Application of WH-4-023 in preparation of medicine for inhibiting formation of CAF

Abstract

The invention provides an application of WH-4-023 in preparation of a medicine for inhibiting formation of tumor-associated fibroblasts. Specifically, it is found that WH-4-023 can affect the formation process of a tumor microenvironment of targeted tumor-related fibroblast cells, development of solid tumors is effectively inhibited from the source, and then increase of the tumor volume is inhibited.

Description

Technical Field

[0001] The invention belongs to the field of medicine, and in particular relates to an application of WH-4-023 in preparing a medicine for inhibiting CAF formation. Background Art

[0002] Cancer is one of the most harmful diseases to human life and health, and a large number of people die from cancer every year. Gastric cancer is a common tumor of the digestive system, and its course is insidious, making early diagnosis extremely difficult.

[0003] Gastric cancer has great regional differences. Melanoma, also known as malignant melanoma, is a highly malignant tumor originating from melanocytes and mainly occurring in the skin. Although melanoma accounts for only 10% of skin cancers, it accounts for 80% of skin cancer mortality. Melanoma is also showing a rapid upward trend in my country. It metastasizes early, progresses quickly, has a poor prognosis, and a high mortality rate.

[0004] At present, the main treatments for gastric cancer and melanoma are surgery, chemotherapy and radiotherapy. These methods are defective. Only patients in the early stage can undergo surgery. Surgery is a local treatment method and has no effect on tumor cells that have metastasized to the blood or other tissues. There are many postoperative complications, which further aggravates the pain of patients. Chemotherapy refers to the use of drugs to treat diseases. The drugs used cannot identify cancer cells and only kill rapidly proliferating cells non-specifically, resulting in bone marrow cells, digestive tract mucosa, hair and other rapidly proliferating normal cells being killed, causing side effects such as bone marrow suppression, vomiting, diarrhea, and hair loss. Radiotherapy is a method of using radiation to kill cancer tissue. Although radiation is more likely to damage cancer cells, it also damages normal cells, causing local or systemic radiation reactions.

[0005] As knowledge of cancer continues to expand, researchers have come to realize that the tumor microenvironment is a heterogeneous, complex system that is primarily composed of tumor cells and non-malignant host components, including immune cells, stroma, and vascular systems. In many tumors, such as pancreatic cancer, lung cancer, breast cancer, and colorectal cancer, stroma accounts for up to 90% of the tumor mass. There are both cellular and non-cellular components in the tumor stroma, including collagen, fibroblasts, and mesenchymal stromal cells.

[0006] Fibroblasts are one of the most abundant and critical cell types in the tumor stroma and are the main producers of the extracellular matrix (ECM). In the tumor microenvironment, various inflammatory cytokines produced by tumor cells, host immune cells, and stromal cells can activate fibroblasts. These activated fibroblasts are called tumor-associated fibroblasts (CAFs). CAFs are an important component of the structure of solid tumors and also play an important role in forming the tumor immunosuppressive environment. Compared with normal tissue fibroblasts, CAFs have significant tumor-promoting properties and can produce extracellular matrix, proteases, growth factors, chemokines, etc., which can promote tumor proliferation, angiogenesis, invasion, and metastasis, and play an important role in tumor progression. At present, CAFs are generally divided into three subgroups, namely, CAFs with myofibroblast characteristics (myCAFs), CAFs with inflammatory characteristics (iCAFs), and CAFs with antigen presentation ability (apCAFs). Among them, myCAFs are close to tumor cells and express high levels of α-SMA. Their formation affects tumor development and determines the size. In recent years, CAF targeted therapy has made significant progress. The main purposes of these methods are: (1) directly or indirectly deplete CAFs; (2) reduce or eliminate the tumor-promoting and immunosuppressive functions of CAFs; (3) normalize or reprogram CAFs to a quiescent state. However, existing methods are all targeted at established CAFs, and there are no reports on inhibiting the formation of CAFs (especially myCAFs) to prevent or treat solid tumors.

[0007] WH-4-023 (Monensin) is a small molecule SRC kinase inhibitor that can effectively and specifically inhibit the activity of protein tyrosine kinase SRC. Currently, there are no reports on the relationship between WH-4-023 and tumor and CAF formation.

[0008] At present, although there are related drugs with different mechanisms that can target and eliminate CAFs, there are no reports of drugs that directly target the differentiation and formation of CAFs, nor are there any public ideas for using drugs that directly target the differentiation and formation of CAFs (especially myCAFs) to treat tumors. It is foreseeable that effectively inhibiting the differentiation and formation of CAFs can effectively inhibit the occurrence and development of solid tumors from the root, which is of great practical significance for exploring ideas for tumor treatment. Summary of the invention

[0009] In view of this, the present invention aims to propose an application of WH-4-023 in the preparation of a drug for inhibiting the formation of CAFs, thereby effectively inhibiting the occurrence and development of solid tumors by inhibiting the differentiation and formation of CAFs from the root.

[0010] To achieve the above object, the technical solution of the present invention is implemented in the following manner:

[0011] In a first aspect, the present invention provides the use of WH-4-023 in the preparation of a drug for inhibiting CAF formation. The structure of WH-4-023 is shown in Formula I:

[0012]

[0013] Preferably, the CAF is myCAF.

[0014] Preferably, the inhibiting of CAF formation includes inhibiting the formation of melanoma CAF and / or gastric cancer CAF.

[0015] Our research shows that functional CAFs in tumors are differentiated from a type of precursor cells with cell stemness. Therefore, inhibiting the further differentiation of this precursor cell has the potential to inhibit tumor formation. The inventors creatively discovered that CAFs are differentiated from their precursor CD34+Pi16+ fibroblasts. Furthermore, after computational screening and experiments, we found that WH-4-023 can inhibit the differentiation of precursor CD34+Pi16+ fibroblasts, and verified that it is a drug that inhibits CAF formation and further inhibits tumors, and has achieved good results in cell experiments and mouse models.

[0016] In a second aspect, the present invention provides the use of WH-4-023 in the preparation of a drug for inhibiting the differentiation of CAF precursor CD34+Pi16+ fibroblasts into CAFs.

[0017] In a third aspect, the present invention provides the use of WH-4-023 in the preparation of a drug for preventing or treating solid tumors.

[0018] Preferably, there is provided use of WH-4-023 in the preparation of a medicament for preventing or treating melanoma.

[0019] Preferably, there is provided use of WH-4-023 in the preparation of a medicament for preventing or treating gastric cancer.

[0020] Preferably, the WH-4-023 is an injection or an oral preparation.

[0021] Preferably, the dosage of WH-4-023 is 0.1-2.0 mg / kg body weight.

[0022] Further preferably, the dosage of WH-4-023 is 0.5-1.0 mg / kg body weight.

[0023] More preferably, the dosage of WH-4-023 is 1.0 mg / kg body weight.

[0024] In a fourth aspect, the present invention provides a use of a pharmaceutical composition in the preparation of a drug for preventing or treating solid tumors, wherein the pharmaceutical composition comprises WH-4-023, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

[0025] Preferably, the solid tumor is melanoma or gastric cancer.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. The inventors creatively discovered that CAFs differentiate from their precursor CD34+Pi16+ fibroblasts, which has a pioneering significance in the important research idea of ​​"blocking the CAF differentiation signal pathway";

[0028] 2. Based on the discovery of the above differentiation signaling pathway, the inventors found that, unlike previous drugs that target the elimination of CAFs, WH-4-023 can promote the growth and stemness maintenance of CD34+Pi16+ fibroblasts, inhibit the differentiation of CD34+Pi16+ fibroblasts into CAFs, and then inhibit the differentiation and formation of CAFs from the root, that is, block the formation process of CAFs when they are not formed, thereby achieving a more effective effect of inhibiting the occurrence and development of solid tumors;

[0029] 3. The main contribution of the present invention is that, based on the formation of CAFs in different tumors and the confirmation of the formation mechanism, it is found that WH-4-023 can stably control the formation of tumor CAFs under specific dosage conditions, thereby inhibiting the development of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0031] Figure 1 This is the situation of melanoma subcutaneous tumor 12 days later;

[0032] Figure 2 This is a graph showing the changes in tumor volume of melanoma from day 0 to day 12. The unit of tumor volume in the graph is mm. 3 ;

[0033] Figure 3 This is the situation of gastric cancer subcutaneous tumor formation 20 days later;

[0034] Figure 4 This is a graph showing the changes in tumor volume from day 0 to day 20 for gastric cancer. The unit of tumor volume is mm. 3 ;

[0035] Figure 5The changes of CD34, Pi16, α-SMA, etc. after multiple fluorescent staining of melanoma tissue sections at 12 days of subcutaneous tumor formation;

[0036] Figure 6 The statistical results are from multiple fluorescent staining of melanoma tissue sections at 12 days after subcutaneous tumor formation.

[0037] Figure 7 To isolate tumor CD34+ fibroblasts, RNA was extracted after 7 days of in vitro differentiation culture, and the statistical results of CD34, Pi16, α-SMA and other transcription levels;

[0038] Figure 8 To show the expression of CD34, Pi16, and α-SMA after multiple immunofluorescence staining of differentiated cells;

[0039] Fig. 9 This is the statistical result of the number of cells expressing CD34, Pi16, and α-SMA in each field of view after multiple immunofluorescence staining of differentiated cells. DETAILED DESCRIPTION

[0040] Unless otherwise defined, the technical terms used in the following examples have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. The test reagents used in the following examples, unless otherwise specified, are all conventional biochemical reagents; the experimental methods, unless otherwise specified, are all conventional methods.

[0041] In the present invention, the term "CAF" refers to tumor-associated fibroblasts, which are an important component of the structure of solid tumors.

[0042] The term "myCAF" refers to a subpopulation of CAFs with myofibroblastic characteristics.

[0043] The term "CD34" is a highly glycosylated type I transmembrane glycoprotein that is selectively expressed on the surface of human and other mammalian hematopoietic stem / progenitor cells and gradually weakens and disappears as the cells mature. Existing research results show that CD 34 molecules play an important role in mediating intercellular adhesion, and can participate in the transportation and colonization of hematopoietic stem cells, participate in inflammatory responses, and the homing of lymphocytes.

[0044] The term "Pi16" stands for Peptidase Inhibitor 16 (PI16 for short), which is a protein belonging to the peptidase inhibitor family. It is widely distributed in the human body, including in tissues such as the lungs, kidneys, liver, and gastrointestinal tract. Pi16 regulates and controls the proteolytic process in the body by inhibiting the activity of specific peptidases. It can interact with a variety of peptidases and inhibit their activity, thereby regulating peptidase-mediated physiological and pathological processes. Several studies have shown that Pi16 is expressed in a variety of stem and progenitor cells. The inhibitory effect of Pi 16 can affect a variety of biological processes, including inflammatory responses, immune regulation, cell proliferation, and apoptosis. Studies have shown that peptidase inhibitor 16 may play an important role in the occurrence and development of tumors. Its expression level is closely related to the invasion and metastasis ability of tumors. In addition, Pi 16 is also involved in the occurrence and development of some other diseases, such as cardiovascular disease, diabetes, and neurological diseases.

[0045] The term "α-SMA" stands for α-smooth muscle actin. α-SMA is a protein highly expressed in smooth muscle cells, which is involved in regulating the contraction and relaxation of smooth muscle cells. It is also an important marker for tumor-associated fibroblasts. Anti-α-smooth muscle actin antibodies can be used to detect the presence and distribution of myCAFs by immunohistochemistry.

[0046] The term "Merge" means that in immunofluorescence staining, images of different stains are superimposed together to simultaneously display their positions and relationships. Usually, in immunofluorescence staining, different target molecules or cell structures are labeled with different fluorescent dyes, such as using green fluorescent dye to label one protein and red fluorescent dye to label another protein. Merge images are images of these different stains superimposed together, using channels of different colors to represent different stains. Through Merge images, the positions and relationships of target molecules or cell structures with different stains can be displayed simultaneously, helping researchers observe and analyze their interactions or colocalization. Merge images are usually presented in color, where different stains are represented by different colors. For example, green and red stains are represented by green and red channels, respectively, and when the two stains overlap, yellow is formed. By observing the Merge image, you can intuitively understand the relationship and interaction between target molecules or cell structures with different stains.

[0047] The term "DAPI" means DAPI is a fluorescent dye, and its full name is 4',6-diamino-2-phenylpyridine. It is a DNA dye that can bind to the double helix structure of DNA and emit blue fluorescence. DAPI can be used to stain cell nuclei to observe and quantify the number, morphology and distribution of cell nuclei. In immunofluorescence staining, DAPI is often used with other fluorescent dyes to mark different cell structures or molecules with different fluorescent colors.

[0048] The term "COL1A1" stands for collagen Iα1 chain gene, which is one of the important markers of fibroblasts. Collagen is a protein mainly found in connective tissue. It is an important component of skin, bones, tendons, blood vessels and other connective tissues. Mutations or abnormal expression of the COL1A1 gene are associated with a variety of diseases and disease-related tissue fibrosis, such as osteoporosis, fracture healing, etc.

[0049] The term "SPARC" is a protein, and its full name is Secreted Protein Acidic and Rich in Cysteine. It is an extracellular matrix protein secreted by matrix cells and can also be used as a marker for matrix cells. SPARC plays an important regulatory role in the extracellular matrix. It is involved in the synthesis, remodeling and degradation of the extracellular matrix, and has a regulatory effect on the structure and function of the extracellular matrix. In addition, SPARC is also involved in the regulation of cell-cell and cell-matrix interactions, and has an impact on biological processes such as cell migration, proliferation and differentiation.

[0050] The present invention will be described in detail below with reference to the embodiments and the accompanying drawings.

[0051] It should be noted that all procedures in the experiments related to the present invention have been approved by the relevant ethics committees and animal research institutional committees, and meet the requirements of relevant management regulations. All animal experimental treatment procedures were carried out in accordance with the "Guidelines for the Care and Use of Laboratory Animals of the National Institutes of Health", which has been approved by the Institutional Ethics Committee of Shanghai Xinhua Hospital. The animal experimental methods were approved by the Institutional Animal Research Committee of Shanghai Jiao Tong University School of Medicine. Clinical samples of subjects were collected at Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. Written informed consent was obtained from all subjects before participating in this study. All clinical studies were conducted in accordance with the "Declaration of Helsinki" and approved by the Research Ethics Committee of Xinhua Hospital, Shanghai Jiao Tong University School of Medicine.

[0052] In the specific embodiment of the present invention, the data with the number of experimental repetitions ≥ 5 times were subjected to the Kolmogorov-Smirnov normality test to determine the normality of the data and the F test to evaluate the homogeneity of variance. The two groups of data were analyzed using unpaired and two-tailed Student's t-tests. The data were expressed as mean ± standard deviation using GraphPad Prism 8 software. One-way analysis of variance and Bonferroni post hoc analysis were used for comparisons between multiple groups, with 5 experimental replicates per group. The Kruskal-Wallis test was used to evaluate the comparisons between multiple groups, with 3 experiments repeated per group, followed by Bonferroni post hoc analysis. Appropriate significance was obtained at a relatively small population size. P<0.05 was considered statistically significant.

[0053] Example 1 Verification of the anti-tumor activity of WH-4-023 by animal experiments

[0054] 1. Establishment of Mouse Tumor Model

[0055] 8-week-old C57BL / 6J, 615 mice and Cd34-CreERT2; Rosa26-LSL-tdTomato mice (C57BL / 6J background, Shanghai Biological Model Biotechnology Development Co., Ltd.) were selected and fed with normal laboratory diet. In order to avoid data changes caused by gender differences, the mice selected for the study were randomly assigned to different experimental groups at a ratio of male: female = 1:1.

[0056] The mouse tumor cell line B16-F10-EGFP and the mouse forestomach carcinoma cell line MFC-GFP were obtained from the Cell Bank of the Chinese Academy of Sciences and cultured according to their guidelines. Low-passage cells were cultured at 1 × 10 5 Cells / ml were resuspended in a 1:1 mixture of PBS and Matrigel (Corning #356231) for B16F10 and MFC cells.

[0057] The hair on the right abdomen of C57BL / 6J mice (B16F10) or 615 mice (MFC) was shaved in advance, and 100 μL of mouse tumor cell fluid B16-F10-EGFP was subcutaneously injected into the right back of C57BL / 6J mice to form a subcutaneous tumor and establish a melanoma mouse model; 100 μL of mouse forestomach cancer cell fluid MFC-GFP was subcutaneously injected into the right abdomen of 615 mice to form a subcutaneous tumor and establish a gastric cancer mouse model.

[0058] 2.WH-4-023 anti-tumor activity test

[0059] 2.1WH-4-023 Melanoma Inhibitory Activity Test

[0060] 2.1.1 Tumor volume measurement

[0061] The melanoma mouse model was divided into three groups, each with 4 mice, namely blank control group, positive control group and WH-4-023 group. From the 7th day after subcutaneous tumor formation, the drug was directly injected into the melanoma in situ tumor every other day.

[0062] The drug concentrations used in the three groups of melanoma mouse models are as follows:

[0063] a. Blank control group: injected with normal saline;

[0064] b. Positive control group: injected with Erdafitinib at 20 mg / kg body weight;

[0065] c. WH-4-023 group: injected with WH-4-023 at 1 mg / kg body weight.

[0066] On days 0, 2, 4, 6, 8, 10, and 12, the length of the tumor on the back of the mouse was measured with a vernier caliper, and the tumor volume was calculated. On day 12 of subcutaneous tumor formation, the mouse was killed by cervical dislocation, and the tumor tissue was carefully peeled off from the skin to measure the tumor volume.

[0067] like Figure 1 The figure shows the tumor volumes of the three groups of mice at 12 days after subcutaneous melanoma formation, with 4 parallel samples in each group. It can be seen that the tumor volume of the WH-4-023 group was significantly smaller than that of the blank control group, and the tumor volume of the WH-4-023 group was basically the same as that of the positive control group.

[0068] like Figure 2 The figure shows the changes in tumor volume of three groups of mice with subcutaneous melanoma from day 0 to day 12 (unit: mm 3 ). It can be seen that on days 0-6 of subcutaneous tumor formation, the tumor volumes of the three groups were basically the same due to the lack of drug injection; after drug injection on day 7, the differences in tumor volumes among the three groups gradually emerged, and the tumor volumes of the WH-4-023 group and the positive control group were significantly smaller than those of the blank control group.

[0069] comprehensive Figure 1 and Figure 2 , indicating that WH-4-023 has an inhibitory effect on melanoma, and its inhibitory effect is equivalent to that of the positive control group using erdafitinib.

[0070] 2.1.2 Multiple fluorescence staining experiment of melanoma tissue sections

[0071] Tumor tissues peeled from the skin of sacrificed mice were frozen in liquid nitrogen: the samples were further fixed in 4% PFA for 2 to 3 hours and then dehydrated in 30% sucrose overnight. The samples were then immersed in optimal cutting temperature compound (OCT, Tissue-Tek) at room temperature for 30 minutes, embedded and frozen in OCT at -80°C. For paraffin sectioning, the samples were fixed in 4% PFA for 24 hours, then dehydrated with different concentrations of ethanol (50% to 100%) and xylene gradient to make them transparent, and finally immersed and embedded in paraffin. 3μm sections were collected. The frozen sections were immersed in PBS to dissolve OCT, and the paraffin sections were immersed in xylene and gradient ethanol to dissolve paraffin. The subcutaneous melanoma sections of mice were treated with 0.2% Triton X-100 in PBS for 15 minutes and then blocked with 5% donkey serum at room temperature. The slides were then incubated with the primary antibody solution at 4°C overnight. After washing with PBS three times, secondary antibody was applied at 37°C for 1 hour, followed by washing with PBS three times. The cell nuclei were then stained with DAPI. All slides were mounted with anti-fluorescence mounting medium. Images were acquired with a Leica SP5 confocal microscope and analyzed with ImageJ software. The following antibodies were used: anti-α-smooth muscle actin (SMA) ab7817; anti-C-kit ab283653 (Abcam); anti-Cd34 ab81298 (Abcam); anti-Pi16, AF4929 (R&D system). The cell nuclei were counterstained with DAPI (4′, 6-diamidino-2-phenylindole). The stained tissue was mounted on a slide and images were taken with a Leica SP5 confocal microscope. The results are shown in Figure 2. Figure 5 shown.

[0072] like Figure 5 The figure shows the changes of CD34, Pi16, and a-SMA observed after multiple fluorescent staining of melanoma tissue sections 12 days after subcutaneous tumor formation; Figure 6 Shown are the statistical results of the positive cell ratios in Figure 5, wherein the expression levels of CD34 and Pi16 represent the levels of precursor cells CD34+Pi16+fibroblasts.

[0073] Combination Figure 5 and Figure 6 It can be seen that the expression levels of CD34 and Pil6 in the WH-4-023 group were significantly higher than those of CD34 and Pi16 in the positive control group, indicating that WH-4-023 promoted the generation of CAF precursor CD34+Pi16+fibroblasts; at the same time, the expression levels of Col1a1 and a-SMA in the WH-4-023 group were significantly lower than those in the blank control, indicating that WH-4-023 inhibited the generation of myCAF.

[0074] 2.2WH-4-023 Gastric Cancer Inhibition Activity Test

[0075] 2.2.1 Tumor volume measurement

[0076] The gastric cancer mouse model was divided into three groups, 5 mice in each group, namely blank control group, positive control group and WH-4-023 group. For the gastric cancer mouse model, on the 7th day after subcutaneous tumor formation, the drug was injected intraperitoneally every other day.

[0077] The drugs and concentrations used in the three groups of gastric cancer mouse models are as follows:

[0078] a. Blank control group: injected with normal saline;

[0079] b. Positive control group: injected with 20 mg / kg erdafitinib;

[0080] c. WH-4-023 group: injected with 1 mg / kg WH-4-023.

[0081] like Figure 3 The figure shows the volume of gastric cancer tumors in three groups of mice at 20 days after subcutaneous rumen cancer was formed. Each group had 5 parallel samples. It can be seen that the tumor volume of the WH-4-023 group and the positive control group was smaller than that of the blank control group, and the tumor volume of the WH-4-023 group was significantly smaller than that of the positive control group.

[0082] like Figure 4 The figure shows the changes in tumor volume of the three groups of mice from day 0 to day 20 of subcutaneous gastric cancer tumor formation. It can be seen that from day 0 to day 7 of subcutaneous tumor formation, the tumor volumes of the three groups were basically the same due to the lack of drug injection; after drug injection from day 7, the differences in tumor volume among the three groups gradually emerged, and the gastric cancer tumor volume of the WH-4-023 group was significantly smaller than that of the blank control group, and also significantly smaller than that of the positive control group.

[0083] comprehensive Figure 3 and Figure 4 This indicates that WH-4-023 has an inhibitory effect on gastric cancer tumors, and its inhibitory effect is significantly better than that of the positive control group erdafitinib.

[0084] Example 2 Verification of the anti-tumor activity of WH-4-023 by cell experiment

[0085] 1. Sample Collection

[0086] Ten patients with pathological diagnosis of gastric cancer were included in this study. None of the patients had received chemotherapy, radiotherapy, or any other anti-tumor drugs before tumor resection. Paired freshly resected tumors and adjacent normal tissues were obtained immediately after surgical resection. The adjacent normal tissues were at least 5 cm away from the tumor tissue.

[0087] 2. Isolation, Culture and Grouping of Primary Fibroblasts

[0088] Prepare differentiation medium, which consists of the following components: DMEM + 2% chicken embryo extract, 1% FBS (10099141, Thermo Fisher Scientific, Waltham, MA, USA), 1% N2, 2% B27, 100 nM retinoic acid, 50 nM 2-mercaptoethanol (2-ME:M6250, Sigma Aldrich, St. Louis, MO, USA), 1% P / S and 20 ng / ml bFGF.

[0089] Prepare S / P stem cell culture medium, which consists of the following components: DMEM + 2% chicken embryo extract, 1% FBS, 1% N2, 2% B27, 100 nM retinoic acid, 50 nM 2-mercaptoethanol, 1% P / S, 20 ng / ml bFGF and 0.01% leukemia inhibitory factor (10 ng / ml) (LIF:ESG1107, EMD Millipore, Burlington, MA, USA).

[0090] Fresh gastric cancer tissue was cut into pieces and washed with phosphate-buffered saline (PBS; Gibco TM , USA). Single cell suspensions were the same as previously described. Isolated cells were pelleted by centrifugation at 1200 rpm for 5 min and resuspended in PBS. These cells were purified using the Cd34 microbead kit (Miltenyi Biotec, Bergisch Gladbach, Germany) and cultured in S / P cell culture medium. For differentiation assays, Cd34 were cultured in a medium obtained by mixing differentiation medium and S / P medium in a 3:1 volume ratio. + Fibroblasts.

[0091] The tumor culture medium is the culture supernatant of the gastric cancer cell line BGC: high glucose medium (DMEM) + 10% fetal bovine serum (FBS) + 1% P / S. After culturing for 2 days, the supernatant was collected and centrifuged at 1000g for 5 minutes. The supernatant was collected and used as the tumor culture medium.

[0092] Cd34 + The fibroblasts were divided into 5 groups. The drugs were directly added to the differentiation medium. The medium was changed every other day. The grouping and drug concentration added to each group are as follows:

[0093] a. Blank control group: add normal saline;

[0094] b. Tumor culture medium group: no drug added;

[0095] c. Positive control group: tumor culture medium supplemented with 0.01 μM erdafitinib;

[0096] d. 0.5 μM WH-4-023 group: 0.5 μM WH-4-023 was added to the tumor culture medium;

[0097] e. 0.05 μM WH-4-023 group; 0.05 μM WH-4-023 was added to the tumor culture medium.

[0098] All cells were cultured at 37°C with 5% CO 2 Primary fibroblasts were used before passage 5.

[0099] 4. PCR Experiment

[0100] Total RNA was extracted using the RNeasy Mini kit (QIAGEN). The concentration and quality of total RNA were assessed using a Nanodrop spectrophotometer (ThermoFisher Scientific). cDNA synthesis was performed using Prime-Script RT master mix (TaKaRa). Primers were obtained from Sangon Biotech (Shanghai) Co., Ltd. qRT-PCR analysis was performed in triplicate using SYBR PremixEx Taq (TaKaRa) on a 7900HT real-time PCR system (Applied Biosystems). Primers were as follows:

[0101] Gene name Upstream primer Downstream primer Cd34 CCTACCAATGAGTCTGTTGAGG GAAGTAGTAGGCAGTATGCCAG Pi16 CCAGTGCCCTCTTGGCTAC ACCTCGGTCACCCTTGGA α-SMA ATAGGCACGTTGTGAGTCACACCA CGACACTGCTGACAGAGGCACCA SPARC GTCCCACACTGAGCTGGC AAGCACAGAGTCTGGGTGAGTG Col1a1 ACATGTTCAGCTTTGTGGACC TAGGCCATTGTGTATGCAGC GAPDH CCAGCCTCGTCCCGTAGACA CTGGTCCTCAGTGTAGCCCAAGATG

[0102] like Figure 7 The results show that tumor CD34+ fibroblasts were isolated and cultured in vitro for differentiation. After 7 days of culture, cells were collected and RNA was extracted, and the transcription levels of CD34, Pil6, a-SMA, etc. were statistically analyzed. It can be seen that after 7 days of differentiation, the relative RNA expression levels of CD34 and Pil6 in the positive control group were significantly increased compared with the blank tumor culture medium group; 0.5μM WH-4-023 can significantly increase the relative RNA expression levels of CD34 and Pil6; when the concentration of WH-4-023 was reduced to 0.05μM, the relative RNA expression levels of CD34 and Pil6 were still significantly increased compared with the blank tumor culture medium group, indicating that WH-4-023 promoted the maintenance of the stemness of CAF precursor CD34+Pi16+ fibroblasts from a genetic level.

[0103] At the same time, the relative RNA expression levels of a-SMA in the WH-4-0230.5μM group and the WH-4-0230.05μM group were significantly decreased compared with the blank tumor culture medium group, and the relative RNA expression level of Col1a1 was equivalent to that of the blank tumor culture medium group, indicating that WH-4-023 inhibited the generation of myCAF.

[0104] 5. Immunofluorescence Staining

[0105] Patient gastric cancer tissues were treated with 0.2% Triton X-100 in PBS for 15 minutes and then blocked with 5% donkey serum at room temperature. The slides were then incubated with the primary antibody solution at 4°C overnight. After 3 washes with PBS, the secondary antibody was applied at 37°C for 1 hour, followed by 3 washes with PBS. The nuclei were then stained with DAPI. All slides were mounted with anti-fluorescence mounting medium. Images were collected with a Leica SP5 confocal microscope and analyzed with ImageJ software. The following antibodies were used: anti-type I collagen, ab138492 (Abcam); anti-α-smooth muscle actin ab7817; anti-C-kit ab283653 (Abcam); anti-Cd34 ab81298 (Abcam); anti-Pi6, AF4929 (R&D system). The nuclei were counterstained with DAPI (4′, 6-diamidino-2-phenylindole). The stained tissue was mounted on a slide and images were taken using a Leica SP5 confocal microscope. Figure 8 shown.

[0106] like Figure 8 Shown is the multiple immunofluorescence staining of differentiated cells to observe the expression of CD34, Pil6, and a-SMA; Fig. 9 To calculate the statistical results of the number of positive cells expressing CD34, Pil6, and a-SMA in each field of view of multiple immunofluorescence staining. It can be seen that the expression levels of CD34 and Pil6 in the WH-4-023 group were higher than or equivalent to the expression levels of CD34 and Pi16 in the positive control group, which showed that WH-4-023 promoted the maintenance of the stemness of CAF precursor CD34+Pi16+ fibroblasts at the cellular level; at the same time, the expression level of a-SMA in the WH-4-023 group was significantly lower than that in the blank control group, which showed that WH-4-023 inhibited the generation of myCAF at the cellular level.

[0107] In summary, through animal experiments and cell experiments, it was proved that WH-4-023 can promote the growth and stemness maintenance of CAF precursor CD34+Pi16+ fibroblasts, inhibit their transformation into CAFs, and then inhibit the increase in the volume of solid tumors with CAFs as the main body, playing a positive role in the prevention and treatment of solid tumors.

[0108] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of WH-4-023 in the preparation of drugs for inhibiting CAF formation.

2. According to the use of claim 1, the CAF is myCAF.

3. The use according to claim 1, characterized in that: The inhibiting of CAF formation includes inhibiting the formation of melanoma CAF and / or gastric cancer CAF.

4. Application of WH-4-023 in the preparation of drugs for inhibiting the differentiation of CD34+Pi16+ fibroblasts into CAFs.

5. Use of WH-4-023 in the preparation of drugs for preventing or treating solid tumors.

6. The use according to claim 5, characterized in that: The solid tumor is melanoma or gastric cancer.

7. The use according to any one of claims 1 to 6, characterized in that: The WH-4-023 is an injection or an oral preparation.

8. The use according to any one of claims 1 to 6, characterized in that: The dosage of WH-4-023 is 0.1-2.0 mg / kg body weight.

9. The use according to claim 8, characterized in that: The dosage of WH-4-023 is 0.5-1.0 mg / kg body weight.

10. Use of a pharmaceutical composition in the preparation of a drug for preventing or treating solid tumors, characterized in that: The pharmaceutical composition comprises WH-4-023, or a pharmaceutically acceptable salt thereof, or a solvate thereof.

Images