Excipient for delivering exogenous plasmid DNA as well as preparation and application of excipient

Abstract

The invention relates to the technical field of nucleic acid delivery, in particular to an excipient for delivering exogenous plasmid DNA as well as preparation and application of the excipient. The excipient is a liquid mixture or a lyophilized substance of the liquid mixture, the liquid mixture comprises amino acid substances and a buffer solution, and when exogenous plasmid DNA is delivered, the effective delivery concentration of the amino acid substances is 3 mmol / L or above. An excipient and exogenous plasmid DNA are mixed to obtain the exogenous plasmid DNA preparation, in the exogenous plasmid DNA preparation, the effective delivery concentration of amino acid substances is 3 mmol / L or above, and the effective delivery concentration of the exogenous plasmid DNA is 0.05 ug / uL or above. The exogenous plasmid DNA preparation provided by the invention can achieve the purpose of delivering the exogenous plasmid DNA to muscle and skin tissues in multiple species in a more efficient, wider and longer time interval, and can enlarge the transfection range, improve the protein expression quantity of the target gene and enhance the immune response. Tumor vaccines and infectious disease vaccines with good immune effects can be developed, and clinical value is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of nucleic acid delivery, and is an excipient for delivering exogenous plasmid DNA and application thereof. Background Art

[0002] Since Wolff et al. reported in 1990 that naked plasmids can be directly injected into muscle cells to transfect and express exogenous genes, it has been discovered that exogenous plasmid DNA can be directly injected into some tissues or organs of animals to obtain a small amount of gene expression. These tissues and organs mainly include muscle tissue, skin tissue, and liver. However, this method of direct injection of exogenous nucleic acids is considered to be inefficient. Both the number of transfected cells and the level of exogenous gene expression in transfected cells are too low to reach the threshold of application. For example, it cannot arouse an effective immune response in an organism or repair genetic defects. For this reason, the existing in vivo transfection technology for plasmid DNA relies on further assistance of exogenous nucleic acid delivery through physical and biochemical methods.

[0003] Physical methods refer to methods that use external forces such as sound, light, electricity, and heat to create instantaneous holes on the cell membrane surface to assist in the delivery of exogenous nucleic acids. Therefore, physical methods often require additional equipment to treat muscles when assisting in the delivery of exogenous nucleic acids, such as electroporation and ultrasound. However, physical methods in the prior art usually have the problems of high operating costs, poor compliance, and local tissue damage.

[0004] Biochemical methods refer to the use of biologically active materials or molecules to form nanoparticles with exogenous nucleic acids, thereby improving the uptake of exogenous nucleic acids, improving lysosomal escape, and assisting in the delivery of exogenous nucleic acids. However, biochemical methods in the prior art usually have problems such as high tissue toxicity, high cost, poor targeting, and poor stability. In addition, both physical methods and biochemical methods in the prior art have the problem of low delivery efficiency to a certain extent. Summary of the invention

[0005] Problems with the prior art: The prior art has the problem that after the plasmid DNA encoding the target gene sequence is delivered into the organism, the transfection range in the organism is small and the expression level of the target gene is low.

[0006] In view of the above problems existing in the prior art, the present invention provides an excipient for delivering exogenous plasmid DNA and its preparation and use.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] In a first aspect, an excipient for delivering exogenous plasmid DNA is a liquid mixture or a lyophilized product of a liquid mixture, wherein the liquid mixture comprises an amino acid substance and a buffer.

[0009] Preferably, when delivering exogenous plasmid DNA, the effective delivery concentration of the amino acid substance is above 3 mmol / L.

[0010] Preferably, the effective delivery concentration of the amino acid substance is 3-300mmol / L; preferably, the effective delivery concentration of the amino acid substance is 10-300mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 100-300mmol / L.

[0011] Preferably, the route of delivery is intramuscular or transdermal injection.

[0012] Preferably, when the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of glycine, γ-aminobutyric acid, L-histidine, histamine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid,

[0013] More preferably, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid.

[0014] Preferably, when the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid,

[0015] More preferably, when the delivery method is intramuscular injection, the amino acid substance is selected from one or more substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid.

[0016] Preferably, when the delivery method is intramuscular injection, the amino acid substances are two substances selected from the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid,

[0017] More preferably, when the delivery method is intramuscular injection, the effective delivery concentration ratio of the two substances constituting the amino acid substances is 1-5:1-5, preferably, the effective delivery concentration ratio is 1-2:1-2.

[0018] Preferably, when the delivery method is intramuscular injection, the amino acid substance is a combination of L-glutamic acid and ectoine.

[0019] And / or when the delivery method is intramuscular injection, the amino acid substance is a combination of L-glutamic acid and L-leucine.

[0020] Preferably, when the delivery method is skin injection, the amino acid substance includes one or more substances selected from the group consisting of L-proline, L-valine, L-lysine, homoserine, L-serine, glycine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine and polyglutamic acid,

[0021] More preferably, the amino acid substance comprises one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid.

[0022] Most preferably, when the delivery method is skin injection, the amino acid substance is selected from one or more substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid.

[0023] Preferably, when the delivery method is skin injection, the amino acid substances are two substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid,

[0024] More preferably, when the delivery method is skin injection, the effective delivery concentration ratio of the two substances constituting the amino acid substances is 1-5:1-5, preferably, the effective delivery concentration ratio is 1-2:1-2.

[0025] Preferably, the excipient has the function of expanding the transfection range of the exogenous plasmid DNA encoding the target gene in the organism and increasing the expression amount of the target gene.

[0026] Preferably, the buffer is an isotonic buffer, preferably, the isotonic buffer is PBS or physiological saline.

[0027] In a second aspect, the present invention provides a preparation method containing the excipient, comprising the steps of: mixing components including amino acids and buffer to obtain a liquid mixture, or freeze-drying the liquid mixture to obtain a lyophilized product of the liquid mixture.

[0028] In a third aspect, the present invention provides use of the excipient or the excipient prepared by the preparation method in the preparation of an exogenous plasmid DNA preparation.

[0029] In a fourth aspect, the present invention provides an exogenous plasmid DNA preparation, comprising the excipient or the excipient prepared by the preparation method, and exogenous plasmid DNA, wherein the amino acid substance in the exogenous plasmid DNA preparation is used to deliver the exogenous plasmid DNA, and the effective delivery concentration of the amino acid substance is above 3 mmol.

[0030] Preferably, in the exogenous plasmid DNA preparation, the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL, preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL, more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1 ug / uL,

[0031] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of the amino acid substance is above 3mmol / L, preferably, the effective delivery concentration is 3-300mmol / L, more preferably, the effective delivery concentration is 10-300mmol / L, and most preferably, the effective delivery concentration is 100-300mmol / L.

[0032] Preferably, the exogenous plasmid DNA is an exogenous plasmid DNA encoding a target gene sequence, and more preferably, the target gene is a gene sequence of a functional protein.

[0033] Preferably, the functional protein comprises one or more substances selected from the group consisting of ovalbumin, fluorescent protein, luciferase, cytokine, nanobody, monoclonal antibody and recombinant antibody.

[0034] Preferably, the exogenous DNA is: pVAX-luci-tdT plasmid DNA, or pVAX-Ova plasmid DNA. Preferably, the exogenous DNA is: purified pVAX-luci-tdT plasmid DNA, and / or purified pVAX-Ova plasmid DNA.

[0035] In a fifth aspect, the present invention provides a method for preparing the exogenous plasmid DNA preparation, comprising the following steps: mixing a substance containing an excipient and an exogenous plasmid DNA to obtain an exogenous plasmid DNA preparation, wherein when the amino acid substance is delivered to the exogenous plasmid DNA, the effective delivery concentration of the amino acid substance is above 3 mmol / L, and the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL.

[0036] In a sixth aspect, the present invention provides the use of the exogenous plasmid DNA preparation or the exogenous plasmid DNA preparation prepared by the preparation method in the preparation of vaccine products or non-vaccine pharmaceutical products.

[0037] In a seventh aspect, the present invention provides a vaccine product comprising the exogenous plasmid DNA preparation or the exogenous plasmid DNA preparation prepared by the preparation method. Preferably, the vaccine product is of intramuscular injection type or skin injection type.

[0038] In one aspect, the present invention provides a non-vaccine pharmaceutical product, comprising the exogenous plasmid DNA preparation or the exogenous plasmid DNA preparation prepared by the preparation method. Preferably, the non-vaccine pharmaceutical product is of intramuscular injection type or skin injection type.

[0039] Beneficial effects of the present invention:

[0040] (1) The present invention uses amino acid substances of a specific concentration as excipients, mixes the excipients with plasmid DNA encoding the target gene, and then delivers the plasmid DNA to muscle tissue / skin tissue in the form of injection. Compared with not using an excipient, the transfection range of the plasmid DNA is increased. Increase the protein expression of the target gene , thereby achieving the goal of efficiently, extensively and long-term delivery of plasmid DNA encoding exogenous proteins to muscle tissue / skin tissue.

[0041] (2) The exogenous plasmid DNA preparation containing excipients provided by the present invention has the characteristics of low cost, good reproducibility, and easy acquisition of raw materials. In addition, no additional electroporation equipment is required during the injection process, and no tissue damage and additional pain are caused. Compared with existing technologies, it has better applicability.

[0042] (3) The exogenous plasmid DNA preparation containing excipients provided by the present invention can encode antigenic proteins, and after being injected through muscle or skin, can produce an effective immune response against the encoded antigenic proteins, thereby producing a preventive or therapeutic effect on tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1The statistical results of the correlation between the in vivo imaging signal value of luciferase in mice, the in vitro luciferase signal value, and the relative expression level of luciferase are shown in the figure for mice that were intramuscularly injected with different concentrations of L-glutamate-plasmid DNA solutions.

[0044] Figure 2 is the relative expression of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, saline group and electroporation group relative to the PBS group, wherein, Figure 2 The vertical axis in the figure shows the multiple of expression level relative to that of the PBS group, that is, the multiple of relative expression level of luciferase relative to that of the PBS group.

[0045] Figure 3 These are immunofluorescence images of tibialis anterior muscle sections of mice in the amino acid group (wherein the amino acid is glycine, D-histidine, L-alanine, or L-glutamic acid), the amino acid derivative group (wherein the amino acid derivative is ectoine or homoserine), the polyglutamate group, the PBS group, and the electroporation group.

[0046] Figure 4 The values ​​are the in vivo imaging signals of luciferase in mice on the 1st, 3rd, 7th, 11th, 15th and 30th day after injection. The results showed that the L-glutamate group showed several times the protein expression level of the PBS group for up to 30 days. Figure 5 This is a stereofluorescence microscopy image of the mouse tibialis anterior muscle on day 30 after injection.

[0047] Figure 6 The number of myofilaments in the tibialis anterior muscle sections of mice on day 30 after injection is the quantitative result of the number of labeled myofilaments on the muscle sections.

[0048] Figure 7 The quantitative results are the mean fluorescence intensity of the tibialis anterior muscle sections of mice on day 30 after injection.

[0049] Figure 8 This is an immunoblot of mouse tibialis anterior muscle tissue.

[0050] Fig. 9 This is the detection result diagram of the in vivo imaging signal value.

[0051] Fig.10 is the relative expression of luciferase in the amino acid group, amino acid derivative group, and polyglutamic acid group relative to the PBS group, wherein, Fig.10 The vertical axis in the figure shows the multiple of expression level relative to that of the PBS group, that is, the multiple of relative expression level of luciferase relative to that of the PBS group. Fig.11These are immunofluorescence images of skin sections of mice in the amino acid group (including glycine, ectoine, L-glutamic acid or L-glutamine), the amino acid derivative group (including ectoine), the polyglutamic acid group, and the PBS group.

[0052] Fig.12 This is the result of detecting the in vivo imaging signal values ​​of rats in the L-glutamate group, PBS group and electroporation group.

[0053] Fig.13 These are the immunofluorescence images of tibialis anterior muscle sections of rats in the L-glutamate group, PBS group, and electroporation group.

[0054] Fig.14 These are the immunofluorescence images of rabbit tibialis anterior muscle sections in the L-glutamate group, ectoine group, and PBS group.

[0055] Fig.15 It is a flow chart of immune sequence sample collection and a schematic diagram of the construction of the pVax-Ova plasmid encoding the immunogen gene sequence (ovalbumin gene sequence), i.e., a schematic diagram of the structure of the ovalbumin DNA vaccine.

[0056] Fig.16 This is a graph characterizing the number of IFN-γ-positive spleen cells in response to spike protein after intramuscular injection of mice in the amino acid group (wherein the amino acid is L-glutamic acid, ectoine, L-leucine or D-histidine), amino acid derivative group (wherein the amino acid derivative is ectoine), PBS group, electroporation group, control group, and blank immunized mice after pVAX-Ova immunization, Fig.16 In the figure, ovalbumin antigen stimulation is indicated as pVAX-Ova immunization, and the non-stimulated control is indicated as blank immunization.

[0057] Fig.17 The number of IFN-γ positive spleen cells in response to spike protein after intramuscular injection in the amino acid group (wherein the amino acid is L-glutamic acid, L-leucine or D-histidine), amino acid derivative group (wherein the amino acid derivative is ectoine), PBS group and electroporation group of mice immunized with pVAX-Ova

[0058] Fig.18 The titer of OVA-specific antibodies injected intramuscularly in the amino acid group (wherein the amino acid is L-glutamic acid, L-leucine or D-histidine), the amino acid derivative group (wherein the amino acid derivative is ectoine), the PBS group and the electroporation group after immunization with pVAX-Ova is shown in FIG. Fig.18 The first dose refers to the first immunization, the second dose refers to the second immunization, and the third dose refers to the third immunization.

[0059] Fig.19 This is a graph showing the titer of OVA-specific antibodies after skin injection of mice in the L-glutamate group and the PBS group, wherein the ordinate represents absorbance and the abscissa represents dilution multiple.

[0060] Fig. 20 This is the result graph of OVA-specific antibody titer after skin injection in rats in the L-glutamate group, ectoine group and PBS group.

[0061] Fig.21 This is the result graph of OVA-specific antibody titer after intramuscular injection in rats in the L-glutamate group, electroporation group and PBS group.

[0062] Fig. 22 Flowchart of experimental procedures and sample collection for tumor immunoprophylaxis.

[0063] Fig.23 The figure is a comparison of the survival rates of the amino acid group (L-glutamic acid, L-leucine or a combination of L-glutamic acid and L-leucine), the PBS group and the blank immunization mice after subcutaneous transplantation of melanoma cells within 90 days. DETAILED DESCRIPTION

[0064] In order to better understand the above technical solution, the technical solution of the present invention is clearly and completely explained in conjunction with the specific implementation method below. It should be noted that the content in the specific implementation method is only a specific implementation and explanation of the technical solution of the present invention, and should not be understood as limiting the scope of protection of the present invention.

[0065] (I) Regarding the excipients for delivering exogenous plasmid DNA provided by the present invention.

[0066] In some specific embodiments, the present invention provides an excipient for delivering exogenous plasmid DNA. The excipient is a liquid mixture or a lyophilized product of a liquid mixture, wherein the liquid mixture includes an amino acid substance and a buffer, wherein, when delivering the exogenous plasmid DNA, the effective delivery concentration of the amino acid substance is 3 mmol / L or more. Wherein, the delivery method for delivering the exogenous plasmid DNA is intramuscular injection or skin injection. During intramuscular injection or skin injection, the excipient and the exogenous plasmid DNA are mixed and injected, which can transfect the muscle tissue or skin tissue at the injection site, promote the expression of the target gene, and thus produce a therapeutic or immune effect.

[0067] Preferably, the effective delivery concentration of the amino acid substance is 3-300mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 10-300mmol / L; most preferably, the effective delivery concentration of the amino acid substance is 100-300mmol / L.

[0068] Preferably, when the excipient is a liquid mixture, the liquid mixture includes an amino acid substance and a buffer. The present invention has no limitation on the concentration of the amino acid in the liquid mixture, as long as the effective delivery concentration of the amino acid is 3 mmol / L or more when delivering the exogenous plasmid DNA, preferably, the effective delivery concentration of the amino acid substance is 3-300 mmol / L.

[0069] That is to say, when the concentration of amino acid substances in the liquid mixture is high, solvents such as buffer solutions can be used to reduce the concentration of amino acid substances, thereby adjusting the effective delivery concentration of amino acid substances to 3-300mmol / L when delivering exogenous plasmid DNA; when the concentration of amino acid substances in the liquid mixture is low, the lyophilized material of the liquid mixture or the amino acid substances themselves can be used to increase the concentration of amino acid substances, thereby adjusting the effective delivery concentration of amino acid substances to 3-300mmol / L when delivering exogenous plasmid DNA.

[0070] It should be noted that the excipient of the present invention can be a liquid mixture of one amino acid substance or a liquid mixture of two or more amino acid substances, wherein the ratio of the effective delivery concentrations of the two or more amino acid substances is not particularly limited, as long as the total effective delivery concentration of the two or more amino acid substances is above 3 mmol / L when delivering exogenous plasmid DNA.

[0071] In some specific embodiments, the present invention provides an excipient for delivering exogenous plasmid DNA, characterized in that it is a liquid mixture or a lyophilized product of a liquid mixture, wherein the liquid mixture includes an amino acid substance and a buffer, wherein the effective delivery concentration of the amino acid substance is above 3 mmol / L.

[0072] Preferably, in some embodiments, the effective delivery concentration of the amino acid substance is 100-300 mmol / L.

[0073] More preferably, in some specific embodiments, the effective delivery concentration of the amino acid substance can be 100mmol / L, 101mmol / L, 102mmol / L, 103mmol / L, 104mmol / L, 105mmol / L, 106mmol / L, 107mmol / L, 108mmol / L, 109mmol / L, 110mmol / L, 111mmol / L, 112mmol / L, 113mmol / L, 114mmol / L, 115mmol / L, 116mmol / L, 117mmol / L, 118mmol / L, 119mmol / L, 120mmol / L, 121mmol / L ol / L, 122mmol / L, 123mmol / L, 124mmol / L, 125mmol / L, 126mmol / L, 127mmol / L, 128mmol / L, 129mmol / L, 130mmol / L, 131mmol / L, 132mmol / L, 133mmol / L , 134mmol / L, 135mmol / L, 136mmol / L, 137mmol / L, 138mmol / L, 139mmol / L, 140mmol / L, 141mmol / L, 142mmol / L, 143mmol / L, 144mmol / L, 145mmol / L, 146 mmol / L, 147mmol / L, 148mmol / L, 149mmol / L, 150mmol / L, 151mmol / L, 152mmol / L, 153mmol / L, 154mmol / L, 155mmol / L, 156mmol / L, 157mmol / L, 158mmol / L、159mmol / L、160mmol / L、161mmol / L、162mmol / L、163mmol / L、164mmol / L、165mmol / L、166mmol / L、167mmol / L、168mmol / L、169mmol / L、170mmol / L、1 71mmol / L, 172mmol / L, 173mmol / L, 174mmol / L, 175mmol / L, 176mmol / L, 177mmol / L, 178mmol / L, 179mmol / L, 180mmol / L, 181mmol / L, 182mmol / L, 183mm ol / L, 184mmol / L, 185mmol / L, 186mmol / L, 187mmol / L, 188mmol / L, 189mmol / L, 190mmol / L, 191mmol / L, 192mmol / L, 193mmol / L, 194mmol / L, 195mmol / L,196mmol / L、197mmol / L、198mmol / L、199mmol / L、200mmol / L、201mmol / L、20 2mmol / L、203mmol / L、204mmol / L、205mmol / L、206mmol / L、207mmol / L、208mm ol / L、209mmol / L、210mmol / L、211mmol / L、212mmol / L、213mmol / L、214mmol / L、215mmol / L、216mmol / L、217mmol / L、218mmol / L、219mmol / L、220mmol / L、 221mmol / L、222mmol / L、223mmol / L、224mmol / L、225mmol / L、226mmol / L、22 7mmol / L、228mmol / L、229mmol / L、230mmol / L、231mmol / L、232mmol / L、233mm ol / L、234mmol / L、235mmol / L、236mmol / L、237mmol / L、238mmol / L、239mmol / L、240mmol / L、241mmol / L、242mmol / L、243mmol / L、244mmol / L、245mmol / L、 246mmol / L、247mmol / L、248mmol / L、249mmol / L、250mmol / L、251mmol / L、25 2mmol / L、253mmol / L、254mmol / L、255mmol / L、256mmol / L、257mmol / L、258mm l / L、259mmol / L、260mmol / L、261mmol / L、262mmol / L、263mmol / L、264mmol / L、265mmol / L、266mmol / L、267mmol / L、268mmol / L、269mmol / L、270mmol / L、 271mmol / L、272mmol / L、273mmol / L、274mmol / L、275mmol / L、276mmol / L、27 7mmol / L、278mmol / L、279mmol / L、280mmol / L、281mmol / L、282mmol / L、283mm ol / L、284mmol / L、285mmol / L、286mmol / L、287mmol / L、288mmol / L、289mmol / L、290mmol / L、291mmol / L、292mmol / L、293mmol / L、294mmol / L、295mmol / L、296mmol / L, 297mmol / L, 298mmol / L, 299mmol / L or 300mmol / L, or an effective delivery concentration of an amino acid substance within a numerical range consisting of any two of the above specific numerical values ​​as endpoints.

[0074] (ii) Regarding the exogenous plasmid DNA preparation provided by the present invention.

[0075] In some specific embodiments, the present invention provides an exogenous plasmid DNA preparation containing the above-mentioned excipients, wherein the effective delivery concentration of the amino acid substances in the excipients in the excipients in the exogenous plasmid DNA preparation is above 3 mmol / L, and the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL.

[0076] Preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL.

[0077] More preferably, in some embodiments, the effective delivery concentration of the exogenous plasmid DNA may be 0.05ug / uL, 0.06ug / uL, 0.07ug / uL, 0.08ug / uL, 0.09ug / uL, 0.1ug / uL, 0.11ug / uL, 0.12ug / uL, 0.13ug / uL, 0.14ug / uL, 0.15ug / uL, 0.16ug / uL, 0.17ug / uL, 0.18ug / uL, 0.19ug / uL, 0.2ug / uL, 0.21ug / uL, 0.22ug / uL, 0.23ug / uL, 0.24ug / uL, 0.25ug / uL, 0.26ug / uL uL, 0.27ug / uL, 0.28ug / uL, 0.29ug / uL, 0.3ug / uL, 0.31ug / uL, 0.32ug / uL, 0.33ug / uL, 0.34ug / uL, 0.35ug / uL, 0.36ug / uL, 0.37ug / uL, 0.38ug / uL, 0. 39ug / uL, 0.4ug / uL, 0.41ug / uL, 0.42ug / uL, 0.43ug / uL, 0.44ug / uL, 0.45ug / uL, 0.46ug / uL, 0.47ug / uL, 0.48ug / uL, 0.49ug / uL, 0.5ug / uL, 0.51ug / uL ,0.52ug / uL, 0.53ug / uL, 0.54ug / uL, 0.55ug / uL, 0.56ug / uL, 0.57ug / uL, 0.58ug / uL, 0.59ug / uL, 0.6ug / uL, 0.61ug / uL, 0.62ug / uL, 0.63ug / uL, 0.64 ug / uL, 0.65ug / uL, 0.66ug / uL, 0.67ug / uL, 0.68ug / uL, 0.69ug / uL, 0.7ug / uL, 0.71ug / uL, 0.72ug / uL, 0.73ug / uL, 0.74ug / uL, 0.75ug / uL, 0.76ug / uL, 0.77ug / uL, 0.78ug / uL, 0.79ug / uL, 0.8ug / uL, 0.81ug / uL, 0.82ug / uL, 0.83ug / uL, 0.84ug / uL, 0.85ug / uL, 0.86ug / uL, 0.87ug / uL, 0.88ug / uL, 0.89ug / uL、0.9ug / uL、0.91ug / uL、0.92ug / uL、0.93ug / uL、0.94ug / uL、0.95ug / uL、0.96ug / uL、0.97ug / uL、0.98ug / uL、0.99ug / uL、1.00ug / uL、1.05ug / uL、1.1ug / uL, 1.15ug / uL, 1.2ug / uL, 1.25ug / uL, 1.3ug / uL, 1.35ug / uL, 1.4ug / uL, 1.45ug / uL, 1.5ug / uL, 1.55ug / uL, 1.6ug / uL, 1.65ug / uL, 1.7ug / uL, 1.75ug / uL, 1.8ug / uL, 1.85ug / uL, 1.9ug / uL, 1.95ug / uL, 2.00ug / uL, 2.05ug / uL, 2.1ug / uL, 2.15ug / uL, 2.2ug / uL, 2.25ug / uL, 2.3ug / uL, 2.35ug / uL, 2.4ug / uL, 2.45ug / uL, 2.5ug / uL, 2.55ug / uL, 2.6ug / uL, 2.65 ug / uL, 2.7ug / uL, 2.75ug / uL, 2.8ug / uL, 2.85ug / uL, 2.9ug / uL, 2.95ug / uL, 3.00ug / uL, 3.05ug / uL, 3.1ug / uL, 3.15ug / u L, 3.2ug / uL, 3.25ug / uL, 3.3ug / uL, 3.35ug / uL, 3.4ug / uL, 3.45ug / uL, 3.5ug / uL, 3.55ug / uL, 3.6ug / uL, 3.65ug / uL, 3. 7ug / uL, 3.75ug / uL, 3.8ug / uL, 3.85ug / uL, 3.9ug / uL, 3.95ug / uL, 3.00ug / uL, 4.05ug / uL, 4.1ug / uL, 4.15ug / uL, 4.2ug / uL, 4.25ug / uL, 4.3ug / uL, 4.35ug / uL, 4.4ug / uL, 4.45ug / uL, 4.5ug / uL, 4.55ug / uL, 4.6ug / uL, 4.65ug / uL, 4.7ug / uL, 4.75ug / uL, 4.8ug / uL, 4.85ug / uL, 4.9ug / uL, 4.95ug / uL or 5.00ug / uL, or an effective delivery concentration of exogenous plasmid DNA within a numerical range consisting of any two of the above specific numerical values ​​as endpoints. .

[0078] Preferably, the exogenous DNA is: pVAX-luci-tdT plasmid DNA, or pVAX-Ova plasmid DNA. Preferably, the exogenous DNA is: purified pVAX-luci-tdT plasmid DNA, and / or purified pVAX-Ova plasmid DNA. It should be noted that the selection of plasmid DNA is not limited to the above: pVAX-luci-tdT plasmid DNA and / or pVAX-OVA plasmid. The two plasmids encoding the gene sequences of specific functional proteins are only used to illustrate the specific use method and effect of the present invention. During injection, a syringe can be used for intramuscular injection or intradermal injection, or a needle-free syringe can be used for administration. Preferably, the functional protein includes one or more substances selected from the group consisting of catalytic proteins, transport proteins, immune proteins and regulatory proteins.

[0079] (III) Regarding the exogenous plasmid DNA preparation for intramuscular injection provided by the present invention.

[0080] In some specific embodiments, the present invention provides an exogenous plasmid DNA preparation for intramuscular injection, which contains the above-mentioned excipients and exogenous plasmid DNA, wherein, in the exogenous plasmid DNA preparation, the effective delivery concentration of the exogenous plasmid DNA is 0.05ug / uL or more, preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5ug / uL, more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1ug / uL,

[0081] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of the amino acid substance is above 3mmol / L, preferably, the effective delivery concentration is 3-300mmol / L, more preferably, the effective delivery concentration is 10-300mmol / L, and most preferably, the effective delivery concentration is 100-300mmol / L.

[0082] When a liquid mixture containing the above-mentioned effective delivery concentration of amino acid substances is used as an excipient for intramuscular injection, the expression amount of the target gene in the exogenous plasmid DNA is greater than 0 and less than or equal to 60 times that of the exogenous plasmid DNA without the excipient.

[0083] And / or when a liquid mixture containing amino acid substances at the above-mentioned effective delivery concentration is used as an excipient for intramuscular injection, the number of cells successfully transfected by the pVAX-luci-tdT plasmid DNA in muscle tissue is 5-80 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the muscle tissue is muscle tissue of a mouse, rat or rabbit.

[0084] Preferably, in some specific embodiments, the exogenous plasmid DNA is purified pVAX-luci-tdT plasmid DNA, which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence.

[0085] Preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of glycine, γ-aminobutyric acid, L-histidine, histamine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid.

[0086] Preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid.

[0087] More preferably, in some specific embodiments, the amino acid substance is one of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid.

[0088] Most preferably, in some specific embodiments, when a liquid mixture containing L-glutamic acid with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0089] And / or when a liquid mixture containing L-proline with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0090] And / or when a liquid mixture containing L-threonine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0091] And / or when a liquid mixture containing L-asparagine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0092] And / or when a liquid mixture containing D-histidine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0093] And / or when a liquid mixture containing L-serine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 10 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0094] And / or when a liquid mixture containing L-alanine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0095] And / or when a liquid mixture containing L-methionine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0096] And / or when a liquid mixture containing L-leucine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0097] And / or when a liquid mixture containing D-alanine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0098] And / or when a liquid mixture containing L-phenylalanine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0099] And / or when a liquid mixture containing L-valine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0100] And / or when a liquid mixture containing L-isoleucine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0101] And / or when a liquid mixture containing tetrahydropyrimidine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 ug / uL.

[0102] And / or when a liquid mixture containing homoserine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 30 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0103] And / or when a liquid mixture containing polyglutamic acid with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 50 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL.

[0104] More preferably, in some specific embodiments, the amino acid substance is one or a combination of two of L-glutamic acid, L-leucine, and ectoine.

[0105] Most preferably, in some specific embodiments, when a liquid mixture containing L-glutamic acid with an effective delivery concentration of 3-300mmol / L is used as an excipient, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0106] And / or when a liquid mixture containing L-glutamic acid with an effective delivery concentration of greater than or equal to 30 mmol / L and less than 20 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0107] And / or when a liquid mixture containing L-glutamic acid with an effective delivery concentration of greater than or equal to 20 mmol / L and less than 100 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 25 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0108] And / or when a liquid mixture containing L-glutamic acid with an effective delivery concentration of greater than or equal to 100 mmol / L and less than or equal to 300 mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0109] And / or when a liquid mixture containing an amino acid substance with an effective delivery concentration of 3-300mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without an excipient. Wherein, the amino acid substance is a combination of L-glutamic acid and ectoine, preferably, the concentration ratio of L-glutamic acid to ectoine is 1:5-1:5, more preferably, the concentration ratio of L-glutamic acid to ectoine is 1:2-1:2, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0110] In some specific embodiments, when a liquid mixture containing an amino acid substance with an effective delivery concentration of 3-300mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without an excipient. Wherein, the amino acid substance is a combination of L-glutamic acid and L-leucine, preferably, the concentration ratio of L-glutamic acid and L-leucine is 1:5-1:5, more preferably, the concentration ratio of L-glutamic acid and L-leucine is 1:2-1:2, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0111] In some specific embodiments, when a liquid mixture containing an amino acid substance with an effective delivery concentration of 3-300mmol / L is used as an excipient for intramuscular injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without an excipient. Wherein, the amino acid substance is a combination of L-glutamic acid and glycine, preferably, the concentration ratio of L-glutamic acid to glycine is 1:5-1:5, more preferably, the concentration ratio of L-glutamic acid to glycine is 1:2-1:2, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0112] Preferably, in some specific embodiments, when a liquid mixture containing amino acid substances with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the number of cells successfully transfected by the pVAX-luci-tdT plasmid DNA in mouse muscle tissue is 10-40 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 ug / uL, wherein the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, ectoine, homoserine, D-histidine, L-alanine and L-glutamic acid.

[0113] Preferably, in some specific embodiments, when a liquid mixture containing amino acid substances with an effective delivery concentration of 100-300mmol / L is used as an excipient for intramuscular injection, the number of cells successfully transfected by the pVAX-luci-tdT plasmid DNA in rat muscle tissue is 10-80 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL, wherein the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, ectoine, homoserine, D-histidine, L-alanine and L-glutamic acid, and preferably, the amino acid substance is L-glutamic acid.

[0114] Preferably, in some specific embodiments, when a liquid mixture containing amino acid substances with an effective delivery concentration of 100-300 mmol / L is used as an excipient for intramuscular injection, the number of cells successfully transfected by the pVAX-luci-tdT plasmid DNA in rabbit muscle tissue is 5-20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1 ug / uL, wherein the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, ectoine, homoserine, D-histidine, L-alanine and L-glutamic acid, and more preferably, the amino acid substance is L-glutamic acid or ectoine.

[0115] (IV) Regarding the exogenous plasmid DNA preparation for skin injection provided by the present invention.

[0116] In some specific embodiments, the present invention provides an exogenous plasmid DNA preparation for skin injection, which contains the above-mentioned excipients and exogenous plasmid DNA, wherein in the exogenous plasmid DNA preparation, the effective delivery concentration of the exogenous plasmid DNA is 0.05ug / uL or more, preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5ug / uL, more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1ug / uL,

[0117] And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of the amino acid substance is above 3mmol / L, preferably, the effective delivery concentration is 3-300mmol / L, more preferably, the effective delivery concentration is 10-300mmol / L, and most preferably, the effective delivery concentration is 100-300mmol / L.

[0118] When a liquid mixture containing the above-mentioned effective delivery concentration of amino acid substances is used as an excipient for skin injection, the expression amount of the target gene in the exogenous plasmid DNA is greater than 0 and less than or equal to 80 times that of the exogenous plasmid DNA without using the excipient.

[0119] And / or when a liquid mixture containing amino acid substances at the above-mentioned effective delivery concentration is used as an excipient for skin injection, the number of cells successfully transfected in the skin tissue by the pVAX-luci-tdT plasmid DNA is 10-80 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the skin tissue is the skin tissue of a mouse, rat or rabbit.

[0120] Preferably, in some specific embodiments, the exogenous plasmid DNA is purified pVAX-luci-tdT plasmid DNA, which encodes both the luciferase gene sequence and the red fluorescent protein gene sequence.

[0121] More preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of L-proline, L-valine, L-lysine, homoserine, L-serine, and glycine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine and polyglutamic acid.

[0122] More preferably, in some specific embodiments, the amino acid substance includes one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid.

[0123] More preferably, the amino acid substance is one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid and L-glutamine, ectoine, homoserine and polyglutamic acid. Preferably, based on the effective delivery concentration of the amino acid substance, the effective delivery concentration ratio of the two substances constituting the amino acid substance is 1-5:1-5, preferably, the effective delivery concentration ratio is 1-2:1-2.

[0124] Most preferably, in some specific embodiments, when a liquid mixture containing D-histidine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin injection, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0125] And / or when a liquid mixture containing L-leucine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin application, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 20 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 ug / uL.

[0126] And / or when a liquid mixture containing polyglutamic acid with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin application, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0127] And / or when a liquid mixture containing L-glutamic acid with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin application, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than 0 and less than or equal to 40 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1ug / uL.

[0128] And / or when a liquid mixture containing tetrahydropyrimidine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin application, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than or equal to 20 and less than or equal to 60 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 ug / uL.

[0129] And / or when a liquid mixture containing L-glutamine with an effective delivery concentration of 100-300 mmol / L is used as an excipient for skin application, the expression level of the target gene in the pVAX-luci-tdT plasmid DNA is greater than or equal to 40 and less than or equal to 80 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.1-1 ug / uL.

[0130] And / or in some specific embodiments, when a liquid mixture containing amino acid substances with an effective delivery concentration of 100-300mmol / L is used as an excipient for skin injection, the number of cells successfully transfected by the pVAX-luci-tdT plasmid DNA in the skin tissue of mice is 10-80 times that of the pVAX-luci-tdT plasmid DNA without using an excipient, wherein the effective delivery concentration of the pVAX-luci-tdT plasmid DNA is 0.05-1ug / uL, wherein the amino acid substance is selected from one or more substances in the group consisting of L-glutamic acid, L-glutamine, tetrahydropyrimidine, and polyglutamic acid.

[0131] Unless otherwise specified, the various reagents / instruments used in the examples of the present invention are conventional commercially available products. The sources of the experimental reagents used in the present invention are shown in Table 1, and the sources of the experimental instrument information are shown in Table 2.

[0132] Table 1. Experimental reagent information

[0133]

[0134]

[0135] Table 2. Experimental instrument information

[0136]

[0137] 1. The preparation of the reagents involved in the embodiments or application examples is as follows:

[0138] (1) Lysis buffer: Add 2 tablets of EDTA-free cOmplete to 100 mL of firefly luciferase reporter gene cell lysis buffer. TM The protease inhibitors are mixed and dissolved to obtain a lysate.

[0139] (2) Running buffer: Mix 100 mL of Tris-Glycine SDS-PAGE running buffer (10×) with ultrapure water and dilute to 1 L to obtain running buffer.

[0140] (3) Rapid transfer buffer: Mix 100 mL of ice-free transfer buffer (10×) with 200 mL of anhydrous ethanol and dilute to 1 L with ultrapure water to obtain rapid transfer buffer.

[0141] (4) TBST buffer: Mix 100 mL of TBST buffer (10×) with ultrapure water and dilute to 1 L with ultrapure water to obtain TBST.

[0142] Blocking solution: Mix PBS (1x) with 2.5 g BSA powder and dilute to 50 mL to obtain blocking solution)

[0143] (5) PBST: Mix PBS (1x) with 500 μL of Tween 20 and dilute to 500 mL to obtain PBST.

[0144] (6) RPMI 1640 Medium containing 1% P / S: Mix 5 mL P / S with RPMI 1640 Medium and dilute to 500 mL

[0145] (7) PBS containing 2% P / S: Mix 1 mL P / S with PBS (1x) and adjust the volume to 50 mL.

[0146] (8) Lymphocyte separation solution containing 1% P / S: Add 0.5 mL P / S to the lymphocyte separation solution and dilute to 50 mL.

[0147] (9) Culture medium with a peptide library stimulator concentration of 0.2 mg / mL: 60 μL of DMSO containing 0.1 mg / mL of peptide library stimulator is mixed with serum-free lymphocyte culture medium and fixed to 3 mL to obtain a culture medium with a peptide library stimulator concentration of 0.2 mg / mL.

[0148] 2. Preparation of the purified pVAX-luci-tdT plasmid DNA involved in the embodiment (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), the specific preparation method is as follows:

[0149] The construction method of plasmid pVAX-luci-tdT is as follows:

[0150] The plasmid backbone pVAX was from Invitrogen, and the luciferase luciferase and the red fluorescent protein tdTomato were amplified using primer pairs. The primer pair for amplifying luciferase was: Luci-F: CCGTCAGACTCGAGGCCACCATGGAAGACGCCAAAAACAT (Sequence No. 1), Luci-R: CCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCCACGGCGATCTTTCCGCCCT (Sequence No. 2); the primer pair used for amplifying tdTomato was: tdT-F: TAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGTGAGCAAGGGCGAGGAG (Sequence No. 3), tdT-R: GGCTGATCAGCGGGTTTAAACTTACTTGTACAGCTCGTCCATGCC (Sequence No. 4). The amplified product was detected by agarose gel electrophoresis and recovered using a gel recovery kit for later use. The vector backbone was digested with restriction endonucleases XhoI and PmeI, and the digestion products were detected by agarose gel electrophoresis to ensure complete digestion, and the corresponding fragments were recovered using a gel recovery kit for standby use. Plasmid construction was completed using a seamless cloning kit (Novozyme, C116). Specifically, the digestion vector and the two fragments were mixed in a ratio of 40ng, 20ng, and 2xpremix components in the C116 kit were added and incubated at 50 degrees Celsius for 5 minutes. The product was transformed into Escherichia coli DH5α and plated for overnight culture. The next day, a single clone was picked for PCR identification and sequencing. Select a single clone with a correct sequence and high plasmid yield for seed preservation. The monoclone was preserved with glycerol. Specifically, the bacterial solution grown to the logarithmic growth phase (OD600 = 0.6-1.2) was mixed with 40% (w / v) sterile glycerol in equal proportions and frozen in an ultra-low temperature refrigerator at -80 degrees Celsius.

[0151] The purification method of pVAX-luci-tdT plasmid DNA is as follows:

[0152] 1. Lysis of bacteria:

[0153] (1) Escherichia coli containing the pVAX-luci-tdT plasmid was inoculated into 6 L LB medium at a ratio of 1:1000 for bacterial expansion culture. The bacterial expansion culture parameters were 37°C and 220 rpm for 16 h. The expanded bacterial cells were collected by centrifugation. The centrifugation parameters were: 8000g, 4°C for 10 min, and 36 g of wet weight of bacterial cells were obtained.

[0154] (2) 36 g of bacterial cells were mixed with 120 mL of the first solution (10 mM ethylenediaminetetraacetic acid + 50 mM tris(hydroxymethyl)aminomethane hydrochloride and pH = 8.0) to resuspend the bacterial cells. After resuspension, 120 mL of the second solution (200 mM sodium hydroxide + 1 wt % sodium dodecyl sulfate) was added to lyse the bacterial solution. The lysis was carried out at room temperature for 3 min. Subsequently, 270 mL of the third solution (4 M ammonium sulfate solution, pH = 5.5) was added. After sufficient mixing, the solution was allowed to stand to obtain a lysate. At this time, the final concentration of ammonium sulfate in the lysate was 2.12 M. The lysate was centrifuged at 10,000 g, 4°C for 30 min to collect the supernatant, which was the crude material solution containing the plasmid.

[0155] 2. Purification of plasmid DNA:

[0156] (3) The crude material liquid containing the plasmid is loaded on a hydrophobic chromatography column, and a hydrophobic chromatography product is obtained by a hydrophobic chromatography process, wherein the hydrophobic chromatography process is as follows: 1. Column balance, using solution A to balance the chromatographic column for 2 column volumes, with a flow rate of 10 mL / min; 2. Loading: The crude material liquid containing the plasmid is passed through the hydrophobic chromatography column at a flow rate of 10 mL / min; 3. Eluent: The chromatographic column is eluted with 95% by volume of solution A + 5% by volume of solution B until all indicators are stable, with a flow rate of 10 mL / min; 4. Elution: Elution is performed with 76% by volume of solution A + 24% by volume of solution B, with a flow rate of 10 mL / min, to obtain a hydrophobic chromatography product. Wherein, the hydrophobic chromatography column is 26 mm x 10 mm, with a column bed volume of 50 mL, and the filler is a chromatographic column of mercaptopyridine.

[0157] (4) diluting the hydrophobic chromatography product with water at a ratio of 1:1, loading the diluted hydrophobic chromatography product on a strong anion exchange chromatography column, and obtaining purified plasmid DNA through an ion exchange chromatography process, the ion exchange chromatography process: 1. Column balancing: using solution B to balance 2 column volumes, the flow rate is 10mL / min; 2. Loading: mixing the hydrophobic chromatography product with solution B at a volume ratio of 1:1, and passing through a strong anion exchange chromatography column at a flow rate of 10mL / min; 3. Eluting: using 40% by volume of solution C + 60% by volume of solution B to elute 3 column volumes until all indicators are stable; 4. Elution: using 90% by volume of solution C + 10% by volume of solution B for elution, the flow rate is 10mL / min and collecting the eluted product of 0.9M sodium chloride solution to obtain purified plasmid DNA. Wherein, the strong anion exchange chromatography column is 16mmx10mm, the column bed volume is 20mL, and the filler is a quaternary ammonium ligand chromatography column.

[0158] Wherein, solution A is 2.1M ammonium sulfate + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0159] Solution B is 10 mM EDTA + 100 mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5;

[0160] Solution C is 1M sodium chloride + 10mM ethylenediaminetetraacetic acid + 100mM tris(hydroxymethyl)aminomethane hydrochloride, pH = 7.5.

[0161] It should be noted that the present application does not have any particular limitation on the exogenous plasmid and the purification method of the exogenous plasmid. The above exogenous plasmid and the purification method of the exogenous plasmid are only a specific example. In other words, as long as the excipient provided by the present invention can achieve the delivery effect of the present invention when delivering the exogenous plasmid or delivering the purified exogenous plasmid, the delivery effect is to increase the transfection range of the plasmid DNA. Increase the protein expression of the target gene .

[0162] 3. The preparation of the purified pVAX-Ova plasmid DNA encoding the ovalbumin gene sequence involved in the embodiments or application examples is as follows:

[0163] The construction method of plasmid pVAX-Ova is as follows: the DNA sequence of ovalbumin (NCBI Accession: NP990483.2) was obtained from NCBI, and the sequence was optimized using the GenSmart. online codon optimization tool. The target host was mouse, and possible functional elements (GGTAGG and AATAAA) were avoided. The optimized sequence was fully synthesized and constructed in the pVAX-CAG vector by XhoI+PmeI. Among them, the primers were ova-F: GAATTGTTTAGTGAACCGTCAGACTCGAGGCCACCATGGGCAGCATCGGCGCCGCTAGC (Sequence No. 5); ova-R: CTCCTCGACGTCACCGCATGTTAGCAGACTTCCTCTGCCCTCAGGGCTCACGCACCTTCCGAAGAAC (Sequence No. 6).

[0164] The purification method of plasmid pVAX-Ova is the same as the purification method of pVAX-luci-tdT plasmid DNA described above.

[0165] It should be noted that the present application does not have any particular limitation on the exogenous plasmid and the purification method of the exogenous plasmid. The above exogenous plasmid and the purification method of the exogenous plasmid are only a specific example. In other words, as long as the excipient provided by the present invention can achieve the delivery effect of the present invention when delivering the exogenous plasmid or delivering the purified exogenous plasmid, the delivery effect is to increase the transfection range of the plasmid DNA. Increase the protein expression of the target gene.

[0166] 4. The protein immunoblot (Western Blot) detection method, in vitro luciferase activity detection method, immunofluorescence detection method, enzyme-linked immunosorbent (ELISA) experimental method and enzyme-linked immunosorbent spot (ELISPOT) experimental method involved in the embodiments or application examples are specifically as follows:

[0167] 4.1. Western Blot Detection Method:

[0168] (1) Isolation of the tibialis anterior muscle: The experimental animals (in this application, the experimental animals are mice, rats or rabbits) injected with purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) are euthanized with carbon dioxide, the skin on the outside of the tibialis anterior muscle of the experimental animals is wiped clean with 75% ethanol, and the epidermis is torn off with tweezers, and dissecting forceps are inserted from the tendon below the tibialis anterior muscle, and slid up and down to separate the tibialis anterior muscle from the surrounding bones and muscles. Subsequently, ophthalmic scissors are used to cut the upper and lower tendons and isolate the tibialis anterior muscle.

[0169] (2) Preparation of homogenate: Add 400 μL of lysis solution to the tibialis anterior muscle obtained in step (1) and immerse it in a 1.5 mL centrifuge tube with a snap, and add 5 5 mm zirconium oxide crushing beads thereto. Then, place the centrifuge tube in a homogenizer and crush it for 2 min at a power of 8 W to obtain a homogenate, which is then placed on ice for later use.

[0170] (3) Preparation of lysate The homogenate was centrifuged at 12,000 × g and 4°C for 5 min, 250 μL of the supernatant was taken into a new centrifuge tube, and then centrifuged at 12,000 × g and 4°C for 5 min to obtain the supernatant, i.e., the lysate.

[0171] (4) Preparation of protein samples: 80 μL of the lysate obtained in step (3) was taken and added to 20 μL of 5x protein loading buffer, and the mixture was boiled at 98°C for 5 min to obtain a protein sample. Another 5 μL of the lysate was taken into a 96-well plate, 250 μL / well of Bradford reaction solution was added and incubated at room temperature for 5 min. The absorbance at 595 nm was read by a multifunctional microplate reader within 1 h, and converted to protein concentration using a standard curve.

[0172] (5) Vertical electrophoresis and membrane transfer: Take 10 μL of the protein sample and perform vertical electrophoresis using 10% SDS-PAGE gel. Then cut a 5 cm × 8 cm PVDF membrane and stack it in the order of sponge-filter paper-PVDF membrane-polyacrylamide gel-filter paper-sponge using a membrane transfer fixture. In an ice-free rapid membrane transfer solution, use a constant current of 0.4 A to transfer the protein in the protein sample from the vertical electrophoresis gel to the membrane to obtain a transferred PVDF membrane.

[0173] (6) Blocking: The transferred PVDF membrane was washed once with TBST, blocked in a 5% (w / v) skim milk powder solution for 30 min, and then washed three times with TBST. The 5% (w / v) skim milk powder solution was prepared by skim milk powder and TBST.

[0174] (7) Primary antibody incubation: Anti-FireflyLuciferase antibody was diluted at a volume ratio of 1:2000 between Anti-FireflyLuciferase antibody and universal antibody diluent to obtain Anti-FireflyLuciferase antibody solution. HRP-conjugated GAPDH Monoclonal antibody was diluted at a volume ratio of 1:2000 between HRP-conjugated GAPDH Monoclonal antibody and universal antibody diluent to obtain HRP-conjugated GAPDH Monoclonal antibody solution. Then, the Anti-Firefly Luciferase antibody solution and the HRP-conjugated GAPDH Monoclonal antibody solution were mixed to obtain a mixed solution, and the PVDF membrane obtained in step (3) was incubated in the mixed solution at 4°C overnight.

[0175] (8) Rinse: After overnight incubation, rinse the PVDF membrane three times with TBST buffer, each time for more than 5 min.

[0176] (9) Secondary antibody incubation: Goat anti-rabbit IgG H&L (HRP) was diluted with 5% (w / v) skim milk powder solution at a volume ratio of 1:20,000 to obtain a secondary antibody solution. The rinsed PVDF membrane was then incubated in the secondary antibody solution at room temperature for 1 h.

[0177] (10) Rinse: After incubation for 1 h, rinse the PVDF membrane three times with TBST buffer, each time for more than 5 min.

[0178] (11) Chemiluminescence detection: using SuperSignal TM West Pico PLUS chemiluminescent substrate was used to prepare the chemiluminescent substrate. The chemiluminescent substrate was covered on the PVDF membrane and incubated at room temperature for 3 minutes. The chemiluminescent image of the incubated PVDF membrane was then collected using a mini chemiluminescent imager to obtain an immunoblot image.

[0179] (12) Image processing: Use ImageJ software to scan the grayscale value of the corresponding band in the immunoblot image, and the obtained value is normalized using the concentration measured by BCA to obtain the relative expression level of luciferase.

[0180] 4.2. In vitro luciferase activity detection method:

[0181] (1) Isolation of the tibialis anterior muscle: The experimental animal (in this application, the experimental animal is a mouse) injected with a pVAX-luci-tdT plasmid DNA solution encoding the luciferase / red fluorescent protein gene sequence was euthanized with carbon dioxide, the skin on the outside of the tibialis anterior muscle of the experimental animal was wiped clean with 75% ethanol, and the epidermis was torn off with tweezers, and dissecting forceps were inserted from the tendon below the tibialis anterior muscle, and slid up and down to separate the tibialis anterior muscle from the surrounding bones and muscles. Subsequently, ophthalmic scissors were used to cut the upper and lower tendons and isolate the tibialis anterior muscle.

[0182] (2) Preparation of homogenate: Add 400 μL of lysis solution to the tibialis anterior muscle obtained in step (1) and immerse it in a 1.5 mL centrifuge tube with a snap, and add 5 5 mm zirconium oxide crushing beads thereto. Then, place the centrifuge tube in a homogenizer and crush it for 2 min at a power of 8 W to obtain a homogenate, which is then placed on ice for later use.

[0183] (3) Preparation of lysate The homogenate was centrifuged at 12,000 × g and 4°C for 5 min, 250 μL of the supernatant was taken into a new centrifuge tube, and then centrifuged at 12,000 × g and 4°C for 5 min to obtain the supernatant, i.e., the lysate.

[0184] (4) Pipette One-Lite luciferase Assay at 100 μL / well into a black-bottom 96-well plate, then add 2 μL of the cleavage product obtained in step (4) and incubate at room temperature for 5 min. Within 1 h, collect the bioluminescence in the 400-600 nm band using a multifunctional microplate reader with an integration time of 1 s to obtain the in vitro luciferase signal value, which is used to evaluate the activity level of luciferase in the experimental animal.

[0185] 4.3. Immunofluorescence detection method:

[0186] (1) When the tissue sample is a tibialis anterior muscle sample: The experimental animal (in this application, the experimental animal is a mouse, rat or rabbit) injected with a pVAX-luci-tdT plasmid DNA solution encoding the gene sequence of luciferase / red fluorescent protein is euthanized with carbon dioxide. Then, the skin on the outside of the tibialis anterior muscle is wiped clean with 75% ethanol, and the epidermis is torn off with tweezers. Use dissecting forceps to insert from the tendon below the tibialis anterior muscle, and slide up and down to separate the tibialis anterior muscle from the surrounding bones and muscles. Then use ophthalmic scissors to cut the upper and lower tendons and isolate the tibialis anterior muscle. The isolated tibialis anterior muscle is immersed in universal GD muscle fixative (the tibialis anterior muscle of the mouse is immersed in 2mL of universal GD muscle fixative, the tibialis anterior muscle of the rat is immersed in universal GD muscle fixative, and the tibialis anterior muscle of the rabbit is immersed in 50mL of universal GD muscle fixative) and fixed overnight at 4°C.

[0187] Or when the tissue sample is a skin sample: the experimental animal (in this application, the experimental animal is a mouse, rat or rabbit) injected with the pVAX-luci-tdT plasmid DNA solution encoding both the gene sequences of luciferase and red fluorescent protein is euthanized with carbon dioxide. Then, the skin at the injection site is cleaned with 75% ethanol, and the skin at the injection site is cut with scissors, spread flat in a 6-well plate, and 2 mL of universal GD muscle fixative is added to immerse it, and fixed overnight at 4°C.

[0188] (2) Remove the fixative and rinse the tibialis anterior muscle sample / skin sample obtained in step (1) with 3 mL of PBS for 5 min, 3 times. Prepare a 10 wt% sucrose solution using PBS (1x). Discard the PBS (1x) in the rinsed tibialis anterior muscle sample / skin sample and replace it with the 10 wt% sucrose solution, and wait for the tibialis anterior muscle sample / skin sample to sink to the bottom.

[0189] (3) Use absorbent paper to absorb moisture from the surface of the tibialis anterior muscle sample / skin sample, place it in a plastic mold of appropriate size, use OCT to completely immerse the tibialis anterior muscle sample / skin sample for coating, and then place it at -20°C until the OCT is completely solidified.

[0190] (4) Use a cryostat to slice the tibialis anterior muscle sample / skin sample into 10 μm thick slices.

[0191] The tibialis anterior muscle slices / skin slices were then attached to glass slides and dried at room temperature.

[0192] (5) The air-dried samples were briefly rehydrated in PBS (1x) and mounted with a mounting medium containing DAPI. Immunofluorescence images of the tibialis anterior muscle sections / skin sections were collected using a VS200 slide scanner.

[0193] 4.4. Enzyme-linked immunosorbent assay (ELISA)

[0194] (1) Using antigen coating solution, ovalbumin (contained in PBS) with a concentration of 100 mg / mL was diluted to a concentration of 10 μg / mL and added to the ELISA assay plate at a volume of 100 μL / well for overnight coating at 4°C;

[0195] (2) The next day, remove the coating solution, rinse with PBST 2-3 times, add 200 μL of blocking solution, block at 37°C for 2 h, and then rinse with PBST 3 times to remove any residual liquid;

[0196] (3) The serum sample was diluted 3-fold with a ratio of blocking solution to serum sample = 1:1000 as the starting point, and 6 dilutions were made. The dilution end point was 1 / (2.43×10 5 ). The diluted serum samples were transferred to the coated ELISA assay plate, 100 μL per well, and incubated at 37°C for 1 hour; the samples were discarded and washed with PBST 3-5 times;

[0197] (4) Adding secondary antibody (Goat-anti-moust IgG, IgG1, IgG2a), diluting the secondary antibody at a ratio of secondary antibody: antibody diluent = 1:20000, and adding the diluted secondary antibody to the ELISA assay plate washed with the PBST in step (3), 100 μL per well, incubating at 37° C. for 1 hour; discarding the secondary antibody, and washing with the PBST for 3-5 times;

[0198] (5) Add 100 μL of a single component to each well of the ELISA assay plate washed with the PBST in step (4) for color development. After color development reaches an appropriate depth, add 50 μL of a stop solution to each well for termination. Use an ELISA reader to read the OD450 absorbance, wherein twice the OD of the blank immunization group is taken as the critical value. The highest dilution above the critical value is considered to be the antibody titer, which refers to the concentration of the antibody in the serum, and is used to indicate the strength of the antibody's ability to bind to the antigen. The higher the titer, the greater the antibody concentration and the stronger the ability to bind to the antigen.

[0199] 4.5. ELISPOT assay:

[0200] (1) Add 1.5 mL / well of 0°C 1% P / S lymphocyte separation solution to a 24-well plate, place on ice, and transfer the spleen sample. Use a 5 / 10 mL syringe piston to grind the spleen until the grinding liquid becomes dark red and turbid to obtain a grinding suspension. Filter the grinding suspension through a flow tube; transfer the filtered grinding suspension to a 2 mL centrifuge tube, add 0.3 mL of RPMI-1640 to each tube, and centrifuge at 800 g and 4°C for 30 min to obtain a lymphocyte layer.

[0201] (2) Aspirate the lymphocyte layer and transfer to a new 15 mL centrifuge tube. Add 10 mL of RPMI1640 Medium containing 1% P / S to each tube. Centrifuge at 200 g and 4°C for 10 min. Discard the supernatant to obtain the cell pellet.

[0202] (3) Resuspend the cell pellet with 0.6 mL of serum-free lymphocyte culture medium. Dilute 100 times and place in a 96-well plate, 0.1 mL per well. Add an equal amount of 0.4% trypan blue dye. Use a BioRad automatic cell counter to count and calculate the cell concentration. Dilute the cells to 5×106 / mL with serum-free lymphocyte culture medium according to the cell concentration, take 200 μL and place in a 96-well plate for use, and plate 50 μL per well using a plate gun (250,000 cells).

[0203] (4) Take 200 μL of medium containing peptide library stimulator at a concentration of 0.2 mg / mL and place in a 96-well plate for later use. Experimental wells (+): Add the cells obtained in step (3) to the wells containing the medium at a rate of 50 μL per well using a pipette and incubate at 37°C for 20 hours.

[0204] (5) Pour the cells and culture medium in the wells, add 0℃ deionized water, 200μL / well, and place at 4℃ for 10min to lyse the cells; use the colorimetric reaction reagent in the ELISA kit for color development, specifically, use 1xWashingBuffer working solution 250μL / well, leave for 1min and then discard the liquid in the well, repeat 3-6 times; add 1xBiotinylatedAntibody working solution to each experimental well, 100μL / well. Incubate at 37C for 1 hour; use 1xWashingBuffer working solution 250μL / well, leave for 1min and then discard the liquid in the well, then use 1xWashing Buffer working solution 250μL / well, leave for 1min and then discard the liquid in the well, repeat 3-6 times; add 1xStreptavidin-HRP working solution to each experimental well, 100μL / well. Incubate at 37℃ for 1h; add AEC colorimetric solution at 100μL / well, and stand at room temperature in the dark for 30min. Choose the end time of colorimetric development according to the spot formation. If the room temperature is lower than 20℃, it is recommended to develop the color in a 37℃ incubator and check every 5-10min. Use ELISPOT plate reader to read the spots.

[0205] Example 1: Screening of the final concentrations of plasmid DNA and amino acids in the solution of amino acid-plasmid DNA (intramuscular injection in mice)

[0206] (1) Preparation of L-glutamic acid-plasmid DNA solutions of different concentrations: The purified pVAX-luci-tdT plasmid DNA (the plasmid DNA simultaneously encodes the luciferase gene sequence and the red fluorescent protein gene sequence) was mixed with PBS (1x) to obtain a mixed solution of L-glutamic acid-plasmid, wherein the final concentration of the plasmid DNA was 0.05 μg / μL, 0.1 μg / μL or 0.5 μg / μL, and the final concentration of L-glutamic acid in the solution was 300 mM. 50 μL of the above plasmid DNA was drawn using an insulin needle and injected intramuscularly into the tibialis anterior muscle of BalB / C mice (the mice were purchased from Vital River Company), with 6 mice in each group. On the third day after the injection, D-luciferin potassium salt was injected into the mouse abdominal cavity at an injection volume of 150 mg per kg of mouse, and then live imaging was performed using a live imaging instrument, and the live imaging signal value of luciferase in the mouse was collected.

[0207] (2) After collecting the in vivo imaging signal value in step (1), each group of mice is tested according to an in vitro luciferase activity detection method to obtain an in vitro luciferase signal value to evaluate the activity level of luciferase in the mouse.

[0208] (3) After collecting the in vivo imaging signal values ​​in step (1), the mice in each group were tested by western blot detection to obtain the relative expression level of luciferase.

[0209] (4) The in vivo imaging signal value obtained in step (1), the in vitro luciferase signal value obtained in step (2), and the relative expression level of luciferase obtained in step (3) are correlated and statistically analyzed. The result is as follows: Figure 1 shown.

[0210] like Figure 1 As shown, Figure 1 The correlation statistical results of the in vivo imaging signal value of luciferase in mice, the in vitro luciferase signal value, and the relative expression of luciferase are shown in the figure for mice injected with different concentrations of L-glutamate-plasmid DNA solution. The results show that the in vivo imaging signal value, the in vitro luciferase signal value, and the relative expression of luciferase have a good linear relationship. The values ​​obtained by the in vivo imaging method can better measure the expression of total protein and thus screen out compounds and their working concentrations that have the ability to enhance the in vivo delivery efficiency of plasmid DNA.

[0211] Example 2: Effect of amino acid solution as excipient on the expression level of exogenous protein (intramuscular injection in mice)

[0212] Preparation of an amino acid-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acids and PBS (1x) to obtain an amino acid-plasmid mixed solution, wherein the final concentration of the amino acid in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.05 ug / uL; wherein the amino acid is specifically glycine, γ-aminobutyric acid, L-histidine, L-cysteine, L-glutamine, L-lysine, L-arginine, L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine or L-isoleucine.

[0213] Preparation of amino acid derivative-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acid derivatives and PBS (1x) to obtain an amino acid derivative-plasmid mixed solution. The final concentration of the amino acid derivative in the solution is 300mM, and the final concentration of the plasmid DNA is 0.05ug / uL; the amino acid derivative is specifically: histamine, homoserine or ectoine.

[0214] Preparation of polyglutamic acid-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), polyglutamic acid and PBS (1x) to obtain a polyglutamic acid-plasmid mixed solution. Wherein, based on the equivalent monomer concentration of polyglutamic acid, the final concentration of polyglutamic acid in the solution is 300mM, and the final concentration of plasmid DNA is 0.05ug / uL. Wherein, the calculation method of equivalent monomer is: when preparing a 300mM glutamic acid-plasmid mixed solution, each L of the mixed solution contains 44.139g of glutamic acid, therefore, a 300mM polyglutamic acid-plasmid mixed solution is prepared with 44.139g of polyglutamic acid per L of the mixed solution.

[0215] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.05 ug / uL to obtain a PBS-plasmid DNA solution.

[0216] Preparation of physiological saline-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in physiological saline to a final concentration of 0.05 ug / uL to obtain a physiological saline-plasmid DNA solution.

[0217] (2) Amino acid group: Use a 31G insulin needle to draw each amino acid-plasmid DNA solution obtained in step (1). Inject 50uL per muscle into the tibialis anterior muscle of the corresponding BalB / C mice (the mice were purchased from Vital River Company) (each solution was injected into 3 mice).

[0218] Amino acid derivative group: The difference from the amino acid group is that a solution of amino acid derivative-plasmid DNA was injected.

[0219] Polyglutamic acid group: The difference from the amino acid group is that a polyglutamic acid-plasmid DNA solution was injected.

[0220] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution was injected.

[0221] The physiological saline group was different from the amino acid group in that a physiological saline-plasmid DNA solution was injected.

[0222] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0223] (3) On the third day after the injection, D-luciferin potassium salt was injected into the mouse peritoneum at a dose of 150 mg per kg of mouse, and then live imaging was performed using a live imaging device, and the live imaging signal value of luciferase in the mouse body was collected. Then, the mice in each group after collecting the live imaging signal value were detected according to the protein immunoblotting detection method to obtain the relative expression of luciferase, and then the relative expression of luciferase in the amino acid group, polyglutamic acid group, saline group and electroporation group was calculated relative to the PBS group. The results are as follows: Figure 2 shown.

[0224] like Figure 2 As shown, Figure 2 is the relative expression of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, saline group and electroporation group relative to the PBS group, wherein, Figure 2 The vertical axis in the figure is the multiple of the expression level relative to the PBS group, that is, the multiple of the relative expression level of luciferase relative to the PBS group. Figure 2 There was no significant difference in the amino acids marked with circles (among which, the amino acids marked with circles are glycine, γ-aminobutyric acid or L-histidine) and the amino acid derivative: histamine compared with the PBS group.

[0225] Figure 2 The amino acids marked with triangle dots (wherein the amino acids marked with triangle dots are L-cysteine, L-glutamine, L-lysine or L-arginine) show significant inhibition,

[0226] Figure 2 The amino acids or amino acid derivatives marked with diamond dots (wherein, the amino acids marked with diamond dots are L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine or L-isoleucine, and the amino acid derivatives marked with diamond dots are ectoine or homoserine) or polyglutamic acid are shown to significantly promote the expression of total protein, which also indicates that the amino acids, amino acid derivatives or polyglutamic acid marked with diamond dots in the figure significantly promote the effectiveness of vector transfection.

[0227] Example 3: Effect of Amino Acid Solution as Excipient on Plasmid DNA Transfection in Vivo (Intramuscular Injection in Mice)

[0228] It should be noted that, in addition to the relative expression level of luciferase (total protein expression level) indicator in Example 2, the number of cells successfully transfected in vivo is also an important indicator for evaluating whether amino acids or amino acid polymers are suitable as excipients. Therefore, the amino acid group (wherein the amino acid is D-histidine, L-alanine, or L-glutamic acid) that significantly promotes luciferase expression (total protein expression) in Example 3, the amino acid derivative group (wherein the amino acid derivative is ectoine or homoserine) and the polyglutamate group are selected, and the number of cells successfully transfected in vivo using the above-mentioned amino acids or amino acid polymers as excipients is further detected according to the immunofluorescence detection method, and this is used as an indicator for a second screening.

[0229] In addition, the glycine group that did not significantly promote luciferase expression (total protein expression) in Example 3 was selected, and the number of cells transfected with the glycine as an excipient was further detected according to the immunofluorescence detection method.

[0230] The amino acid group (wherein the amino acid is glycine, D-histidine, L-alanine or L-glutamic acid), the amino acid derivative group (wherein the amino acid derivative is ectoine or homoserine), the polyglutamate group of mice, the PBS group of mice and the electroporation group of mice obtained in step (3) of Example 2 after collecting the in vivo imaging signal value were used to collect immunofluorescence images of mouse tibialis anterior muscle slices according to the immunofluorescence detection method. The results are as follows Figure 3 shown.

[0231] like Figure 3 As shown, Figure 3 The immunofluorescence images of the tibialis anterior muscle sections of mice in the amino acid group (wherein the amino acid is glycine, D-histidine, L-alanine, or L-glutamic acid), the amino acid derivative group (wherein the amino acid derivative is ectoine or homoserine), the polyglutamic acid group, the PBS group, and the electroporation group. The results showed that sporadic positive cells were seen in the tibialis anterior muscle sections of mice in the PBS group, and a large number of positive cells were shown in the tibialis anterior muscle sections of mice injected with the solution of amino acid-plasmid DNA (wherein the amino acid is D-histidine, L-alanine or L-glutamic acid), the solution of amino acid derivative-plasmid DNA (wherein the amino acid derivative is ectoine or homoserine), and the solution of polyglutamic acid-plasmid DNA, that is, a large number of cells were successfully transfected in vivo, and at the same time, no significant tissue damage and immune infiltration were caused. The number of positive cells in the tibialis anterior muscle sections of mice injected with the glycine-plasmid DNA solution was close to that in PBS.

[0232] Example 4: Effect of L-glutamic acid solution as an excipient in promoting plasmid DNA transfection in vivo, compared with electroporation technology (muscular injection in mice)

[0233] (1) Preparation of L-glutamic acid-plasmid DNA solution: Purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamic acid and PBS (1x) were mixed to obtain an L-glutamic acid-plasmid solution, wherein the final concentration of L-glutamic acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL.

[0234] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0235] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was aspirated using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of corresponding BalB / C mice (the mice were purchased from Vital River Company) at an injection volume of 50 uL per muscle (6 mice were injected).

[0236] PBS group: The PBS-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of corresponding BalB / C mice (the mice were purchased from Vital River Company) at an injection volume of 50ul per muscle (6 mice were injected).

[0237] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0238] (3) D-luciferin potassium salt was injected into the peritoneal cavity of each group of mice at a dose of 150 mg per kg of mouse on the 1st, 3rd, 7th, 11th, 15th and 30th day after injection. Then, in vivo imaging was performed using an in vivo imaging device, and the in vivo imaging signal value of luciferase in the mice was collected. The results are as follows: Figure 4 shown.

[0239] (4) All mouse tibialis anterior muscle samples (n=6) obtained in step (3) on the 30th day after injection were fixed in a fixative overnight. Then, they were transferred to PBS and rinsed three times. The rinsed tissue was collected using a stereo fluorescence microscope to collect red fluorescence signals for stereo fluorescence imaging, and a stereo fluorescence imaging image was obtained. The results are shown in FIG. Figure 5 shown.

[0240] (5) Collect immunofluorescence images of mouse tibialis anterior muscle slices from all mice after collecting the in vivo imaging signal values ​​obtained in step (3) according to the immunofluorescence detection method, and count the number of myofilaments of the mouse tibialis anterior muscle according to the immunofluorescence images. The results are as follows: Figure 6 As shown. And the average fluorescence intensity of mouse tibialis anterior muscle slices was calculated. The results are shown Figure 7 shown.

[0241] (6) The immunoblotting detection method was used to detect all the mice on the 30th day after injection obtained in step (3) to obtain an immunoblot image. The result is as follows: Figure 8 shown.

[0242] like Figure 4 As shown, Figure 4 The values ​​are the in vivo imaging signals of luciferase in mice on the 1st, 3rd, 7th, 11th, 15th and 30th day after injection. The results showed that the L-glutamate group showed several times the protein expression level of the PBS group for up to 30 days.

[0243] like Figure 5 As shown, Figure 5 This is a stereofluorescence microscope image of the mouse tibialis anterior muscle on day 30 after injection. The results show that L-glutamate can effectively promote the transfection of plasmid DNA in vivo, and the number of positive myofilaments increases significantly. Among them, positive myofilaments represent the successful expression of luciferase in the mouse tibialis anterior muscle.

[0244] like Figure 6 As shown, Figure 6 The quantitative results of the number of myofilaments marked on the muscle slices of the mouse tibialis anterior muscle on the 30th day after injection. In the figure, PBS is represented by the PBS group, electroporation is represented by the electroporation group, and glutamate is represented by the L-glutamate group. The results showed that the L-glutamate group greatly increased the number of positive myofilaments, with an average of 582 myofilaments / slice, among which the positive myofilaments represent the successful expression of luciferase in the mouse tibialis anterior muscle.

[0245] like Figure 7 As shown, Figure 7 The quantitative results of the mean fluorescence intensity of the mouse tibialis anterior muscle slices on the 30th day after injection. In the figure, PBS is represented as the PBS group, electroporation is represented as the electroporation group, and glutamate is represented as the L-glutamate group. The results show that the L-glutamate group can effectively increase the fluorescent protein signal, and the intensity is not weaker than the electroporation technology.

[0246] like Figure 8 As shown, Figure 8This is an immunoblot of mouse tibialis anterior muscle tissue. In the figure, PBS is represented as the PBS group, electroporation is represented as the electroporation group, and L-glutamate is represented as the L-glutamate group. The results show that the expression level of luciferase in the L-glutamate group is significantly higher than that in the PBS group. Therefore, L-glutamate as an excipient can stably increase the expression level of exogenous proteins.

[0247] Example 5: Effects of different concentrations of amino acid solutions or amino acid mixture solutions as excipients on the in vivo transfection effect of plasmid DNA (muscular injection in mice)

[0248] Prepare a 3mM L-glutamate-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) to obtain a 3mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 3mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0249] Prepare a 30mM L-glutamate-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) to obtain a 30mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 30mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0250] Prepare a 300mM L-glutamate-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate and PBS (1x) to obtain a 300mM L-glutamate-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 300mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0251] Prepare a 150mM L-glutamate-150mM ectoine-plasmid DNA solution: mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, ectoine and PBS (1x) to obtain a 150mM L-glutamate-150mM ectoine-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 150mM, the final concentration of ectoine in the solution is 150mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0252] Prepare a 150mM L-glutamate-150mM L-leucine-plasmid DNA solution: mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, L-leucine and PBS (1x) to obtain a 150mM L-glutamate-150mM L-leucine-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 150mM, the final concentration of L-leucine in the solution is 150mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0253] Prepare a 150mM L-glutamate-150mM glycine-plasmid DNA solution: mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamate, glycine and PBS (1x) to obtain a 150mM L-glutamate-150mM glycine-plasmid DNA solution, wherein the final concentration of L-glutamate in the solution is 150mM, the final concentration of glycine in the solution is 150mM, and the final concentration of the plasmid DNA is 0.1ug / uL.

[0254] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0255] (2) 3 mM L-glutamate group: Use a 31G insulin needle to draw up the 3 mM L-glutamate-plasmid DNA solution obtained in step (1), and inject it intramuscularly into the tibialis anterior muscle of the corresponding BalB / C mice (the mice were purchased from Vital River Company) at an injection volume of 50 uL per muscle (6 mice were injected).

[0256] 30 mM L-glutamate group: The difference from the 3 mM L-glutamate group is that the 30 mM L-glutamate-plasmid DNA solution obtained in step (1) was injected.

[0257] 300 mM L-glutamate group: The difference from the 3 mM L-glutamate group is that the 300 mM L-glutamate-plasmid DNA solution obtained in step (1) was injected.

[0258] 150 mM L-glutamate-150 mM ectoine group: The difference from the 3 mM L-glutamate group is that the 150 mM L-glutamate-150 mM ectoine-plasmid DNA solution obtained in step (1) was injected.

[0259] 150 mM L-glutamic acid-150 mM L-leucine group: The difference from the 3 mM L-glutamic acid group is that the 150 mM L-glutamic acid-150 mM L-leucine-plasmid DNA solution obtained in step (1) was injected.

[0260] 150 mM L-glutamic acid-150 mM glycine group: The difference from the 3 mM L-glutamic acid group is that the 150 mM L-glutamic acid-150 mM glycine-plasmid DNA solution obtained in step (1) was injected.

[0261] PBS group: The difference from the 3 mM L-glutamate group is that the PBS-plasmid DNA solution obtained in step (1) was injected.

[0262] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0263] (3) On the third day after injection, D-luciferin potassium salt was injected into the mouse peritoneum at a dose of 150 mg per kg of mouse. Then, in vivo imaging was performed using an in vivo imaging device, and the in vivo imaging signal value of luciferase in the mouse was collected. The results are shown in FIG. Fig. 9 shown.

[0264] like Fig. 9 As shown, Fig. 9 It is a detection result graph of the in vivo imaging signal value, wherein PBS is represented as the PBS group, electroporation is represented as the electroporation group, 3mM glutamate is represented as the 3mM L-glutamate group, 30mM glutamate is represented as the 30mM L-glutamate group, 300mM glutamate is represented as the 300mM L-glutamate group, Glutamate / ectoine is represented as the 150mM L-glutamate-150mM ectoine group, Glutamate / leucine is represented as the 150mM L-glutamate-150mM L-leucine group, and Glutamate / glycine is represented as the 150mM L-glutamate-150mM glycine group.

[0265] It can be seen that in the L-glutamate-plasmid DNA solution, as the final concentration of L-glutamate increases, the in vivo imaging signal value also increases, that is, the in vivo transfection effect of plasmid DNA is enhanced relative to the PBS group. At the same time, the mixture of L-glutamate and ectoine, and the mixture of L-glutamate and L-leucine as excipients have a gain effect.

[0266] Example 6: Effect of amino acid solution as excipient on the expression level of exogenous protein (skin injection in mice)

[0267] (1) Preparation of amino acid-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acids and PBS (1x) to obtain an amino acid-plasmid mixed solution, wherein the final concentration of the amino acid in the solution is 300mM, and the final concentration of the plasmid DNA is 0.1ug / uL, wherein the amino acid is specifically: L-proline, L-valine, L-lysine, glycine, L-serine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, L-threonine or L-arginine. Preparation of amino acid derivative-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), amino acid derivatives and PBS (1x) to obtain an amino acid derivative-plasmid mixed solution. The final concentration of the amino acid derivative in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL; the amino acid derivative is specifically homoserine or ectoine.

[0268] Preparation of polyglutamic acid-plasmid DNA solution: Purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), polyglutamic acid and PBS (1x) are mixed to obtain a polyglutamic acid-plasmid mixed solution, wherein the final concentration of polyglutamic acid in the solution is 300 mM based on the equivalent monomer concentration of polyglutamic acid, and the final concentration of plasmid DNA is 0.1 ug / uL.

[0269] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0270] (2) Amino acid group: Each amino acid-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the skin of BalB / C mice (the mice were purchased from Vital River Company) at a volume of 20ul per injection site, with 3 mice per group and 2 sites per mouse.

[0271] Amino acid derivative group: The difference from the amino acid group is that a solution of amino acid derivative-plasmid DNA was injected.

[0272] Polyglutamic acid group: The difference from the amino acid group is that a polyglutamic acid-plasmid DNA solution was injected.

[0273] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution was injected.

[0274] (3) On the third day after the injection, D-luciferin potassium salt was injected into the mouse peritoneum at a dose of 150 mg per kg of mouse, and then in vivo imaging was performed using a live imaging device, and the in vivo imaging signal value of luciferase in the mouse body was collected. Then, each group of mice after collecting the live imaging signal value was detected according to the protein immunoblotting detection method to obtain the relative expression level of luciferase. Then, the relative expression level of luciferase in the amino acid group, amino acid derivative group, polyglutamic acid group, and PBS group was calculated based on the PBS group. The results are as follows: Fig.10 shown.

[0275] like Fig.10 As shown, Fig.10 is the relative expression of luciferase in the amino acid group, amino acid derivative group, and polyglutamic acid group relative to the PBS group, wherein, Fig.10 The vertical axis in the figure is the multiple of the expression level relative to the PBS group, that is, the multiple of the relative expression level of luciferase relative to the PBS group. The results showed that L-proline, L-valine, L-lysine, homoserine, L-serine, and glycine had no significant difference compared with the PBS group, and did not promote the expression of total protein. L-threonine and L-arginine showed obvious inhibitory effects, and D-histidine, L-leucine, polyglutamic acid, L-glutamic acid, ectoine and L-glutamine had significant differences compared with the PBS group, and promoted the expression of total protein.

[0276] Example 7: Effect of Amino Acid Solution as Excipient on Plasmid DNA Transfection in Vivo (Skin Injection in Mice)

[0277] The amino acid group mice (wherein the amino acid is glycine, L-glutamic acid or L-glutamine), the amino acid derivative group (wherein the amino acid derivative is ectoine), the polyglutamic acid group mice, and the PBS group mice after collecting the in vivo imaging signal value obtained in step (3) of Example 6 were subjected to immunofluorescence detection method to collect immunofluorescence images of mouse skin sections. The results are as follows: Fig.11 shown.

[0278] like Fig.11 As shown, Fig.11 These are immunofluorescence images of skin sections of mice in the amino acid group (wherein the amino acid is glycine, ectoine, L-glutamic acid or L-glutamine), the amino acid derivative group (wherein the amino acid derivative is ectoine), the polyglutamic acid group, and the PBS group. The results show that compared with the PBS control group, the L-glutamic acid group, the L-glutamine group, the ectoine group, and the polyglutamic acid group can transfect more cells through skin injection.

[0279] Example 8: Effect of L-glutamic acid solution as excipient on the in vivo transfection effect of plasmid DNA (muscular injection in rats)

[0280] (1) Preparation of L-glutamic acid-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamic acid and PBS (1x) were mixed to obtain an L-glutamic acid-plasmid mixed solution, wherein the final concentration of L-glutamic acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL.

[0281] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0282] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of corresponding rats (the rats were purchased from Vital River) at an injection volume of 200 uL per muscle (6 rats were injected).

[0283] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution was injected.

[0284] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0285] (3) On the third day after injection, D-luciferin potassium salt was injected into the rat peritoneum at a dose of 150 mg per kg of rat, and then in vivo imaging was performed using an in vivo imaging device, and the in vivo imaging signal value of luciferase in the mouse was collected. The results are shown in FIG. Fig.12 shown.

[0286] (4) The L-glutamate group, PBS group and electroporation group rats after collecting the in vivo imaging signal values ​​obtained in step (3) were subjected to immunofluorescence detection methods to collect immunofluorescence images of rat tibialis anterior muscle slices. The results are as follows: Fig.13 shown.

[0287] like Fig.12 and 13 As shown, Fig.12 This is a graph showing the results of in vivo imaging signal value detection in rats in the L-glutamate group, PBS group and electroporation group. In the graph, glutamate is represented as L-glutamate. Fig.13 The immunofluorescence images of the tibialis anterior muscle slices of rats in the L-glutamate group, PBS group and electroporation group, in which glutamate is represented by L-glutamate. The results show that L-glutamate can significantly increase the muscle transfection range of rats.

[0288] Example 9: Effect of L-glutamic acid solution or ectoine solution as excipient on the in vivo transfection effect of plasmid DNA (muscular injection in rabbits)

[0289] (1) Preparation of L-glutamic acid-plasmid DNA solution: The purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), L-glutamic acid and PBS (1x) were mixed to obtain an L-glutamic acid-plasmid mixed solution, wherein the final concentration of L-glutamic acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL.

[0290] Preparation of ectoine-plasmid DNA solution: Mix the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence), ectoine and PBS (1x) to obtain an ectoine-plasmid mixed solution, wherein the final concentration of ectoine in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL.

[0291] Preparation of PBS-plasmid DNA solution: Dissolve the purified pVAX-luci-tdT plasmid DNA (the plasmid DNA encodes both the luciferase gene sequence and the red fluorescent protein gene sequence) in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0292] (2) L-glutamate group: The L-glutamate-plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of corresponding rabbits (the rabbits were purchased from Vital River) at an injection volume of 1 mL per muscle (3 rabbits were injected).

[0293] Ectoine group: The difference from the L-glutamate group is that an ectoine-plasmid DNA solution was injected.

[0294] PBS group: The difference from the amino acid group is that PBS-plasmid DNA solution was injected.

[0295] (3) The rabbits in the L-glutamate group, the ectoine group, and the PBS group obtained in step (2) were subjected to immunofluorescence detection, and immunofluorescence images of rabbit tibialis anterior muscle slices were collected. The results were as follows: Fig.14 shown.

[0296] like Fig.14 As shown, Fig.14 The immunofluorescence images of rabbit tibialis anterior muscle slices in the L-glutamate group, ectoine group, and PBS group, in which glutamate is represented by L-glutamate. The results show that L-glutamate and ectoine can significantly increase the muscle transfection range of rabbits.

[0297] Application Example 1: Amino Acid Solution as Excipient for the Immune Effect of Ovalbumin DNA Vaccine in vivo (Muscular Injection in Mice)

[0298] like Fig.15 As shown, Fig.15 The upper part of the figure is a flowchart of immune sequence sample collection. Fig.15 The lower part of the figure is a schematic diagram of the structure of the pVax-Ova plasmid encoding the immunogen gene sequence (ovalbumin gene sequence), that is, a schematic diagram of the structure of the ovalbumin DNA vaccine.

[0299] (1) pVAX-Ova immunization:

[0300] (1.1) Preparation of an amino acid-pVAX-Ova plasmid DNA solution: Mix the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence), amino acids and PBS (1x) to obtain an amino acid-plasmid mixed solution, wherein the final concentration of the amino acid in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL, wherein the amino acid is L-glutamic acid, L-leucine or D-histidine.

[0301] Preparation of an amino acid derivative-pVAX-Ova plasmid DNA solution: Mix the purified pVAX-Ova plasmid DNA encoding the immunogen gene sequence (ovalbumin gene sequence), amino acids and PBS (1x) to obtain an amino acid derivative-plasmid mixed solution, wherein the final concentration of the amino acid derivative in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL, wherein the amino acid derivative is tetrahydropyrimidine.

[0302] Preparation of PBS-plasmid pVAX-OvaDNA solution: Dissolve the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence) in PBS (1x) to a final concentration of 0.1 ug / ul to obtain a PBS-plasmid DNA solution.

[0303] (1.2) Amino acid group: The mice were given the first, second and third immunizations at 0, 2 and 4 weeks, respectively. The specific immunization method was as follows: the amino acid-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of the mice at an injection volume of 50 uL per muscle.

[0304] Amino acid derivative group: The difference from the amino acid group is that a solution of amino acid derivative-plasmid pVAX-OvaDNA was injected.

[0305] PBS group: The difference from the amino acid group is that a solution of PBS-plasmid pVAX-OvaDNA was injected.

[0306] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0307] Control group: injected with PBS only.

[0308] (2) Blank immunization: The difference from step (1) is that the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence) is replaced by the injection of pVAX-Ova plasmid DNA not encoding the immunogenic gene sequence, to obtain the corresponding amino acid group after blank immunization, amino acid derivative group after blank immunization, PBS group after blank immunization, and electroporation group after blank immunization.

[0309] (3) All mice immunized with pVAX-Ova and blank were killed by cervical dislocation at week 6, and spleen samples were collected by dissection and rinsed several times in PBS containing 2% P / S. They were temporarily stored in a 24-well plate containing PBS containing 2% P / S at 0°C and kept on ice for later use. The spleen samples were then measured by enzyme-linked immunosorbent assay (ELISPOT) to determine the number of IFN-γ-positive spleen cells that responded to the spike protein. The results were as follows: Fig.16 The statistical results are shown in Fig.17 shown.

[0310] (4) Blood samples were collected from the orbital vein of mice in each group immunized with pVAX-Ova and mice in each group immunized with blank at 2, 4, and 6 weeks (i.e., peripheral blood collection). The blood samples were allowed to stand at room temperature for 30 minutes, and then centrifuged at 1000 g for 30 minutes. The supernatant was taken as serum sample. The serum sample was then tested for OVA-specific antibody titer by enzyme-linked immunosorbent assay (ELISA). The results were as follows: Fig.18 shown.

[0311] like Fig.16 , 17 and Fig.18 As shown, Fig.16 This is a graph characterizing the number of IFN-γ-positive spleen cells in response to spike protein after intramuscular injection of mice in the amino acid group (wherein the amino acid is L-glutamic acid, ectoine, L-leucine or D-histidine), amino acid derivative group (wherein the amino acid derivative is ectoine), PBS group, electroporation group, control group, and blank immunized mice after pVAX-Ova immunization, Fig.16 In the figure, ovalbumin antigen stimulation is indicated as pVAX-Ova immunization, and the non-stimulated control is indicated as blank immunization. Fig.17 The figure shows the number of IFN-γ positive spleen cells in response to the spike protein after intramuscular injection of mice in the amino acid group (wherein the amino acid is L-glutamic acid, L-leucine or D-histidine), amino acid derivative group (wherein the amino acid derivative is ectoine), PBS group and electroporation group after immunization with pVAX-Ova. Fig.18The titer of OVA-specific antibodies injected intramuscularly in the amino acid group (wherein the amino acid is L-glutamic acid, L-leucine or D-histidine), the amino acid derivative group (wherein the amino acid derivative is ectoine), the PBS group and the electroporation group after immunization with pVAX-Ova is shown in FIG. Fig.18 The first dose refers to the first immunization, the second dose refers to the second immunization, and the third dose refers to the third immunization. The results showed that the amino acid group had better cellular and humoral immune response indicators.

[0312] Application Example 2: L-glutamic acid solution as an excipient for the in vivo immune effect of ovalbumin DNA vaccine (skin injection in mice)

[0313] (1) Preparation of L-glutamic acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogen OVA protein (ovalbumin), L-glutamic acid and PBS (1x) were mixed to obtain an L-glutamic acid-plasmid mixed solution, wherein the final concentration of L-glutamic acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL.

[0314] Preparation of PBS-plasmid pVAX-Ova plasmid DNA solution: Dissolve the purified pVAX-Ova plasmid DNA encoding the immunogen, namely the OVA protein gene sequence (ovalbumin gene sequence), in PBS (1x) to a final concentration of 0.1 ug / ul to obtain a PBS-plasmid DNA solution.

[0315] (2) L-glutamate group: At 0, 2, and 4 weeks, each amino acid-plasmid DNA solution obtained in step (1) was drawn using a 31G insulin needle and injected intradermally into BalB / C mice (the mice were purchased from Vital River Company) at an injection volume of 20uL per injection site, with 3 mice per group and 2 sites per mouse.

[0316] PBS group: The difference from the amino acid group is that a solution of PBS-plasmid pVAX-OvaDNA was injected.

[0317] (2) Blood samples were collected from mice in the pVAX-Ova immunization group and the blank immunization group through the orbital vein at weeks 2, 4, and 6, respectively. The blood samples were allowed to stand at room temperature for 30 minutes and then centrifuged at 1000 g for 30 minutes. The supernatant was taken as the serum sample. The serum sample was then measured for OVA-specific antibody titer by enzyme-linked immunosorbent assay (ELISA). The serum sample was diluted 2-fold starting from 1:1000, and the absorbance of each dilution was measured. The results are shown in Table 1. Fig.19 shown.

[0318] like Fig.19As shown, Fig.19 The results of OVA-specific antibody titer after skin injection of mice in the L-glutamate group and the PBS group are shown in the figure, where the ordinate represents the absorbance value at 450nm and the abscissa represents the dilution multiple of the OVA-specific antibody. The results show that L-glutamate can have a better humoral immune response when used for skin injection.

[0319] Application Example 3: L-glutamic acid solution or ectoine solution as excipient for the in vivo immune effect of ovalbumin DNA vaccine (skin injection or intramuscular injection in rats)

[0320] (1) Preparation of an L-glutamic acid-pVAX-Ova plasmid DNA solution: The purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence (ovalbumin gene sequence), L-glutamic acid and PBS (1x) were mixed to obtain an L-glutamic acid-plasmid mixed solution, wherein the final concentration of L-glutamic acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL.

[0321] Preparation of ectoine-pVAX-Ova plasmid DNA solution: Mix the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, ectoine and PBS (1x) to obtain an ectoine-plasmid mixed solution, wherein the final concentration of ectoine in the solution is 300 mM, and the final concentration of the plasmid DNA is 0.1 ug / uL.

[0322] Preparation of PBS-plasmid pVAX-Ova plasmid DNA solution: Dissolve the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, in PBS (1x) to a final concentration of 0.1 ug / ul to obtain a PBS-plasmid DNA solution.

[0323] (2) Skin injection: The skin injection method for the L-glutamic acid group, the ectoine group, and the PBS group is as follows:

[0324] L-glutamate group: At 0, 2, and 4 weeks, the L-glutamate-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected into the rats' skin at a volume of 100 ug per injection site. There were 3 rats in each group and 2 injection sites per rat.

[0325] Ectoine group: The difference from the amino acid group is that an ectoine-pVAX-Ova plasmid DNA solution was injected.

[0326] PBS group: The difference from the amino acid group is that a solution of PBS-plasmid pVAX-OvaDNA was injected.

[0327] (3) Intramuscular injection: The intramuscular injection method of the L-glutamate group, PBS group, and electroporation group is as follows:

[0328] L-glutamate group: At 0, 2, and 4 weeks, the L-glutamate-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of rats at a dose of 50 ug per muscle.

[0329] PBS group: The difference from the amino acid group is that a solution of PBS-plasmid pVAX-OvaDNA was injected.

[0330] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0331] (4) Peripheral blood was collected from all rats obtained in step (2) at week 5 to separate serum, and then the OVA-specific antibody titer was measured by enzyme-linked immunosorbent assay (ELISA). The results were as follows: Fig. 20 As shown; peripheral blood was collected from all rats obtained in step (3) at week 5 to separate serum, and then the OVA-specific antibody titer was determined by enzyme-linked immunosorbent assay (ELISA), starting from 1:1000, with a 2-fold dilution, and the absorbance of each dilution was measured. The results are shown in Fig.21 shown.

[0332] like Fig. 20 As shown, Fig. 20 The figure is the result of OVA-specific antibody titer after skin injection in rats in the L-glutamate group, ectoine group and PBS group, wherein the ordinate represents the absorbance value at 450nm, and the abscissa represents the dilution multiple of the OVA-specific antibody. Fig.21 As shown, Fig.21 The results of OVA-specific antibody titer after intramuscular injection of rats in the L-glutamate group, electroporation group and PBS group are shown in the figure, where the ordinate represents the absorbance value at 450nm and the abscissa represents the dilution multiple of OVA-specific antibody. The results show that the use of amino acids can promote the antibody level of rats.

[0333] Application Example 4: Amino acid solution or amino acid mixture solution as excipient for the in vivo immune effect of ovalbumin DNA vaccine (muscular injection in mice)

[0334] like Fig. 22 As shown, Fig. 22 Flowchart of experimental procedures and sample collection for tumor immunoprophylaxis.

[0335] (1) pVAX-Ova immunization:

[0336] (1.1) Preparation of amino acid-pVAX-Ova plasmid DNA solution: Purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, amino acids and PBS (1x) were mixed to obtain an amino acid-plasmid mixed solution, wherein the final concentration of the amino acid in the solution was 300 mM, and the final concentration of the plasmid DNA was 0.1 ug / uL, wherein the amino acid was L-glutamic acid, L-leucine or a combination of the two. When combined, the final concentrations of L-glutamic acid and L-leucine were 150 mM, respectively.

[0337] Preparation of PBS-plasmid pVAX-OvaDNA solution: Dissolve the purified pVAX-Ova plasmid DNA encoding the immunogenic gene sequence, i.e., the ovalbumin gene sequence, in PBS (1x) to a final concentration of 0.1 ug / uL to obtain a PBS-plasmid DNA solution.

[0338] (1.2) Amino acid group: At 0, 2, and 4 weeks, the amino acid-pVAX-Ova plasmid DNA solution obtained in step (1) was drawn up using a 31G insulin needle and injected intramuscularly into the tibialis anterior muscle of mice at an injection volume of 50 uL per muscle.

[0339] PBS group: The difference from the amino acid group is that a solution of PBS-plasmid pVAX-OvaDNA was injected.

[0340] Electroporation group: Based on the treatment of the PBS group, eight electrical stimulations were applied to the injection site, wherein the electric field intensity of the electrical stimulation was 100 V / cm, the frequency of the electrical stimulation was 20 ms each time, and the interval was 1 s.

[0341] (2) Blank immunization: The difference from pVAX-Ova immunization is that the pVAX-Ova plasmid DNA encoding the immunogen gene sequence, i.e., the ovalbumin gene sequence, is replaced by the injection of pVAX-luci-tdT plasmid DNA that does not encode the immunogen gene sequence, to obtain the corresponding amino acid group after blank immunization, PBS group after blank immunization, and electroporation group after blank immunization.

[0342] (3) All mice obtained in step (1) and step (1) were subcutaneously implanted with 100,000 B16-OVA tumor cells at week 7, and the survival rate of the mice was counted over the following 90 days. The results were as follows: Fig.23 shown.

[0343] like Fig.23 As shown, Fig.23The survival rate of mice in the amino acid group (L-glutamic acid, L-leucine or a combination of L-glutamic acid and L-leucine), PBS group and blank immunization within 90 days. The results show that tumor vaccines using amino acid groups can better prolong the survival of mice, and different excipients have different effects and have a cumulative effect.

Claims

1. An excipient for delivering exogenous plasmid DNA, characterized in that It is a liquid mixture or a lyophilized product of a liquid mixture, and the liquid mixture comprises amino acid substances and a buffer.

2. The excipient according to claim 1, characterized in that When delivering exogenous plasmid DNA, the effective delivery concentration of amino acid substances is above 3mmol / L.

3. The excipient according to claim 2, characterized in that The effective delivery concentration of the amino acid substance is 3-300mmol / L; preferably, the effective delivery concentration of the amino acid substance is 10-300mmol / L; more preferably, the effective delivery concentration of the amino acid substance is 100-300mmol / L.

4. The excipient according to any one of claims 1 to 3, characterized in that The route of delivery is intramuscular or transdermal injection.

5. The excipient according to any one of claims 1 to 4, characterized in that When the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid, Preferably, the amino acid substance includes one or more substances selected from the group consisting of L-glutamic acid, L-proline, L-threonine, L-asparagine, D-histidine, L-serine, L-alanine, L-methionine, L-leucine, D-alanine, L-phenylalanine, L-valine, L-isoleucine, ectoine, homoserine and polyglutamic acid.

6. The excipient according to claim 5, characterized in that When the delivery method is intramuscular injection, the amino acid substance includes one or more substances selected from the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid, Preferably, when the delivery method is intramuscular injection, the amino acid substance is selected from one or more substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid.

7. The excipient according to claim 6, characterized in that When the delivery method is intramuscular injection, the amino acid substances are selected from two substances in the group consisting of L-leucine, D-histidine, L-alanine, L-glutamic acid, ectoine, homoserine and polyglutamic acid, Preferably, when the delivery method is intramuscular injection, the effective delivery concentration ratio of the two substances constituting the amino acid substances is 1-5:1-5, preferably, the effective delivery concentration ratio is 1-2:1-2.

8. The excipient according to claim 7, characterized in that When the delivery method is intramuscular injection, the amino acid substance is a combination of L-glutamic acid and ectoine. And / or when the delivery method is intramuscular injection, the amino acid substance is a combination of L-glutamic acid and L-leucine.

9. The excipient according to any one of claims 1 to 4, characterized in that When the delivery method is skin injection, the amino acid substance includes one or more substances selected from the group consisting of L-proline, L-valine, L-lysine, homoserine, L-serine, glycine, D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine and polyglutamic acid, Preferably, the amino acid substance includes one or more substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid. More preferably, when the delivery method is skin injection, the amino acid substance is selected from one or more substances in the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid.

10. The excipient according to claim 9, characterized in that When the delivery method is skin injection, the amino acid substances are two substances selected from the group consisting of D-histidine, L-leucine, L-glutamic acid, L-glutamine, ectoine, homoserine and polyglutamic acid, Preferably, when the delivery method is skin injection, the effective delivery concentration ratio of the two substances constituting the amino acid substance is 1-5:1-5, preferably, the effective delivery concentration ratio is 1-2:1-2.

11. The excipient according to any one of claims 1 to 10, characterized in that The excipient has the function of expanding the transfection range of the exogenous plasmid DNA encoding the target gene in the organism and increasing the expression amount of the target gene.

12. The excipient according to any one of claims 1 to 11, characterized in that The buffer is an isotonic buffer, preferably, the isotonic buffer is PBS or physiological saline.

13. A method for preparing a composition comprising the excipient according to any one of claims 1 to 12, characterized in that: The method comprises the following steps: mixing components including amino acids and buffer to obtain a liquid mixture, or freeze-drying the liquid mixture to obtain a lyophilized product of the liquid mixture.

14. The excipient according to any one of claims 1 to 12 or the excipient prepared by the preparation method according to claim 13, characterized in that: Application in the preparation of exogenous plasmid DNA preparations.

15. An exogenous plasmid DNA preparation, characterized in that: Contains the excipient according to any one of claims 1 to 12 or the excipient prepared by the preparation method according to claim 13, and exogenous plasmid DNA, wherein the amino acid substance in the exogenous plasmid DNA preparation is used to deliver the exogenous plasmid DNA, and the effective delivery concentration of the amino acid substance is above 3 mmol.

16. The exogenous plasmid DNA preparation according to claim 15, characterized in that In the exogenous plasmid DNA preparation, the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL, preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-5 ug / uL, more preferably, the effective delivery concentration of the exogenous plasmid DNA is 0.05-1 ug / uL, And / or in the exogenous plasmid DNA preparation, the effective delivery concentration of the amino acid substance is above 3mmol / L, preferably, the effective delivery concentration is 3-300mmol / L, more preferably, the effective delivery concentration is 10-300mmol / L, and most preferably, the effective delivery concentration is 100-300mmol / L.

17. The exogenous plasmid DNA preparation according to claim 15 or 16, characterized in that The exogenous plasmid DNA is an exogenous plasmid DNA encoding a target gene sequence, and more preferably, the target gene is a gene sequence of a functional protein.

18. The exogenous plasmid DNA preparation according to claim 17, characterized in that The functional protein comprises one or more substances selected from the group consisting of ovalbumin, fluorescent protein, luciferase, cytokine, nanobody, monoclonal antibody and recombinant antibody.

19. The exogenous plasmid DNA preparation according to any one of claims 15 to 18, characterized in that The exogenous DNA is: pVAX-luci-tdT plasmid DNA, or pVAX-Ova plasmid DNA. Preferably, the exogenous DNA is: purified pVAX-luci-tdT plasmid DNA, and / or purified pVAX-Ova plasmid DNA.

20. A method for preparing an exogenous plasmid DNA preparation according to any one of claims 15 to 19, characterized in that: The method comprises the following steps: mixing substances containing excipients and exogenous plasmid DNA to obtain an exogenous plasmid DNA preparation, wherein when the amino acid substances are delivered to the exogenous plasmid DNA, the effective delivery concentration of the amino acid substances is above 3 mmol / L, and the effective delivery concentration of the exogenous plasmid DNA is above 0.05 ug / uL.

21. Use of the exogenous plasmid DNA preparation according to any one of claims 15 to 19 or the exogenous plasmid DNA preparation prepared by the preparation method according to claim 20 in the preparation of vaccine products or non-vaccine pharmaceutical products.

22. A vaccine product, characterized in that: The vaccine product contains the exogenous plasmid DNA preparation according to any one of claims 15 to 19 or the exogenous plasmid DNA preparation prepared by the preparation method according to claim 20, preferably, the vaccine product is of intramuscular injection type or skin injection type.

23. A non-vaccine pharmaceutical product, characterized in that: The non-vaccine pharmaceutical product contains the exogenous plasmid DNA preparation according to any one of claims 15 to 19 or the exogenous plasmid DNA preparation prepared by the preparation method according to claim 20, preferably, the non-vaccine pharmaceutical product is of intramuscular injection or skin injection type.

Images