for improving or treating diastolic dysfunction, characterized in that: The active ingredient of the medicine includes salvianolic acid salt.

10. The drug for improving or treating diastolic dysfunction according to claim 9, characterized in that: The drug also includes pharmaceutically acceptable excipients.

Images