New applications of squamocin

Abstract

This invention discloses a novel application of squamousin. We discovered that squamousin effectively degrades histone methyltransferases EZH2 and MYC in head and neck squamous cell carcinoma (HNSCC), gastric cancer (GC), and colorectal cancer (CRC) cells, and inhibits the tumor-promoting transcriptional activity of MYC. Compared with the marketed drug EPZ6438, squamousin exhibits a stronger ability to inhibit the growth of HNSCC, GC, and CRC. Mechanistically, squamousin enhances endoplasmic reticulum stress-related ubiquitination degradation, triggering ubiquitination through the E1 activator UBA6, promoting ubiquitination transfer to the E2 conjugator UBE2Z, and thereby enhancing the degradation of EZH2 and MYC by the E3 ligase FBXW7. This invention provides a new application for the clinical treatment of head and neck squamous cell carcinoma / gastric cancer / colorectal cancer.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceuticals, specifically relating to new applications of squamocin. Background Technology

[0002] Head and neck squamous cell carcinoma (HNSCC) is an aggressive malignant tumor characterized by high proliferation, high recurrence rate, and poor prognosis. Despite advancements in surgical techniques and radiotherapy / chemotherapy in recent decades, clinical treatment outcomes remain unsatisfactory, with over 50% of patients experiencing recurrence or metastasis within 3 years of treatment, leading to poor prognosis. Given the limited efficacy of chemotherapy in treating recurrent or metastatic HNSCC (R / M HNSCC), recent clinical research has shifted towards immune checkpoint inhibitors (ICIs); however, only 15-20% of HNSCC patients have benefited. To date, the mechanisms of ICI resistance in R / MHNSCC remain poorly understood; however, MYC activation has been shown to contribute to resistance to ICI treatment in both R / MHNSCC and esophageal squamous cell carcinoma. Therefore, elucidating the potential mechanisms by which MYC activation may lead to ICI resistance and developing inhibitors targeting MYC activation are urgent clinical needs.

[0003] Encoded by the proto-oncogene MYC, MYC is involved in all aspects of tumorigenesis in up to 70% of human cancers through copy number increase, upstream signaling abnormalities, and alterations in protein stability. To date, many therapeutics that directly inhibit MYC activity are under development; however, their clinical efficacy remains undetermined, suggesting that alternative strategies targeting MYC activity may require further exploration. Epigenetic proteins are key regulators of MYC, and these druggable epigenetic proteins represent an attractive drug development strategy for inhibiting MYC activity.

[0004] Histone methyltransferase (EZH2) catalyzes histone H3K27me3 and maintains transcriptional repression of key genes. High EZH2 expression is associated with tumor proliferation, metastasis, and poor prognosis in a range of human tumors, including HNSCC, GC, and CRC. Notably, EZH2 can also exert its oncogenic effect by promoting MYC stabilization. However, current EZH2 inhibitors, including EPZ-6438, GSK126, and UNC1999, often induce slow and / or partial tumor cell suppression responses. Therefore, effectively inhibiting the stabilization of EZH2 and its partner MYC is an attractive cancer therapeutic strategy.

[0005] In human cancers, MYC-activated tumor cells further stimulate endoplasmic reticulum (ER) stress and unfolded protein response (UPR), thereby promoting tumor cell proliferation, survival, metastasis, chemotherapy resistance, and immune escape. However, unresolved or extreme UPR can induce tumor cell apoptosis.

[0006] Annonaceous acetogenins (ACGs) are unique and structurally homogeneous polyketide compounds extracted from plants in the Annonaceae family, exhibiting potent antiproliferative effects in various cancers. Squamocin is one of the most potent active ingredients among ACGs, demonstrating strong cytotoxicity against a range of tumor cells and chemotherapy-resistant tumor cells. For example, squamocin is approximately 100 times more cytotoxic to MCF-7 cells than doxorubicin. Therefore, whether squamocin, as a cytotoxic drug and an inhibitor of mitochondrial respiratory complex I, can inhibit the proliferation of tumor cells with high MYC activity, and its mechanism of action, remains unclear.

[0007] In this invention, we discovered for the first time that squamocin significantly inhibits the proliferation of HNSCC, GC and CRC by inhibiting the activity of EZH2 and its MYC, highlighting the therapeutic significance of squamocin for these MYC-driven tumors. Summary of the Invention

[0008] One of the objectives of this invention is to provide a new application of squamocin in pharmaceuticals.

[0009] The technical solution to achieve the above objectives is as follows.

[0010] The use of the anechoic acid lactone compound squamocin in the preparation of medicaments for the prevention and / or treatment of tumors, wherein the tumors are head and neck squamous cell carcinoma (HNSCC), gastric cancer (GC), and / or colorectal cancer (CRC).

[0011] In some of these embodiments, the tumor is squamous cell carcinoma of the head and neck.

[0012] In some of these embodiments, the tumor is gastric cancer.

[0013] In some of these embodiments, the tumor is colorectal cancer.

[0014] In some of these embodiments, the dosage form of the drug is a tablet, capsule, granule, solution, pill, suspension, enteric-coated tablet, sustained-release formulation, or effervescent tablet.

[0015] In some of these embodiments, the application includes squamocin as an inhibitor targeting the UBA6-UBE2Z-FBXW7 ubiquitin cascade to degrade the EZH2 and MYC pathways.

[0016] In some of these embodiments, the application includes squamocin as an inhibitor targeting the heat shock protein Hsp90α.

[0017] In some of these embodiments, the drug is adapted to mammals.

[0018] In some of these embodiments, the mammal is human.

[0019] Another object of the present invention is to provide a medicament for treating squamous cell carcinoma of the head and neck, gastric cancer, and / or colorectal cancer.

[0020] A drug for treating squamous cell carcinoma of the head and neck, gastric cancer, and / or colorectal cancer, the active ingredient of which includes squamocin.

[0021] This invention demonstrates the single component suqamocin isolated from ACG and reveals that suqamocin promotes the degradation of histone methyltransferases EZH2 and MYC and inhibits MYC transcriptional activity in HNSCC, GC, and CRC. In mouse tumor models, suqamocin exhibits a stronger tumor inhibition rate compared to the marketed EPZ6438. Mechanistically, suqamocin enhances the endoplasmic reticulum (ER) stress response, thereby activating the UBA6-UBE2Z-FBXW7 ubiquitin degradation system and promoting the degradation of EZH2 and MYC in the aforementioned tumors. Our results elucidate the role and molecular mechanism of squamocin in promoting the degradation of tumor proteins EZH2 and MYC, providing a basis for accelerating the development of EZH2 / MYC axis-driven tumor drugs. Based on these studies, squamocin may be used for the prevention and treatment of head and neck squamous cell carcinoma, gastric cancer, and colorectal cancer. Attached Figure Description

[0022] Figure 1 Results of experiments on the inhibition of MYC-high expression HNSCC cell line proliferation by Squamocin; A: Western blot analysis of MYC expression in the specified cell line (left); cell viability was detected by CCK8 after 24 h of Squamocin treatment (right); B: SCC15 and SCC25 cells were treated with Squamocin at specified concentrations for 12, 24, and 48 h, and cell viability was detected by CCK8; C: Cells were treated with specified concentrations of Squamocin for 24 h, and cell cycle was analyzed by PI staining.

[0023] Figure 2 Results of experiments on the inhibition of mitochondrial respiratory chain complex I by squamocin; A: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for 24 h, and the activity of mitochondrial respiratory chain complex I was analyzed (mean ± SEM; n = 3, Student's test); B and C: SCC15 and SCC25 cells were pretreated with mito-TEMPO (10 μM) for 6 h, and then treated with squamocin (10 μg / mL) for 24 h; after treatment, the following assays were performed on the cells: extracellular ATP level analysis (B), intracellular ROS analysis (C), and Annexin V staining analysis of apoptosis (D).

[0024] Figure 3 Experimental results of direct target binding of Squamocin; where, A: Target fishing analysis of direct target proteins of Squamocin using the SwissTargetPrediction database, followed by protein-protein interaction analysis of potential targets; BC: Computational docking shows the binding mode (B) and interaction diagram (C) of HSP90α and Squamocin; D: DSF analysis of Squamocin binding to HSP90α protein (mean ± SEM; n = 3, Student's t-test); E: SPR analysis of Squamocin binding to HSP90α protein.

[0025] Figure 4Experimental results on the inhibition of tumor growth by Squamocin in HNSCC in an ezh2-dependent manner; A: 293T cells were transfected with pcDNA3.1-3×Flag-C-HSP90αWT / HSP90α mutant plasmid, and the binding of Squamocin to HSP90α was analyzed by CETSA. The intensity of the grayscale analysis band was referenced to the starting temperature (40℃), and the curve fitting was performed using Prism (mean ± SEM; n = 3); B: SCC15 cells were transfected with two types (#1 and #2) siHSP90AA1 for 48 h, and then treated with Squamocin for 24 h. Cell viability was measured by CCK8 (mean ± SEM; n = 4, Student's t-test). C: SCC15 and SCC25 cells were treated with appropriate concentrations of squamocin for 24 hours, and EZH2 mRNA expression was analyzed by qRT-PCR (left panel, mean ± SEM; n = 2, Student's t-test) and indicator protein was analyzed by immunoblotting (right panel); D: Western blot analysis of cytoplasmic and nuclear indicator proteins after 24 hours of treatment with 10 μg / mL squamocin; E: Cell proliferation curves of SCC15 and SCC25 cells overexpressing EZH2 under squamocin treatment (mean ± SEM; n = 4, two-way ANOVA); F: Representative images of SCC15 and SCC25 cells overexpressing EZH2 after 10 days of treatment with squamocin (10 μg / mL) and quantitative data on the number of clones per well (mean ± SEM; n = 3, Student's t-test). (t-test), *p<0.05, **p<0.01, ***p<0.001.

[0026] Figure 5 Experimental results on the roles of EZH2 and MYC in the progression of HNSCC; A: Immunofluorescence staining analysis indicating subcellular localization of EZH2 and MYC in cells, scale bar: 50 μm; B: Immunoprecipitation of SCC15 and SCC25 cell lysates with anti-EZH2 or anti-MYC and subsequent Western blot analysis; C: Schematic diagram of the domain structure of MYC and EZH2, NTD, CD, and CTD represent the N-terminal, central, and C-terminal domains, respectively; DNMT BR: DNA methyltransferase binding region; CDYL BR: Chromosomal domain γ-like protein binding region; CXC: Cysteine-rich domain; SET: Su(var)3-9, zeste enhancer, trithoracic domain; DE: 293T cells transfected with plasmids expressing ha-labeled EZH2, flag-labeled MYC, or deletion (Δ) mutants, and EZH2 binding to MYC was detected using anti-flag-(D) or anti-ha-(E) related precipitates.

[0027] Figure 6 Experimental results showing that EZH2 enhanced the transcriptional activity of MYC; A: Effect of EZH2 on the half-life of MYC protein under 100 μg / mL CHX treatment, representing the quantification of MYC protein level relative to β-tubulin level, and the MYC half-life was calculated using Prism (mean ± SEM; n = 2); B: SCC25 cells were transfected with two siEZH2 constructs (#1 and #2) for 48 h, and then treated with 10 μM MG132 for 8 h; cell lysates were analyzed by Western blot; C: Western blot analysis of MYC phosphorylation in SCC15 cells overexpressing EZH2 and SCC25 cells transfected with siEZH2. D: SCC15 cells overexpressing EZH2 (top image) and SCC25 cells transfected with siEZH2 (bottom image, mean ± SEM; n = 2, Student's t test), ns: no statistical significance, *p < 0.05, **p < 0.01, ***p < 0.001.

[0028] Figure 7 Experimental results demonstrating the effectiveness of squamocin in inhibiting EZH2 methyltransferase activity and promoting MYC degradation in HNSCC; A: Western blot analysis of corresponding proteins in SCC15 and SCC25 cells 24 hours after treatment with the specified drug; B: Venn diagram of overlapping differentially expressed genes (DEGs, FDR < 0.05) between SCC15 and SCC25 cells after squamocin treatment, with quantification of DEG profiles of the two cell lines using Fisher's exact test (p < 0.05); C: FPKM (mean ± SEM; n = 3, Student's t-test) of indicator genes in RNA-seq of SCC25 cell line after squamocin treatment; D: Analysis of H3K27me of the UNC5B promoter in SCC25 cells using GEO databases (GSE149042 and GSE222312). 3 Modification. E: H3K27me on the UNC5B promoter after treatment of SCC25 cells with 10 μg / mL squamocin. 3 Enriched ChIP-qPCR analysis (mean ± SEM; n = 3, Student's t-test).

[0029] Figure 8 Transcriptomic experimental results showing that Squamocin treatment led to significant upregulation of endoplasmic reticulum stress and UPR.

[0030] A: Scatter plot of ontological enrichment analysis of DEG genes jointly upregulated in SCC15 and SCC25 cells after squamocin treatment; GO and the top 20 biological processes show (p<0.05); B: Venn diagram showing overlap of differentially expressed genes (DEGs, FDR<0.05) upregulated or downregulated in SCC15 and SCC25 cells after squamocin treatment; the DEG profiles of the two cell lines were quantitatively determined using Fisher's exact test (p<0.05); C: Western blot analysis of EZH2 and MYC expression in SCC15 cells after treatment with 10 μg / mL squamocin for 24 h and ER stress inhibitors (ISRIB: 20 ​​μM, 4 μgC: 20 μM, CeapinA7: 20 μM) for 12 h.

[0031] Figure 9 Results of protein half-life and ubiquitination experiments; where A: SCC15 and SCC25 cells were first treated with DMSO or 10 μg / mL squamocin for 24 h, and then treated with 100 μg / mL CHX for a specified time. Western blot analysis was performed (top image) to plot EZH2 and MYC degradation curves (bottom image). The half-lives of EZH2 and MYC were calculated using Prism (mean ± SEM; N = 2). B: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for 24 h, 10 μM MG132 for 8 h, and 10 μM CQ for 8 h, or squamocin for 24 h followed by MG132 and / or CQ for 8 h. Cell lysates were analyzed by Western blot. C: Western blot analysis of EZH2 or MYC ubiquitination in SCC15 and SCC25 cells after 24 h of treatment with 10 μg / mL squamocin and DMSO. D: SCC15 and SCC25 cells were treated with 10 μg / mL squamocin for a specified time, followed by immunoblotting analysis. E: Treatment was performed as instructed. Cell lysates were detected by Western blot.

[0032] Figure 10Results of UBA6 knockout experiment; where AB and D: SCC15 and SCC25 cells were transfected with siUBA6 (A), siUBE2Z (B) or siFBXW7 (D) for 48 hours, then treated with 10 μg / mL squamocin for 24 hours, and cell lysates were immunoprecipitated with anti-EZH2 or anti-MYC, and analyzed with anti-ubiquitin; C: SCC15 and SCC25 cells were treated with squamocin (10 μg / mL) for 24 hours, and ER stress inhibitors (ISRIB: 20 ​​μM, 4 μgC: 20 μM, CeapinA7: 20 μM) for 12 hours, and the indicator genes were analyzed by qRT-PCR (mean ± SEM; n = 2, Student's t test); E: Co-immunoprecipitation of the interaction between endogenous FBXW7 and EZH2 or MYC in SCC15 and SCC25 cells.

[0033] Figure 11 Experimental results of Squamocin inhibiting the EZH2 / MYC axis in various tumors; where A: representative tumor images of nude mouse HNSCC xenografts (n=4), B: tumor volume images measured every 3 days (mean ± SEM; n=4, two-way ANOVA test), C: summary of tumor weights collected after euthanasia (mean ± SEM; n=4, Student's t-test), D: HE, Ki67, EZH2, H3K27me 3 Immunohistochemical staining of MYC in xenograft tumors, scale bar: 200 μm, E, F: representative tumor images and tumor volumes of nude mouse GC (E) and CRC (F) xenograft tumors (mean ± SEM; n = 4, two-way ANOVA test).

[0034] Figure 12 HPLC chromatogram of isolated squamocin.

[0035] Figure 13 HPLC chromatogram of squamocin dissolved in blank solvent. Detailed Implementation

[0036] To facilitate understanding of the present invention, a more complete description will be given below with reference to the accompanying drawings. Preferred embodiments of the invention are shown in the drawings. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention.

[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0038] To facilitate understanding of this technology, some terms and phrases are defined below.

[0039] "Subject," "patient," or "applicant" refers to a human or a non-human animal such as a mammal. "Subject" can include any animal, including horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds. Human subjects may also be referred to as patients.

[0040] As used herein, an "effective amount" or "therapeutic effective amount" is a quantity sufficient to influence the expected biological effects, including clinical outcomes, such as beneficial effects. Thus, an "effective amount" depends on the context in which it is applied. The effective amount can vary according to factors known in the art, such as the disease state, age, sex, and weight of the individual being treated. Several separate doses may be administered daily, or the dose may be proportionally reduced according to the urgency of the treatment situation. Furthermore, the drug squamocin described in this invention can be administered frequently as needed to achieve a therapeutic dose.

[0041] As used herein, the term "prevention" and its variations, as well as other grammatical equivalents, includes preventing the development, occurrence, inhibition, or avoidance of head and neck squamous cell carcinoma (HNSCC), gastric cancer (GC), and colorectal cancer (CRC), and the symptoms of these conditions, as well as reducing the occurrence of symptoms. Prevention can be complete (i.e., no detectable symptoms) or partial, resulting in fewer observed symptoms than would be possible without treatment. The term also includes preventative benefits. For HNSCC or the condition to be prevented, squamocin can be administered to patients at risk of the specific disease, or patients reporting one or more physical symptoms, even if a diagnosis of the HNSCC disease has not yet been made.

[0042] Example

[0043] 1. Experimental materials

[0044] 1.1 Cell lines

[0045] Human HNSCC cell lines SCC15 and SCC25, as well as human embryonic kidney cell line HEK293T cells, were all derived from American Type Culture Collection Company (ATCC, USA).

[0046] 1.2 Main Reagent Kits and Instruments

[0047]

[0048]

[0049]

[0050] Supplementary Table S1.Small interfering RNA(siRNA)sequences

[0051]

[0052] 1.3 Preparation of main reagents

[0053] 1.3.1 Squamocin Isolation and Purification

[0054] 50 kg of custard apple seeds were cold-soaked overnight in 95% ethanol, and then percolated with 20 times the amount of 95% ethanol. The percolate was concentrated under reduced pressure to obtain 5.6 kg of ethanol extract (FLS-1). 200 g of the ethanol extract was dissolved and 300 g of diatomaceous earth was added. The mixture was mixed, dried, and placed in a Soxhlet extractor. The extract was first defatted with n-hexane, and then eluted with dichloromethane (32.7 g, FLS-2) and ethyl acetate, respectively. HPLC analysis of the eluent confirmed that the dichloromethane fraction contained tetrahydrofuran custard lactones.

[0055] The fraction was loaded onto a silica gel column and eluted with a hexane-acetone gradient to obtain two main components. After analysis by mass spectrometry, carbon NMR and proton NMR, and comparison with known compounds by TLC, the two compounds were identified as squanmocin (K19) and bullatacin (K16).

[0056] 1.3.2 Squamocin Structure Identification

[0057] Compound K19: white waxy solid, mp 46-47℃, ESI-MS: 645.4792 (M++Na), indicating its molecular formula is C37H66O7. In 1H-NMR, 7.01 represents 35-H, 5.00 ppm (q) represents 36-H, and 1.40 (d) represents the three protons of 37-CH3, a typical structure of an unsaturated lactone. 13C-NMR also confirms this: δ 173.91 represents 1-C, 148.98 represents 35-C, δ 134.22 represents 2-C, 77.43 represents 36-C, and 19.20 represents 37-C. Simultaneously, 1H... NMR and 13C-NMR data indicate that K19 contains an ortho-bistetrahydrofuran (THF) ring, with two hydroxyl groups flanking the THF ring. 1H-NMR: δ 3.39 (15-H), 3.85-3.93 (16-H, 19-H, 20-H, H-23, H-24); 13C-NMR: δ 83.44 (C-16), 82.55 (C-19), 82.19 (C-20), 82.87 (C-23), 74.20 (C-15), 71.63 (C-24). These NMR data confirm that compound K19 is an ortho-bistetrahydrofuran-type anechoic acid lactone. The 13C-NMR and 1H-NMR data are largely consistent with reported data for squamocin, confirming K19 as squamocin.

[0058] 1.3.3 Chemical Structure of Squamocin

[0059]

[0060] Squamocin is also available for purchase.

[0061] 1.3.4 HPLC chromatogram of crude squamocin for in vivo studies

[0062] The HPLC chromatogram of isolated squamocin is shown in Figure 1. Figure 12 The HPLC chromatogram of squamocin dissolved in blank solvent is shown below. Figure 13 .

[0063] 1.3.5 Preparation of Squamocin stock solution

[0064] Weigh 32 mg of squamocin solid and dissolve it in 3.2 mL of DMSO to prepare a stock solution with a concentration of 10 mg / mL. After filtration, dispense the solution into portions and store at -20 °C.

[0065] 1.3.6 Preparation of 0.2M EDTA·Na₂ solution

[0066] Weigh 74.448 mg of EDTA.Na2, dissolve it in deionized water, and bring the volume to 1 mL. Filter and store at 4 °C.

[0067] 1.3.7 Preparation of 2 mg / mL PI solution

[0068] Dissolve 10 mg of PI in deionized water and bring the volume to 5 mL. Store at -20°C.

[0069] 1.3.8 Preparation of 10% Triton X-100 solution

[0070] Dissolve 1 mL of Triton X-100 in 9 mL of deionized water and store at 4 °C.

[0071] 1.3.9 Preparation of 50 mg / mL PI working solution

[0072]

[0073] 1.3.10 Preparation of 5 mg / mL MTS solution

[0074] Weigh 5 mg of MTS powder, dissolve it in PBS and bring the volume to 1 mL, filter and store at -20°C protected from light.

[0075] 2. Experimental Methods

[0076] 1) Chemicals

[0077] Squamocin was isolated from custard apple seeds according to the reported method, and its structure was identified by ESI-MS and NMR. Squamocin (20 mg / mL), EPZ-6438 (100 mM, Selleck, #S7128), cycloheximine (CHX, 100 mg / mL, MedChemExpress, #HY-12320), MG132 (10 mM, MedChemExpress, #HY-13259), chloroquine (CQ, 10 mM, TargetMol, #T8689), and ISRIB (10 mM, MedChemExpress, #) were used in the synthesis of squamocin (20 mg / mL), EPZ-6438 (100 mM, Selleck, #S7128), cycloheximine (CHX, 100 mg / mL, MedChemExpress, #HY-12320), MG132 (10 mM, MedChemExpress, #HY-13259), chloroquine (CQ, 10 mM, TargetMol, #T8689), and ISRIB (10 mM, MedChemExpress, #HY-13259) were also used in the synthesis of squamocin (20 mg / mL), EPZ-6438 (100 mM, Selleck, #HY-13259), chloroquine (CQ, 10 mM, TargetMol, #T8689), and ISRIB (10 mM, MedChemExpress, #HY-13259). HY-12495A), 4μ8C (10mM, MedChemExpress, #HY-19707), Ceapin A7 (10mM, MedChemExpress, #HY-108434), rotenone (50mg / mL, MedChemExpress, #HY-B1756), and mitto-tempo (10mM, MedChemExpress, #HY-112879) were dissolved in DMSO as stock solutions. Before each experiment, the stock solutions were stored at -80℃ and thawed immediately.

[0078] 2) Lentiviral transduction and RNA interference

[0079] The full-length human EZH2 (NM_001203247.2) and MYC (NM_001354870.1) cDNA amplified by PCR were subcloned into the pOZ-FH-C-puro plasmid (Addgene, #32516) or pRRLSIN.cPPT.PGK-GFP to obtain the EZH2 and MYC plasmids. WPRE (Addgene, #12252) was also used. HNSCC cell lines were infected with lentivirus. EZH2 or MYC was fused with HA or Flag tags and cloned into the pcDNA-3.1 plasmid (Umine Biotechnology Co., Ltd., #BVA03). After 48 hours, the culture medium was removed and replaced with fresh medium containing 2 μg / mL puromycin (Solarbio, #P8230). Cells carrying the constructs were enriched after another 2 weeks. Endogenous EZH2, MYC, UBA6, UBA1, UBE2Z, FBXW7, and RING1 were knocked down using small interfering RNA (siRNA) (Qingdao Biotechnology Co., Ltd., Beijing, China). The sequences are shown in Supplementary Table S1. The transfected HNSCC cell lines were used for subsequent experiments.

[0080] 3) Plasmid construction

[0081] EZH2 or MYC was fused with HA or Flag tags and cloned into the pcDNA-3.1 plasmid (Umine Biotechnology Co., Ltd., #BVA03). Sequence-deleted constructs of EZH2 (Umine Biotechnology Co., Ltd., #BW2757) or MYC (Umine Biotechnology Co., Ltd., #BW2753) were generated by PCR and subcloned into pcDNA-3.1. Immunoprecipitation using anti-Flag (1:50; Cell Signaling Technology, #14793) or anti-HA (1:50; Cell Signaling Technology, #3724) was used to detect the interaction between Flag-MYC and HA-EZH2 in HEK293T cells.

[0082] 4) Cell viability and proliferation assay

[0083] 5×10 3 Cells (100 μL suspension per well) and 2 × 10 3Cells (100 μL suspension per well) were plated in 96-well plates for cell viability assay. After 12 h, cells were treated with the appropriate drug for the corresponding time, with DMSO (without drug treatment) serving as a negative control. Cell viability was measured using CCK8 (HANBIO, #HB-CCK-8-500T). Simply put, 10 μL of CCK8 solution was added to each well. After 2 hours of culture, the absorbance (A) at 450 nm was measured using a microplate reader (680 type, BIO-RAD, USA). The average absorbance values ​​of each well were used to calculate the proliferation inhibition rate: Inhibition rate = (1 absorbance of experimental group / absorbance of control group) × 100%. The half-maximum inhibitory concentration (IC50) was determined using Prism.

[0084] 5) Settlement formation experiment

[0085] 800 cells / well were plated in 6-well plates. After 12 hours, cells were treated with the appropriate drug, with DMSO (without drug) serving as a negative control. Cells were cultured for 10 days. Colonies were washed twice with cold PBS, fixed with 4% paraformaldehyde for 20 minutes, and developed with 0.1% crystal violet (Solarbio, #G1062) for 30 minutes. Colonies with ≥50 cells were counted under a microscope.

[0086] 6) Flow cytometry analysis

[0087] PI / RNase staining buffer (BD Pharmingen) was used respectively TM (#550825) and FITC Annexin V Apoptosis Detection Kit I (BD Pharmingen) TM Cell cycle and apoptosis were detected using the following assay (#556547). Cells were treated with the appropriate drugs for a specified time, then harvested and washed twice with PBS. Cell cycle assay: Cells were fixed overnight in 70% ethanol at 4°C, then resuspended in 500 μL LPI / RNase staining buffer and incubated in the dark at room temperature (RT) for 15 min, followed by flow cytometry analysis. In the apoptosis assay, cells were resuspended in 100 μL of 1X Annexin V Binding Buffer and incubated with 5 μL FITC Annexin V and 5 μL PI at RT for 15 min. 400 μL of 1X Binding Buffer was added to each tube, and samples were analyzed by flow cytometry within 1 h. Cell death assays included early apoptotic cells (PI negative, Annexin V positive) and late apoptotic cells (PI positive, Annexin V positive).

[0088] 7) Western blot and protein half-life determination

[0089] Cells were lysed in radioimmunoprecipitation (RIPA) lysis buffer (GenStar, #E125-01) and freshly doped with the protease inhibitor benzoyl fluoride (PMSF) (Fdbio Science, #FD0100). Protein concentration was determined using a bicapsulated cholic acid (BCA) protein assay kit (GenStar, #E162-01). Equal volumes of protein lysis buffer were loaded onto SDS-PAGE gels and transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, #IPVH00010). The blots were blocked with 5% skim milk at RT for 1 hour, followed by overnight incubation with primary antibody at 4°C. A suitable horseradish peroxidase (HRP)-conjugated secondary antibody was then incubated at RT for 1 hour. The results were analyzed using ImageQuant. TM Protein bands were visualized using the LAS 500 system (GE Healthcare Life Sciences, Japan). To determine protein stability and half-life, cells were treated with 100 μg / mL CHX, and cells were collected at specified time points (0, 15, 30, 60, and 90 min). Western blot analysis of the target protein was then performed using total cell lysis buffer. Protein abundance density analysis was performed using ImageJ software to generate protein degradation curves. Antibodies used are listed in Supplementary Table S2.

[0090] 8) Real-time quantitative PCR (qRT-PCR)

[0091] Total RNA was isolated using TRIzol reagent (Ambion, #15596026) and converted to cDNA using the PrimeScript RT reagent Kit with gDNA Eraser (Vazyme, #R323-01) according to the manufacturer's instructions. qRT-PCR was performed using SYBR Green PCRMaster Mix (Vazyme, #Q331-02). Relative gene expression levels were calculated using the 2-ΔΔCT method. The sequences of the primers used are listed in Supplementary Table S3.

[0092] 9) Immunoprecipitation and ubiquitination analysis

[0093] Cells were collected and thawed on ice for 30 minutes in NP-40 lysis buffer containing the protease inhibitor PMSF. To detect ubiquitination, cells were treated with 10 μM proteasome inhibitor MG132 for 6 hours before lysis. Cell lysates were centrifuged at 14000 × g for 20 min at 4 °C, and protein concentration was determined using the BCA Protein Assay Kit. 1 mg of protein was extracted from the lysates and incubated overnight at 4 °C with anti-EZH2 (1:3000; Cell Signaling Technology, #5246S), anti-MYC (1:3000; Abcam, #ab32072), or anti-fbxw7 (1:2000; Abcam, #ab109617). A negative control was prepared by incubating 1 mg of protein lysate with a nonspecific IgG antibody. Next, immune complexes were precipitated with 50 μL of protein G beads (Millipore, #16-266). After rotating at 4°C for 2 hours, the sample was washed twice with a mixture of NP-40 lysis buffer and 2×SDS loading buffer, and then boiled at 95°C for 10 minutes. The coprecipitate was analyzed by chemiluminescence Western blot.

[0094] 10) Immunohistochemistry

[0095] Immunohistochemistry was used to detect the protein levels of EZH2 and MYC in 20 pairs of paraffin-embedded HNSCC specimens. Immunohistochemical staining was evaluated by two independent pathologists. The staining intensity of malignant cells was scored to analyze protein expression levels: + (unstained), ++ (weakly stained), +++ (moderately stained), ++++ (strongly stained). Intensity scores less than or equal to ++ were considered low expression, while scores greater than ++ were classified as high expression.

[0096] 11) Immunofluorescence

[0097] Cells cultured in confocal medium were washed twice with cold PBS and fixed with 4% paraformaldehyde (Biosharp, #143174) at room temperature for 20 minutes. They were then infiltrated with 0.1% Triton X-100 (Sigma-Aldrich, #V900502) for 10 minutes, blocked with 5% bovine serum at room temperature for 30 minutes, and then incubated overnight at 4°C with EZH2 (1:2000; Cell Signaling Technology, #5246S) and MYC (1:2000; HUABIO, #RT1149) primary antibodies. Goat anti-rabbit IgG (1:1000; CellSignaling Technology, #4412) or goat anti-mouse IgG antibody (1:1000; CellSignaling Technology, #8890) labeled with Alexa fluorescence were incubated at rt for 1 h. Cell nuclei were reverse-stained with 4',6-diamino-2-phenylindole (DAPI) dye (Cell Signaling Technology, #4083S). Fluorescence images were obtained using a laser confocal fluorescence microscope (Olympus, FV3000, Japan).

[0098] 12) Xenograft model

[0099] Stable transfection with EZH2 vector or control vector (5×10) 6 Cancer cells (0.1 mL PBS) were subcutaneously injected into the right dorsal side of 4-week-old female Balb / c nude mice (SPF (Beijing) Biotechnology Co., Ltd.). Twelve days later, when the tumor size reached approximately 100–150 mm³, PBS, EPZ-6438 (50 mg / kg), or squamocin (0.4 mg / kg) were injected intraperitoneally every 3 days. Tumor volume (mm³) 3 )Measured with calipers, and calculated every three days throughout the experiment. The calculation formula is (length × width) 2 The width and length represent the vertical and maximum tumor diameter, respectively. At the endpoint, the tumor was removed and weighed. The tumor inhibition rate (TIR%) was calculated as follows: TIR% = (1 - Wt / Wn) × 100%, where Wn is the average tumor weight of the negative control group and Wt is the average tumor weight of the experimental group mice. The removed tissue was fixed with 10% neutral buffered formalin for histological examination. Animal care and experiments were strictly conducted in accordance with the "Principles of Vertebrate Utilization and Nursing" and the "Guidelines for Laboratory Animal Nursing and Use," and were approved by the Animal Nursing and Use Committee of Southern Medical University (SMU-L2021121).

[0100] 13) Toxicological experiments

[0101] To evaluate the optimal doses of squamocin and rotenone in Wister rats, the median lethal dose was assessed by rapid tail vein injection over 7 days. The lethal doses of rotenone were 100 μg / mL and 400 μg / mL, respectively. Next, one-fifth of the median lethal dose was selected as the highest dose for the experiment. Rats were intravenously injected daily for one week with either a high dose of 80 μg / kg, a medium dose of 32 μg / kg, or a low dose of 12.8 μg / kg of squamocin, or a high dose of 20 μg / kg of rotenone. At the end of the experiment, the levels of ALT, AST, urea, and CREA in the blood were assessed by biochemical analysis. Excised tissues were fixed in 10% neutral buffered formalin for histological examination.

[0102] 14) ChIP-coupled quantitative PCR analysis

[0103] Immunoprecipitation assays were performed using a ChIP kit (Cell Signaling Technology, #9003). SCC25 cells were cross-linked with formaldehyde and then subjected to H3K27me. 3 Antibody (1:50; Cell Signaling Technology, #9733) or rabbit IgG (1:50; Cell Signaling Technology, #2729). DNA fragments were purified and analyzed by quantitative PCR. ChIP-qPCR UNC5B primers: Forward, GAGTCCCAGTCCACCTGTTG; Reverse, CAGAGGTGAGGTGAAGGCAG.

[0104] 15) RNA sequencing and data analysis

[0105] Total RNA was purified using TRIzol reagent and then identified by 1% agarose gel electrophoresis and a Bioanalyzer 2100 system. Sequencing libraries were constructed using the NEBNext ultra-atm RNA Library Prep Kit for Illumina. Clean reads were generated by removing low-quality reads and then aligned with Human Genome Assembly GRCh38 / hg38 using hisat2 v2.0.5 (https: / / github.com / DaehwanKimLab / hisat2). Reads for each gene were counted using featurecots v1.5.0-p3, and the fragment number per kilobase (FPKM) for each gene was calculated based on gene length and read count. Differential gene expression analysis was performed using the R package DESeq2v1.16.1. Differentially expressed genes (DEGs) are defined as follows, unless otherwise specified. DEGs upregulated, log2(fold change) > 0, FDR < 0.05; DEGs downregulated, log2(fold change) < 0, FDR < 0.05. Gene ontology enrichment analysis was performed on co-upregulated or downregulated DEGs between SCC15 and SCC25 cells after treatment with squamocin (10 μg / mL) for 24 h using the DAVID web server (https: / / david.ncifcrf.gov / summary.jsp). Gene set enrichment analysis (GSEA) was performed using GSEA software (https: / / www.broadinstitute.org / gsea) by exploring the Molecular Signatures Database (https: / / www.broadinstitute.org / gsea / msigdb / annotate.jsp).

[0106] 16) Molecular docking

[0107] The molecular structure of squamocin was retrieved and downloaded from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ). Targeted phishing analysis was performed using the SwissTargetPrediction website (http: / / swisstargetprediction.ch / ). A computational docking model was constructed using the AutoDockVina program. The protein structures of HSP90α (PDB:2QG2) and other proteins were obtained from the Protein Data Bank (PDB, https: / / www.rcsb.org / ).

[0108] 17) Differential scanning fluorescence assay (DSF)

[0109] DSF experiments were performed using a Bio-Rad CFX Connect™ real-time system. First, 13.7 μL of Tris buffer (50 mM), 2 μL of protein (9 μM), and 0.5 μL of the compound were added to each well, followed by mixing with 1.8 μL of SYPRO Orange mixture (50-fold). Thermal denaturation was achieved by increasing the temperature from 25 °C to 100 °C (0.5 °C per minute).

[0110] 18) Surface Plasmon Resonance (SPR)

[0111] The binding affinity of squamocin to its target protein HSP90α was detected using a GE Healthcare Biacore 8k SPR instrument. Using a CM5 sensor chip, 18000 RU of the target protein was immobilized on the sensor surface in PBS running buffer at 25°C via a standard amine coupling reaction. Gradient concentrations of squamocin containing 5% DMSO were injected into the channels to assess its binding affinity. The dissociation constant (KD value) of the squamocin-HSP90α complex was calculated using Biacore 8k evaluation software. Kinetic methods were used to fit the results. 2 (RU2)=1.93; ka(1 / Ms)=1561.36; Kd(1 / s)=0.03).

[0112] 19) Cell heat transfer assay (CETSA)

[0113] 293T cells were transfected with HSP90αWT (wild-type) / HSP90α mutants (N51A, G97A, F138K, Y139R) pcDNA3.1-3×Flag-C plasmid for 48 h using Lipo3000. After incubation with squamocin for 6 h, the cells were divided into equal volumes and placed in PCR tubes. The cells were incubated at 40–64 °C in a 3 °C gradient for 3 min. After liquid nitrogen freezing and ice thawing three times, the supernatant was collected for Western blot analysis.

[0114] 20) Patient-derived xenograft (PDX) mouse model

[0115] The tumor tissue used to prepare the PDX mouse model was initially removed from CRC patients with signed consent for preclinical research. Simply put, under anesthesia and aseptic conditions, a small incision was made in the abdominal skin of an NSG mouse. Next, the collected tumor fragments were placed in a cavity under the skin, and the wound was sutured. This instance was considered generation 0 of the PDX mouse model. When the tumor volume reached 1500 mm³, it was removed and re-implanted into mice using the same procedure until the third generation. At this point, whole-exome sequencing confirmed that the model was considered stable and could guarantee growth after re-implantation. Tumor volume (mm³) 3 ) Measured with calipers, and calculated every three days during the experiment. The calculation formula is (length × width) 2 ) / 2.

[0116] 21) Statistical analysis

[0117] Statistical analysis was performed using IBM SPSS Statistics 26. Data are expressed as mean ± SEM. Two-tailed Student's t-tests were used for comparisons between two groups, while two-way ANOVA was used to calculate statistical significance among three or more groups. Wilcoxon paired signed-rank tests were used to calculate differences in expression of each molecule in the ordinal data. Survival data were plotted as Kaplan-Meier curves, and log-rank tests were used to estimate significance. A p-value (two-tailed) < 0.05 was considered statistically significant. ***p < 0.05, p < 0.01, ***p < 0.001.

[0118] 3.2 Experimental Results

[0119] 1) Squamocin inhibits the proliferation of HNSCC cell lines with high MYC expression.

[0120] We found that squamocin has different effects on cells with different MYC expression levels. It has a high inhibitory effect on HNSCC cell lines with high MYC expression levels (CAL27, FADU, SCC15, and SCC25), while its effect on non-cancer cell lines with low MYC expression levels (NOK and HUVEC) is weaker. Figure 1 A). Next, SCC15 and SCC25 cells were treated with squamocin at doses of 5–20 μg / mL for 12, 24, and 48 h, respectively. Therefore, we found that squamocin significantly inhibited the cell viability of both HNSCC cell lines in a dose- and time-dependent manner. Figure 1 B). Calculate the half-maximal inhibitory concentrations (IC50) of SCC15 (IC50 = 11.65 μg / mL) and SCC25 (IC50 = 10.85 μg / mL). Figure 1 B). Squamocin treatment significantly reduced colony counts in SCC15 and SCC25 cells. Cell cycle analysis showed that 10 μg / mL squamocin arrested the cell cycle in both S and G2 / M phases in SCC15 cells, while it only arrested the cell cycle in S phase in SCC25 cells. Figure 1 C).

[0121] 2) Squamocin inhibits mitochondrial respiratory complex I

[0122] It has been reported that squamocin inhibits mitochondrial respiratory complex I, thereby hindering mitochondrial oxidative phosphorylation and inducing apoptosis. To investigate whether the pro-apoptotic activity of squamocin is attributable to its inhibition of mitochondrial respiratory complex I, we evaluated the effects of squamocin on mitochondrial function in two HNSCC cell lines. As expected, squamocin significantly inhibited the activity of mitochondrial respiratory complex I and reduced ATP production (…). Figure 2 A). When these cells were pretreated with the mitochondrial-specific antioxidant mito-TEMPO, ATP consumption was partially recovered. Figure 2 B). Furthermore, squamocin increased reactive oxygen species (ROS) levels in both HNSCC cell lines; however, ROS accumulation was significantly inhibited when these cells were pretreated with mito-TEMPO. Figure 2 C). These data confirm that squamocin impairs the function of mitochondrial respiratory complex I in HNSCC cells. However, unexpectedly, flow cytometry showed that both HNSCC cell lines pretreated with mito-TEMPO (10 μM or 100 μM) only partially inhibited squamocin-induced apoptosis. Figure 2D) suggests that there may be other mechanisms mediating the antitumor effects of squamocin.

[0123] HSP90α is a direct binding target of squamocin.

[0124] To address this issue, we performed target-hunting analysis using the SwissTargetPrediction database, identifying 100 potential squamocin protein targets (Table S1). Subsequently, we conducted protein-protein interaction analysis to investigate key proteins between these targets, using the STRING database to screen for nodes with the highest confidence levels (0.900). Figure 3 A). Molecular docking analysis of the top 10 proteins with squamocin using the Autodockvina program revealed that squamocin had the lowest binding energy to the n-segment peptide chain of the 90 kDa heat shock protein (HSP90α, encoded by HSP90AA1, Table S1). HSP90α is an ATP-guided molecular chaperone and one of the most abundant cytoplasmic molecular chaperones, playing an important role in regulating protein homeostasis. The docking results showed that squamocin and HSP90α bind at Asn51... Gly97 Phe138 and Tyr139 Formation of conventional hydrogen bonds ( Figure 3 B, Figure 3 C). To verify the calculated docking results, we used differential scanning fluorescence (DSF) and surface plasmon resonance (SPR) analysis to evaluate the binding affinity of squamocin to HSP90α. In the DSF experiment, squamocin exhibited a thermal displacement (ΔTm1) from 2.5 °C to 9.5 °C, and in the SPR experiment, the KD value was 1.9 × 10⁻⁵ M. Figure 3 D, Figure 3 E).

[0125] 3) Cell heat transfer assay (CETSA) and knockdown assay to verify the binding of squamocin to HSP90α.

[0126] To validate the predicted binding mode, we constructed the N51A / G97A / F138K / Y139R HSP90α- mutant and reassessed its binding ability using a cell heat transfer assay (CETSA). The results showed that this mutant eliminated the binding of squamocin to HSP90α. Figure 4 A) indicates that HSP90α is a direct target of squamocin. Importantly, we found that knockdown of HSP90α reduced the sensitivity of HNSCC cell lines to squamocin (A). Figure 4 (B) We also found that knockdown of HSP90α led to a decrease in EZH2 and MYC protein levels in SCC15, suggesting that HSP90α is involved in the stability of EZH2 and MYC. These results indicate that squamocin-induced degradation of EZH2 and MYC may be primarily dependent on HSP90α.

[0127] 4) Squamocin inhibits tumor growth in HNSCC primarily in an EZH2-dependent manner.

[0128] Since EZH2 can regulate MYC expression at the transcriptional level or promote MYC stability as a non-PCR2 chaperone in several tumors, this prompted us to investigate whether squamocin treatment also affects EZH2 levels in two HNSCC cell lines. Notably, squamocin reduced EZH2 homeostatic protein levels in a dose-dependent manner without affecting EZH2 mRNA levels. Figure 4 C), indicating that squamocin regulates EZH2 through a posttranscriptional mechanism. After squamocin depletes EZH2, the levels of total H3K27me3 (a marker of EZH2 deposition) and MYC also decrease in a dose-dependent manner. Figure 4 C), both the cytoplasm and nucleus undergo depletion of EZH2 and MYC. Figure 4 D). Importantly, as assessed by CCK8 and colony formation assays, EZH2 overexpression largely rescued the squamocin-induced proliferation inhibition. Figure 4 (E, F). Flow cytometry showed that EZH2 overexpression alleviated squamocin-induced cell cycle arrest and apoptosis. Overall, these findings suggest that squamocin inhibits tumor growth in HNSCC primarily in an EZH2-dependent manner.

[0129] 5) EZH2 and MYC have a synergistic effect on the progress of HNSCC.

[0130] Immunofluorescence analysis showed that EZH2 and MYC were mainly co-localized in the nuclei of SCC15 and SCC25 cells, and the upregulation and loss of EZH2 similarly disrupted the nuclear accumulation of MYC. Figure 5 A). Furthermore, reciprocal co-immunoprecipitation (Co-IP) confirmed the interaction between EZH2 and MYC in both HNSCC cell lines. Figure 5 B). We found that the MYC central domain (CD) and Y-like protein binding region (CDYL BR) of EZH2 are the reason for their direct interaction. Figure 5 These results indicate that MYC is a true interacting partner of EZH2.

[0131] 6) EZH2 enhances the transcriptional activity of MYC.

[0132] Next, we investigated the effects of EZH2 on the stability and transcriptional activity of MYC protein. Notably, time-course experiments showed that forced expression of EZH2 prolonged the half-life of endogenous MYC protein from 53.7 min to 81.3 min, while knockdown of EZH2 accelerated MYC protein turnover, shortening its half-life from 58.1 min to 24.4 min and 22.3 min, respectively. Figure 6 A). Furthermore, MYC deficiency caused by EZH2 deficiency can be effectively restored by the proteasome inhibitor MG132 (A). Figure 6 B) This indicates that the ablation of EZH2 stimulates the proteasome degradation of MYC. A key characteristic event of MYC degradation involves the sequential phosphorylation of two key residues, serine 62 (p-S62) and threonine 58 (p-T58), which respectively lead to the stabilization and instability of MYC. Consistently, ectopic expression of EZH2 has little effect on p-S62 levels but significantly reduces p-T58 levels, while conversely, EZH2 depletion leads to a significant increase in p-T58 levels. Figure 6 C). Furthermore, MYC target genes such as TP53, BMI1, PCNA, and CCND1 were significantly elevated in EZH2-overexpressing SCC15 cells, but downregulated in EZH2-deficient SCC25 cells. Figure 6 D) indicates that EZH2 enhances the transcriptional activity of MYC.

[0133] 7) Squamocin effectively inhibits EZH2 methyltransferase activity and promotes MYC degradation in HNSCC.

[0134] Because squamocin causes a decrease in H3K27me3 levels ( Figure 4 (C, D) We hypothesized that it might inhibit the enzymatic function of EZH2. We treated two HNSCC cell lines with 10 μg / mL squamocin or 25 μM (14 μg / mL) EPZ-6438 (the first EZH2 enzyme inhibitor approved by the US Food and Drug Administration (FDA)). Notably, although EPZ-6438 and squamocin showed comparable efficacy in inhibiting H3K27me3 levels, only squamocin significantly inhibited the accumulation of MYC protein (C). Figure 7A). To further investigate the methyltransferase activity of EZH2, we performed transcriptomic analysis to assess the response of H3K27me3 to squamocin. In SCC15 and SCC25 cells, comparing squamocin treatment with a DMSO control revealed a set of common differentially expressed genes (DEGs) with a false discovery rate (FDR) <0.05, including 3256 upregulated genes and 2770 downregulated genes. Figure 7 B). As expected, several typical EZH2-PRC2 target genes that are repressed by H3K27me3 transcription, such as UNC5B, SMAD7, and GPRC5C, were significantly upregulated after treatment of the SCC25 cell line with squamocin. Figure 7 C). Consistent with this, ChIP-qPCR assays confirmed that in SCC25 cells, treatment with squamocin resulted in a decrease in the overall enrichment of H3K27me3 on the UNC5B promoter. Figure 7 (D, E). Given the significant effect of squamocin on MYC degradation, we investigated whether squamocin regulates MYC transcriptional activity. Our RNA-seq data showed that squamocin treatment upregulated the expression of MYC-inactivating genes and downregulated the expression of MYC-activating genes in SCC15 and SCC25 cells. qRT-PCR confirmed that squamocin, but not EPZ-6438, inhibited the MYC activation target. Overall, these results indicate that in HNSCC cell lines, squamocin effectively depletes EZH2 histone methyltransferase and its non-catalytic binding partner MYC.

[0135] 8) Transcriptomic analysis revealed that squamocin treatment significantly upregulated endoplasmic reticulum stress and UPR.

[0136] MYC-hyperactivated tumor cells exhibit enhanced activation of the endoplasmic reticulum (UPR) in various human cancers. Consistent with this view, persistent, non-lethal UPR signaling was demonstrated in both in vitro and in vivo models of HNSCC, representing a potential therapeutic target: cancer cells with constitutively active UPR are highly sensitive to additional endoplasmic reticulum stress, which may induce apoptosis. Importantly, we observed that squamocin not only inhibits mitochondrial respiratory complex I, leading to increased reactive oxygen species (ROS) and decreased ATP levels, but also disrupts the binding of HSP90α and ATP, both of which synergistically promote endoplasmic reticulum stress and UPR. As expected, gene ontology (GO) analysis showed that commonly upregulated degs were significantly enriched in both "response to endoplasmic reticulum stress" and "response to unfolded protein (UPR)". Figure 8A). Gene set enrichment analysis (GSEA) confirmed that squamocin treatment led to a significant upregulation of endoplasmic reticulum stress and UPR. Figure 8 B).

[0137] Using specific inhibitors, it was confirmed that squamocin activates endoplasmic reticulum stress and enhances the degradation of endoplasmic reticulum-related proteins in HNSCC cells.

[0138] In mammalian cells, the UPR is initiated by three endoplasmic reticulum transmembrane proteins that act as sensors for endoplasmic reticulum stress: activated transcription factor 6 (ATF6), inositol demand enzyme 1α (IRE1α), and prkr-like endoplasmic reticulum kinase (PERK). We consistently found that squamocin treatment enhanced the accumulation of three endoplasmic reticulum stress sensors, XBP1s, ATF4, and ATF6, in SCC15 and SCC25 cell lines, and blocking any of these sensors with specific inhibitors significantly attenuated squamocin-induced degradation of EZH2 and MYC. Figure 8 C).

[0139] 9) Protein half-life and ubiquitination experiments confirmed that EZH2 and MYC proteins were ubiquitinated and degraded by squamocin. To determine which pathway was involved in squamocin-induced EZH2 and MYC degradation, we first performed time-course analysis, which confirmed that squamocin significantly shortened the half-life of endogenous EZH2 and MYC proteins. Figure 9 A). Secondly, the proteasome inhibitor MG132 effectively rescued the decline in EZH2 and MYC protein levels; however, administration of the autophagy inhibitor chloroquine (CQ) did not produce similar results. Figure 9 B) indicates that squamocin-mediated degradation of EZH2 and MYC occurs via the UPS pathway. Third, ubiquitination experiments confirmed that in both HNSCC cell lines, EZH2 and MYC proteins were ubiquitinated and degraded by squamocin. Figure 9 C, D). Similar to siRNA deletion in EZH2 ( Figure 6 C), we also observed a significant increase in MYC p-T58 in SCC15 and SCC25 cells after squamocin treatment. Figure 9 E).

[0140] qRT-PCR analysis results support that squamocin reprograms the UPS by triggering endoplasmic reticulum stress.

[0141] Typically, ubiquitination is a specific molecular mechanism mediated by squamous proteins, achieved through a sequential enzyme-linked reaction involving E1 activator (E1), E2 conjugator (E2), E3 ligase (E3), and deubiquitinases (DUBs). We analyzed global UPS in RNA-seq data. Notably, many human ubiquitinase genes were upregulated by squamocin. We validated the RNA-seq results by performing qRT-PCR analysis on two HNSCC cell lines, revealing that squamocin significantly upregulated a group of key UPS genes, including E1s (UBA6), E2s (UBE2Z, UBE2B, UBE2E2, UBE2E3, and UBE2S), and E3s (FBXW7).

[0142] 10) Knockout experiments showed that the UBA6-UBE2Z cascade is responsible for squamocin-induced degradation of EZH2 and MYC proteins.

[0143] We found that UBA6 was co-upregulated in both HNSCC cell lines, as was UBA1. Knocking out UBA6 eliminated squamocin-mediated ubiquitination and degradation of EZH2 and MYC. Figure 10 A). This indicates that in HNSCC cells, squamocin activates UPS via UBA6 rather than UBA1. Since UBE2Z (UBA6-specific E2s) was significantly co-upregulated in both squamocin-treated HNSCC cell lines, we next investigated whether UBE2Z could mediate the degradation of EZH2 and MYC. The results showed that in UBE2Z knockout HNSCC cell lines, squamocin failed to reduce the levels of EZH2 and MYC. Figure 10 B) This indicates that the enhancement of the UBA6-UBE2Z cascade is the cause of squamocin-induced degradation of EZH2 and MYC proteins.

[0144] 11) Heatmap clustering analysis showed that EZH2 may bind to downstream e3 ligases.

[0145] Heatmap clustering analysis showed that DUBs (USP28, USP37, USP33, and USP22), BTRC, and SKP2 were downregulated, which stabilized EZH2 or MYC, while E3s responsible for degrading EZH2 or MYC, including NEDD4L, PML, FBXO8, FBXW7, and RING1, were increased by squamocin.

[0146] 12) qRT-PCR and knockout experiments confirmed that FBXW7 binds to EZH2 and MYC.

[0147] qRT-PCR results showed that, after squamocin treatment, the e3 expression of FBXW7 and RING1 was most significantly upregulated. Figure 10 C). Using specific siRNAs, we observed that knockout of FBXW7 significantly blocked squamocin-induced degradation of EZH2 and MYC. Figure 10 D), however, knocking out RING1 has almost no effect ( Figure 10 E) indicates that squamocin degrades EZH2 and MYC primarily in an FBXW7-dependent manner. Co-IP assays confirmed the binding of FBXW7 to EZH2 and MYC.

[0148] 13) Squamocin inhibits the EZH2 / MYC axis in various tumors.

[0149] To investigate whether squamocin can inhibit tumor growth in vivo by targeting the EZH2-MYC axis, we established a stably EZH2-overexpressing HNSCC xenograft model in nude mice. EZH2-overexpressing or control SCC15 tumor-bearing mice were intraperitoneally injected with phosphate-buffered saline (PBS), EPZ-6438, or squamocin every 3 days for a total of 5 times. The results were consistent: EZH2 overexpression led to a significant increase in tumor volume and weight, while treatment with EPZ-6438 or squamocin effectively eliminated this effect. Figure 11 (AC). The tumor growth inhibition rates (TIR) ​​of Squamocin and EPZ-6348 were 84.06% and 65.22%, respectively. Immunohistochemical staining of xenografts showed that EZH2 overexpression was accompanied by elevated levels of Ki67, H3K27me3, and MYC. Similar to EPZ-6438 treatment, Squamocin significantly reduced EZH2, Ki67, and H3K27me3 levels. 3 The level was [missing information], but only tumors treated with squamocin showed significant MYC deficiency. Figure 11 D). In summary, these results highlight the potential advantage of squamocin over EZH2-targeting enzyme inhibitors in the degradation of MYC, indicating that squamocin not only inhibits the catalytic activity of EZH2 but also its atypical activity.

[0150] Subsequently, we evaluated the effects of squamocin in other in vivo tumor models. The antitumor efficacy of squamocin was assessed using AGS and SW480 xenograft models. Results showed that squamocin effectively inhibited tumor growth in both GC and CRC, with time-to-intervention (TIR) ​​rates of 56.49% and 53.82%, respectively. In contrast, EPZ-6438 showed TIR rates of 32.7% and 27.43% in GC and CRC, respectively. Figure 11E, F). Furthermore, squamocin showed good safety in mouse models, as no significant histological changes were observed in vital organs such as the heart, liver, spleen, lungs, and kidneys.

[0151] In this invention, we observed that the single ACG compound squamocin disrupts cell cycle progression, leading to tumor cell apoptosis and cellular responses including endoplasmic reticulum stress and overall UPS reprogramming. To our knowledge, this is the first time a functional link between squamocin and ubiquitination and degradation of er-related proteins has been discovered. These intrinsic tumor cell events induce a robust tumor arrest in HNSCC via ubiquitination and degradation of EZH2 and its non-PCR2 partner MYC. The ubiquitination cascade composed of UBA6, UBE2Z, and FBXW7 may control squamocin-induced ubiquitination of EZH2 and its non-PCR2 partner MYC. PCR Degradation of MYC, a partner cell. To investigate the drug target of squamocin, three drug target identification techniques were used, and orthogonal analysis confirmed HSP90α as the direct target of squamocin. Mechanistically, squamocin not only inhibits mitochondrial respiratory complex I, leading to reduced ATP production and increased ROS accumulation, but also impairs the binding of HSP90α to ATP. These intrinsic tumor cell events induced by squamocin collectively trigger UPR and ER stress responses, leading to ERAD-mediated degradation of EZH2 and its non-PCR2 partner MYC, resulting in apoptosis. These observations reveal a novel ubiquitination cascade that regulates the degradation of squamocin to EZH2 and its non-PCR2 partner MYC, highlighting the potential of squamocin as a therapeutic strategy.

[0152] In summary, our data elucidate the role of squamocin in inhibiting EZH2 and its non-PCR2 partner MYC, and provide evidence for future clinical trials in HNSCC. Given the pervasive role of EZH2 and MYC in tumorigenesis, such inhibitors will contribute to accelerating the development of therapies targeting EZH2-MYC-dependent cancers.

[0153] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. The application of squamocin, an anthocyanin compound, as the sole active ingredient in the preparation of drugs for treating tumors, wherein... The tumor is squamous cell carcinoma of the head and neck and / or colorectal cancer.

2. The application according to claim 1, wherein, The tumor is a squamous cell carcinoma of the head and neck.

3. The application according to claim 1, wherein, The tumor is colorectal cancer.

4. The application according to any one of claims 1-3, wherein, The dosage form of the drug is tablets, capsules, granules, solutions, pills, suspensions, or sustained-release formulations.

5. The application according to claim 4, wherein, The tablets are enteric-coated tablets or effervescent tablets.

6. The application according to any one of claims 1-3, wherein, The applications include squamocin as an inhibitor targeting the UBA6-UBE2Z-FBXW7 ubiquitin cascade to degrade the EZH2 and MYC pathways.

7. The application according to any one of claims 1-3, wherein, The applications include squamocin as an inhibitor targeting the heat shock protein Hsp90α.

Images