Use of a T1FR protein to inhibit type I fimbriae of klebsiella pneumoniae and salmonella enteritidis

Abstract

The application discloses application of T1FR protein in inhibition of Klebsiella pneumoniae and Salmonella enteritidis type I fimbriae, and relates to the field of biotechnology. T1fr The biological factor T1FR protein encoded by the gene can inhibit Klebsiella pneumoniae and Salmonella enteritidis type I fimbriae adhesion factors, and can effectively reduce the use of antibiotics and relieve the drug resistance of Klebsiella pneumoniae and Salmonella by inhibiting pathogenic bacteria adsorption and colonization in human and animal tissues, thereby providing a theoretical basis and an important reference scheme for controlling bacterial infection and biofilm formation.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of a T1FR protein in inhibiting type I fimbriae of Klebsiella pneumoniae and Salmonella enteritidis. Background Technology

[0002] Klebsiella pneumoniae is an opportunistic pathogen affecting the intestinal and respiratory tracts of humans and animals. In recent years, drug-resistant Klebsiella pneumoniae has become one of the main pathogens causing hospital-acquired infections. Pili play an important role in the pathogenesis of Klebsiella pneumoniae, and there are mainly type I and type III pili. Type I pili are protein protrusions on the surface of the bacteria; pili proteins consist of a group of... fim ( A, B, C, D, E, F, G, H, K The gene group encodes FimA, which constitutes the most important structural subunit of the pili. The pili adhesin protein FimH is linked to the pili rod composed of FimA through two minor structural subunits, FimF and FimG. Human and mammalian epithelial tissues contain mannose-containing glycoproteins. FimH adhesin targets and adheres to mannose-containing glycoproteins, ultimately colonizing the host epithelium and causing infection. Similar to the expression regulation mechanism of Escherichia coli type I, Klebsiella pneumoniae type I pili also connect through the gene group located at FimA. fimA A phase transition switch upstream of the gene fimS "Control by changing direction," fimS This is a 314 bp DNA sequence. When this "switch" is in the "on" state, the promoter will begin transcription and expression to form pili. Type III pili of *Klebsiella pneumoniae* are important structures affecting the formation of biofilms by *Klebsiella pneumoniae* implanted in medical materials. The genes encoding type III pili are mainly... mrk ( E, A, B, C, D, F )in mrkA The gene encodes the main structural subunit of the fimbriae, which accounts for more than 90% of the fimbriae protein composition.

[0003] Salmonella is a zoonotic pathogen of global concern with a very broad host spectrum, causing intestinal or systemic diseases in humans and animals. Salmonella type I pili are involved in mediating bacterial adhesion to various cells and are crucial for Salmonella colonization and invasion of hosts. Through adhesin secreted by the FimH at the tips of the type I pili, they recognize mannose-containing glycoproteins on eukaryotic cell membranes, adhering to human and mammalian epithelial tissues and leading to infection. Salmonella type I pili are composed of… fim (A, I, C, D, H, F) The gene cluster encodes an operon domain under the control of the fimA promoter. FimZ, FimY, and FimW regulate the transcription and expression of type I fimbriae structural genes. FimZ is the main activator of Salmonella type I fimbriae expression and can directly bind to... fimA Promoter subregion, FimY promotes fimZ FimW can suppress the expression of [something].fimZ expressing.

[0004] Klebsiella pneumoniae and Salmonella type I fimbriae cause bacterial infection in humans and animals, and promote the adhesion of bacteria to biological or non-biological surfaces, leading to the formation of biofilm, and the significant increase of bacterial drug resistance. The use of antibiotics leads to the increasingly serious problem of bacterial drug resistance, although methods such as metal nanomaterials have been developed, which have a certain effect on the formed biofilm, but how to prevent bacterial infection and biofilm formation, and adopt biological factors to block the adhesion of bacterial type I fimbriae is an effective method. In the present application, it is found that T1FR protein can inhibit the formation of Klebsiella pneumoniae and Salmonella type I fimbriae, which provides an important reference scheme for preventing bacterial infection and biofilm formation. SUMMARY

[0005] The purpose of the present application is to provide a biological factor T1FR protein for inhibiting Klebsiella pneumoniae and Salmonella enterica type I fimbriae, which can prevent the colonization of bacteria in tissues and prevent the formation of bacterial biofilm, and provides a new way and reference scheme for controlling bacterial infection and biofilm formation.

[0006] In order to achieve the above purpose, the present application provides a T1FR protein for inhibiting pathogenic bacteria type I fimbriae, wherein the amino acid sequence of the T1FR protein is shown in SEQ ID NO. 10.

[0007] Further, the pathogenic bacteria is Klebsiella pneumoniae and Salmonella enterica, and the T1FR protein can inhibit the formation of Klebsiella pneumoniae and Salmonella enterica biofilm.

[0008] The T1FR protein provided by the present application can be used in the prevention and treatment of Klebsiella pneumoniae and Salmonella enterica infection, and the amino acid sequence of the T1FR protein is shown in SEQ ID NO. 10.

[0009] The present application also provides a method for inhibiting Klebsiella pneumoniae and Salmonella enterica type I fimbriae by T1FR protein, which specifically constructs a recombinant plasmid containing a nucleotide sequence shown in SEQ ID NO. 9, and transfers the constructed recombinant plasmid into Klebsiella pneumoniae and Salmonella enterica for exogenous expression.

[0010] Further, the recombinant plasmid is preferably pUC19.

[0011] The present application has the following advantages:

[0012] The application discloses a biological factor T1FR protein for the first time, which can inhibit Klebsiella pneumoniae and Salmonella enteritidis type I fimbriae adhesion factors, effectively reduces the adsorption and colonization of pathogenic bacteria in human and animal tissues, effectively reduces the use of antibiotics, significantly alleviates the drug resistance of Klebsiella pneumoniae and Salmonella caused by the use of antibiotics, and provides a new way for controlling bacterial infection and biofilm formation. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 A schematic diagram of TIFR protein inhibiting Klebsiella pneumoniae and Salmonella enteritidis type I fimbriae.

[0014] Figure 2 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. mrkA Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0015] Figure 3 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. mrkA Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. fimA Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0016] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 4 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1fr Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1fr Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0017] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 5 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1fr Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. mrkA Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0018] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 6 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1fr Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. fimA Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0019] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 7 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. fimS Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. fimS Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0020] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 8 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0021] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 9 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1fr Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application.

[0022] Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. Figure 10 Verification results of upstream and downstream of a knocked-out gene in the ATCC13883 strain in the application. T1frGenes of Salmonella enteritidis fimA Gene expression detection results.

[0023] Figure 11 Transmission electron microscope observation results of T1FR protein on the inhibition of Salmonella enteritidis type I fimbriae in the present application. fimA Promoter and E. coli type I fimbriae phase variation switch fimS Sequence alignment results of T1FR protein binding region in

[0024] Figure 12 Transmission electron microscope observation results of T1FR protein on the inhibition of Salmonella enteritidis type I fimbriae in the present application. DETAILED DESCRIPTION

[0025] The technical solutions in the embodiments of the present application will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of the present application.

[0026] It is specified that, in the following examples, the experimental methods are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0027] Example 1

[0028] 1. Knock out the gene of Klebsiella pneumoniae (ATCC13883) by Red homologous recombination technology mrkA Gene.

[0029] Design homologous recombination primers, the specific sequences are as follows, and the amplification product is obtained by gel recovery and purification to obtain a chloramphenicol resistance gene containing homologous arms.

[0030] Homologous recombination primer sequence:

[0031] F (SEQ ID NO. 1):

[0032] ATTCACAGTGTGCTCATTGATTCGTAATTCACTCTGACAAGGAAATGGCAGGCATATGAATATCCTCCTTAG;

[0033] R (SEQ ID NO. 2):

[0034] TTATTGTTATTAACTGCCCCATCGCGGGGCAGTTTTATTTTCTGACGGAATGTGTAGGCTGGAGCTGCTTCG.

[0035] The pKD46-Tet plasmid and purified DNA product were simultaneously electroporated into ATCC13883 bacteria. Screening was performed using LB solid medium containing 16 μg / mL chloramphenicol, and single clones were picked and amplified in LB liquid medium containing 16 μg / mL chloramphenicol. Successfully knocked-out strains were validated by PCR. The upstream validation primers were mrkA-ko(check)-F1 (SEQ ID NO. 3): ATACAAGCGGCGGACA, mrkA-ko(check)-R1 (SEQ ID NO. 4): TGGCGATTCAGGTTCAT; the downstream validation primers were mrkA-ko(check)-F2 (SEQ ID NO. 5): CAACAGGGACACCAGGAT, mrkA-ko(check)-R2 (SEQ ID NO. 6): CTTTGACGCCGATAGCA. The results of both upstream and downstream validations are shown below. Figure 2 As shown. The verified strain was inoculated into liquid culture medium and cultured with shaking at 42°C to eliminate the pKD46-Tet plasmid, and named ATCC13883△. mrkA .

[0036] 2. ATCC13883 strain and ATCC13883△ mrkA strain fimA Detection of gene expression

[0037] fimA The gene encodes FimA, a fimbriae protein of Klebsiella pneumoniae. FimA is the main structural protein of Type 1 fimbriae, which helps the bacteria attach to host cells and cause bacterial infection.

[0038] PCR detection was performed on strain ATCC13883 and ATCC13883Δ. mrkA strain fimA Gene expression detection primers are fimA- F (SEQ ID NO.7): GGCGTATGGTTTCGCTGTG; fimA- R (SEQ ID NO.8): TGCGTCCGTTTTGTCCG). Quantitative results are as follows: Figure 3 As shown, the results indicate that ATCC13883△ mrkA Compared to ATCC13883 strain fimA Gene expression increased significantly.

[0039] 6. Construction T1fr Gene expression vector pUC19+T1fr

[0040] Construct a carrier using homologous recombination method T1fr pUC19 plasmid of the gene, T1fr The nucleotide sequence of the gene is shown in SEQ ID NO. 9, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO. 10. The cloned plasmid obtained after successful sequencing verification is designated pUC19+. T1fr The structural diagram of the cloned plasmid is shown below. Figure 4 As shown.

[0041] 7. T1fr Gene in ATCC13883△ mrkA strain exogenous expression

[0042] ATCC13883△ mrkA The strain was cultured at 37°C with shaking until the logarithmic growth phase. The empty pUC19 plasmid and the pUC19+ plasmid were then separately cultured. T1fr The plasmid was electroconverted to ATCC13883△ mrkA The strain was named ATCC13883△ mrkA / pUC19 strain and ATCC13883△ mrkA / pUC19+ T1fr The strain was verified by PCR in ATCC13883△ mrkA The transformation results in the strain are as follows: Figure 5 As shown. The primers used contain:

[0043] pUC19-F (SEQ ID NO. 11): GGCAACTATGGATGAACG

[0044] pUC19-R (SEQ ID NO. 12): GCAAGCAGCAGATTACGC;

[0045] T1fr -F (SEQ ID NO.13): TGTCCGCAGCAACCTTAC

[0046] T1fr -R (SEQ ID NO. 14): ATTTGTTTCCTGGTCACTCA.

[0047] 5. Exogenous expression T1fr After gene generation, Klebsiella pneumoniae fimA Detection of gene expression

[0048] PCR was used to detect strains ATCC13883△mrkA, ATCC13883△mrkA / pUC19, and ATCC13883△mrkA / pUC19+. T1fr In strains fimA Gene expression was detected using primers as described in SEQ ID NO. 7-8 above (2). Quantitative results are as follows: Figure 6 As shown, the results indicate exogenous expression T1fr ATCC13883△ of the gene mrkA / pUC19+ T1fr strain, its fimA Gene expression was significantly reduced.

[0049] 6. Comparative analysis of the phase change switch of Klebsiella pneumoniae type I fimbriae. fimS "and E. coli" fimS "Sequence of the T1FR protein binding region in *E. coli*. T1FR and *E. coli*" fimS The binding of "TAAATAAAGATAACAA" to the substance inhibits the formation of type I fimbriae. The comparison results are as follows: Figure 7 As shown, the phase change switch of Klebsiella pneumoniae type I fimbriae can be seen. fimS "TAAAAATAGATATA in E. coli" fimS The T1FR protein binding region is highly homologous to the T1FR protein.

[0050] 7. Inhibition results of T1FR protein on type I fimbriae of Klebsiella pneumoniae

[0051] ATCC13883△ mrkA Strain, ATCC13883△ mrkA / pUC19 strain and ATCC13883△ mrkA / pUC19+ T1fr The bacterial strains were inoculated into LB solid medium and cultured overnight at 37°C. Single colonies were then picked, stained with 2% phosphotungstic acid for 3-10 seconds, air-dried at room temperature, and then observed using a JEM-1400FLASH transmission electron microscope to examine the bacterial fimbriae. Results are as follows: Figure 8 As shown, exogenous expression T1fr ATCC13883△ after gene mrkA / pUC19+ T1fr Type I fimbriae of the strain were significantly inhibited.

[0052] 8. T1fr Gene exogenous expression in Salmonella enteritidis (ATCC13076)

[0053] The ATCC13076 strain was cultured at 37°C with shaking until the logarithmic growth phase, and pUC19 and pUC19+ were then introduced separately. T1frThe plasmid was electroporated into strain ATCC13076 and named strains ATCC13076 / pUC19 and ATCC13076 / pUC19+. T1fr The transformation results of the plasmid in strain ATCC13076 were verified by PCR. The detection primers are as described in SEQ ID NO.11~14 above (4). The detection results are as follows. Figure 9 As shown.

[0054] 9. Exogenous expression T1fr After gene generation, Salmonella enteritidis fimA Detection of gene expression

[0055] PCR was used to detect strains ATCC13076, ATCC13076 / pUC19, and ATCC13076 / pUC19+. T1fr strain fimA Gene expression detection primers are fimA -F (SEQ ID NO.15): TGCCTTTCTCCATCGTC, fimA -R (SEQ ID NO.16): TTGCGGTAGTGCTATTGTC. Quantitative results are as follows: Figure 10 As shown, the results indicate exogenous transformation T1fr The gene ATCC13076 / pUC19+ T1fr strain fimA Gene expression was significantly reduced.

[0056] 8. Salmonella enteritidis fimA Promoter and E. coli type I fimbriae phase change switch fimS Sequence alignment of the T1FR protein binding region in China.

[0057] The comparison results are as follows Figure 11 As shown, Salmonella enteritidis is visible. fimA The promoter 'TAAATAAAAAATAGCC' is similar to the " fimS The T1FR protein-binding region of the gene is highly homologous, and this region is also highly homologous to FimZ, the major activator of type I fimbriae expression. fimA The binding regions of the promoters overlap.

[0058] 11. Determination of the inhibitory effect of T1FR protein on Salmonella type I fimbriae

[0059] ATCC13076 strain, ATCC13076 / pUC19 strain and ATCC13076 / pUC19+ strain T1frThe bacterial strains were inoculated into LB solid medium and cultured overnight at 37°C. Single colonies were then picked, stained with 2% phosphotungstic acid for 3-10 seconds, air-dried at room temperature, and then observed using a JEM-1400FLASH transmission electron microscope to examine the bacterial fimbriae. Results are as follows: Figure 12 As shown, exogenous expression T1fr ATCC13076 / pUC19+ after gene generation T1fr Type I fimbriae of the strain were significantly inhibited.

[0060] In summary, through exogenous expression T1fr The gene, whose expressed T1FR protein can effectively inhibit type I fimbriae of Klebsiella pneumoniae and Salmonella enterica, is illustrated in the diagram. Figure 1 The technical solution provided by this invention has promising applications in the prevention, control, and treatment of Klebsiella pneumoniae and Salmonella enteritidis infections, and also provides an important basis and approach for rationally reducing the use of antibiotics.

[0061] Although the present invention has been described in detail through the preferred embodiments above, it should be understood that the above description should not be considered as a limitation of the present invention. Various modifications and substitutions to the present invention will be apparent to those skilled in the art after reading the above description. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. Use of a T1FR protein to inhibit type I fimbriae of Klebsiella pneumoniae and Salmonella enteritidis in non-disease diagnostic and therapeutic procedures, characterized in that, The amino acid sequence of the T1FR protein is shown as SEQ ID NO.

10.

2. Use according to claim 1, characterized in that, The T1FR protein can inhibit the formation of biofilm of Klebsiella pneumoniae and Salmonella enteritidis.

3. A method of inhibiting type 1 fimbriae of Klebsiella pneumoniae and Salmonella enteritidis by T1FR protein in non-disease diagnosis and treatment process, characterized by, The recombinant plasmid containing the nucleotide sequence shown as SEQ ID NO. 9 is constructed, and the recombinant plasmid is transformed into Klebsiella pneumoniae and Salmonella enteritidis for exogenous expression.

4. The method of claim 3, wherein, The recombinant plasmid is selected from pUC19.

Images