Application of miR-143-3p and mimics thereof in preparation of medicine for preventing or treating pulmonary fibrosis

Abstract

The invention belongs to the technical field of biological medicines, and relates to miR-143-3p and application of miR-143-3p simulants in preparation of medicines for preventing or treating pulmonary fibrosis. In the application, the research finds that the miR-143-3p can obviously inhibit the activation of lung fibroblasts and effectively relieve the occurrence of lung inflammation and pulmonary fibrosis diseases, and a new reference is provided for the treatment of the pulmonary fibrosis diseases.

Description

Technical Field

[0001] The present invention relates to the fields of biomedicine and molecular biology, and in particular to an application of miR-143-3p in the preparation of drugs related to the prevention or treatment of pulmonary fibrosis. Background Art

[0002] At present, the clinical treatment options for pulmonary fibrosis mainly include drug therapy, physical training and lung transplantation. Among them, pirfenidone and nintedanib are currently recognized as two clinical drugs for the treatment of pulmonary fibrosis. Although these two drugs have the effect of slowing down the progression of the disease to a certain extent, the effects of these two drugs are limited to delaying the development of the disease and cannot achieve a cure, and both have certain side effects. Lung transplantation is the only hope for patients with advanced pulmonary fibrosis. However, due to the lack of organs and the complexity of surgery, the application of lung transplantation in the treatment of pulmonary fibrosis is greatly limited. Therefore, finding a drug that can effectively prevent and treat pulmonary fibrosis is a problem that needs to be solved at present. Summary of the invention

[0003] 1. This study found that miR-143-3p can inhibit the activation of lung fibroblasts, reduce collagen deposition and inflammatory response in pulmonary fibrosis tissue, and effectively prevent and treat the occurrence of pulmonary fibrosis.

[0004] 2. In order to achieve the above-mentioned purpose of the invention, the present invention provides an application of miR-143-3p in the preparation of a drug for preventing or treating pulmonary fibrosis.

[0005] 3. Preferably, the sequence of miR-143-3p is shown in SEQ ID NO: 1, which is 5'-

[0006] UGAGAUGAAGCACUGUAGCUC-3'

[0007] 4. Preferably, miR-143-3p can inhibit the activation of lung fibroblasts and reduce collagen deposition and inflammatory response in fibrotic lung tissue.

[0008] 5. The technical solution provided by the present invention includes: use of a reagent that promotes miR-143-3p expression or enhances miR-143-3p function in the preparation of a drug for preventing or treating pulmonary fibrosis,

[0009] 6. Preferably, the active pharmaceutical ingredient in the application includes AgomiR-143-3p, a chemically modified form of miR-143-3p, a mimic of miR-143-3p, or a carrier carrying miR-143-3p.

[0010] 7. Preferably, the use of miR-143-3p in the preparation of a product for promoting the regeneration of damaged alveolar stem cells is characterized in that the carrier for delivering miR-143-3p and / or miR-143-3p mimics includes one or more of exosomes, liposomes, nanozymes, polymer nanoparticles, etc.

[0011] 8. Preferably, the use of miR-143-3p in the preparation of a product for preventing or treating pulmonary fibrosis is characterized in that the product dosage form is a sustained-release preparation, injection, drip or spray, etc.

[0012] 9. The present invention can achieve the following technical effects: miR-143-3p significantly inhibits the activation of lung fibroblasts, inhibits inflammatory response and collagen deposition in fibrotic lung tissue; therefore, miR-143-3p can be used to prepare drugs for preventing or treating pulmonary fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The effect of different concentrations of TGF-β1 on protein expression in lung fibroblasts in the examples;

[0014] Figure 2 The expression of miR-143-3p in lung fibroblasts after transfection of miR-143-3p;

[0015] Figure 3 The effect of miR-143-3p on protein expression in lung fibroblasts activated by TGF-β1 in the examples;

[0016] Figure 4 The effect of AgomiR-143-3p on the pathology and collagen deposition of pulmonary fibrosis mice in the example. DETAILED DESCRIPTION

[0017] In order to more clearly illustrate the specific scheme for implementing the patent of the present invention, the present invention will be fully described below in conjunction with specific embodiments.

[0018] In the following examples, the sequence of miR-143-3p used is shown in SEQ ID NO: 1, which is: 5'-UGAGAUGAAGCACUGUAGCUC-3'. The sequence of the miR-143-3p mimic used is shown in SEQ ID NO: 2, Sense 5'-UGAGAUGAAGCACUGUAGCUC-3'; Anti-Sense 5'-GCUACAGUGCUUCAUCUCAUU-3'.

[0019] Example 1: Effects of different concentrations of TGF-β1 on the activation of lung fibroblasts

[0020] Current research suggests that most myofibroblasts in fibrotic lung tissues are mainly derived from the activation of endogenous lung fibroblasts. The main causes of lung fibroblast activation include: local increase in transforming growth factor-β (TGF-β), modification and changes in matrix proteins, and increase in local mechanical stress. TGF-β is considered to be the main factor in activating lung fibroblasts. 5 MRC-5 (human embryonic lung fibroblasts) were inoculated in a 6-well plate. When the cell confluence reached 70%, TGF-β1 with a final concentration of 2.5, 5, and 10 ng / mL was added to treat the cells. After treating the cells with different concentrations of TGF-β1 for different times (0, 12, 24, 36, and 48 h), the cells were washed twice with cold PBS, and then 500 μL of RIPA lysis buffer was added to each well. The cells were lysed on ice for 30 min, and then the proteins were scraped with a cell scraper and centrifuged at 12,000g for 20 min. The supernatant was collected to collect the proteins, and the protein concentration was quantified as 1 μg / μL. 10 μg of protein was taken for SDS-PAGE electrophoresis, semi-dry transfer was performed at 10 V for 2 h, and antibodies such as Fibronectin-1 and Collagen-1 were used to detect the expression of fibrosis-related proteins in the cells. The results are as follows Figure 1 As shown, after lung fibroblasts were treated with different concentrations of TGF-β1, the expression of Fibronectin and Collagen I proteins gradually increased with the extension of treatment time; among them, after 5ng / mL TGF-β1 was used to treat cells for 36h, Fibronectin and Collagen I proteins in the cells began to increase significantly. This shows that after 5ng / mL TGF-β1 was used to treat lung fibroblasts for 36h, they have been significantly transformed into myofibroblasts that secrete collagen. Therefore, in the following study of this application, 5ng / mL TGF-β1 will be used to treat lung fibroblasts for 36 hours, and then the inhibitory effect of miR-143-3p on myofibroblasts will be analyzed in vitro.

[0021] Example 2: Expression of miR-143-3p in lung fibroblasts after transfection of miR-143-3p-mimic

[0022] In this application, we will use qRT-PCR to detect the expression of miR-143-3p in lung fibroblasts. The detection process is as follows:

[0023] ① Extraction of total RNA: MRC-5 cells were inoculated in 6-well plates. When the cell confluence reached 50%, the culture medium was replaced with complete culture medium containing 5 ng / mL. After 36 hours, fresh culture medium was replaced. RNAiMAX transfection reagent was used to transfect 30nM mimic-NC or miR-143-3p-mimic per well and culture was continued for 48h. 1mL Trizol Regent was added, mixed thoroughly, and placed on ice for 5min. The lysate was transferred to a 1.5mL centrifuge tube; 200μL chloroform was added, and the mixture was shaken vigorously for 15s and placed on ice for 5min; centrifuged at 12,000g for 15min, and the supernatant was transferred to a new 1.5mL centrifuge tube; an equal volume of isopropanol was added, and the mixture was mixed by inversion until there was no floccules, and placed on ice for 15min; centrifuged at 12,000g for 10min, and the supernatant was discarded; 1mL 75% ethanol was added to wash the RNA precipitate; centrifuged at 7,000g for 7min, and the supernatant was discarded; the mixture was dried and 100μL DEPC water was added, and stored at -80℃ for later use.

[0024] ② Synthesize the first-strand cDNA of miRNA by tailing method (tailing and reverse transcription are completed in one step): miRNA 1 st Strand cDNA Synthesis Kit (by tailing A) Catalog No. MR201, perform A-tailed reverse transcription on the total RNA extracted in step ①. For detailed operations, please refer to the official instructions of Vazyme (https: / / www.vazyme.com / product / 621.html).

[0025] (1) Prepare the following buffer in an RNase-free centrifuge tube:

[0026]

[0027] (The total RNA used in the reaction must contain miRNA)

[0028] Mix by gently pipetting, centrifuge briefly, and incubate at 37°C for 60 min and 85°C for 5 min to obtain the first-strand cDNA of miRNA.

[0029] ③qRT-PCR detection of miR-451a expression level in cells

[0030]

[0031] The temperature was adjusted to 95°C for 10 s and 60°C for 30 s for 40 cycles. U6 was selected as the internal control of miRNA.

[0032] ④Primer information used in qPCR:

[0033] miR-143-3p-F TGAGATGAAGCACTGTAGCTC miR-143-3p-R GCTACAGTGCTTCATCTCATT U6-F CGCTTCGGCAGCACATATAC U6-R TTCACGAATTTGCGTGTCAT

[0034] Example 3: miR-143-3p mimics inhibit activation of lung fibroblasts

[0035] In this application, we first studied the effect of miR-143-3p on the activation of lung fibroblasts in vitro. 0.5×10 5 MRC-5 cells were cultured and when the cell confluence reached about 70%, 2.5 ng / mL TGF-β1 was added to stimulate the cells for 24 h to activate lung fibroblasts; then, the cells were treated with miR-143-3p-mimic or mimic-NC and the cells were collected after 48 h. Western Blot was used to detect the expression of proteins such as Fibronectin-1, Collagen-1, and N-cad. Figure 2 The results showed that miR-143-3p-mimic could significantly inhibit the expression of collagen and myofibroblasts in activated lung fibroblasts compared with the mimic-NC group.

[0036] Example 4: AgomiR-143-3p reduces inflammatory response and collagen deposition in pulmonary fibrosis tissue

[0037] Eight-week-old male C57BL / 6J mice were randomly divided into four groups: control group, BLM group, BLM+AgomiR-NC, and BLM+AgomiR-143-3p group. In this application, we used a Micro-Sprayer nebulizer to aerosolize 50 μL of BLM (1.5 U / kg) or normal saline into the lung tissue of C57BL / 6 mice. After one week of BLM treatment of mice, the mice in the BLM+AgomiR-NC and BLM+AgomiR-143-3p groups were given 5 mg / kg (100 μL) of Agomir-NC or Agomir-143-3p through tail vein injection; two weeks later, hematoxylin-eosin staining (H&E staining) was used to detect pathological changes in the lung tissue of mice. Results Figure 3 As shown, the lung tissue of mice in the BLM treatment group showed severe alveolar collapse, inflammatory cell infiltration and interstitial thickening, with obvious interstitial thickening and collagen fiber deposition; at the same time, the hydroxyproline content and inflammatory factors in the lung tissue of mice increased significantly. However, Agomir-143-3p can significantly reduce collagen deposition and fibrosis area in damaged lung tissue, reduce inflammatory response in pulmonary fibrosis tissue, and restore normal lung tissue structure.

[0038] The above-described embodiments only illustrate several implementation methods of the present invention, so as to facilitate a more detailed and specific understanding of the technical solution of the present invention. They are only preferred embodiments of the present invention, and cannot be interpreted as limiting the scope of protection of the invention patent. It should be pointed out that those skilled in the art can understand that all or part of the above-mentioned implementation processes and equivalent improvements made in accordance with the claims of the present invention are within the scope of the invention.

Claims

1. An application of miR-143-3p in the preparation of a drug for preventing or treating pulmonary fibrosis.

2. The use of miR-143-3p according to claim 1 in preparing a drug for preventing or treating pulmonary fibrosis, characterized in that: The miR-143-3p is derived from umbilical cord mesenchymal stem cell exosomes.

3. The use of miR-143-3p according to claim 1 in preparing a drug for preventing or treating pulmonary fibrosis, characterized in that: The sequence of miR-143-3p is shown in SEQ ID NO: 1, which is 5'-UGAGAUGAAGCACUGUAGCUC-3'.

4. The use of miR-143-3p in the preparation of a drug for preventing or treating pulmonary fibrosis according to claim 2, characterized in that: The sequence of miR-143-3p is shown in SEQ ID NO: 1, which is 5'-UGAGAUGAAGCACUGUAGCUC-3'.

5. Use of miR-143-3p according to any one of claims 1 to 4 in the preparation of a drug for preventing or treating pulmonary fibrosis, characterized in that: The delivery vector of miR-143-3p includes one or more of exosomes, liposomes, nanozymes, polymer nanoparticles, etc.

6. Use of a miR-143-3p mimic in the preparation of a drug for preventing or treating pulmonary fibrosis.

7. Use of a miR-143-3p mimetic according to claim 6 in the preparation of a drug for preventing or treating pulmonary fibrosis, characterized in that: The miR-143-3p is derived from umbilical cord mesenchymal stem cell exosomes.

8. Use of a miR-143-3p mimetic according to claim 6 in the preparation of a drug for preventing or treating pulmonary fibrosis, characterized in that: The sequence of the miR-143-3p mimetic is shown in SEQ ID NO: 2, Sense 5'-UGAGAUGAAGCACUGUAGCUC-3'; Anti-Sense 5'-GCUACAGUGCUUCAUCUCAUU-3'.

9. Use of a miR-143-3p mimetic according to claim 7 in the preparation of a drug for preventing or treating pulmonary fibrosis, characterized in that: The sequence of the miR-143-3p mimetic is shown in SEQ ID NO: 2, which is Sense 5'-UGAGAUGAAGCACUGUAGCUC-3'; Anti-Sense 5'-GCUACAGUGCUUCAUCUCAUU-3'.

10. Use of a miR-143-3p mimetic according to any one of claims 6 to 9 in the preparation of a drug for preventing or treating pulmonary fibrosis, characterized in that: The delivery carrier of the miR-143-3p mimetic includes one or more of exosomes, liposomes, nanozymes, polymer nanoparticles, etc.

Images