Nucleic acid ligand, conjugate thereof as well as preparation method and application of conjugate

Abstract

The invention provides a compound for forming a conjugate with oligonucleotide. The compound has a structure as shown in a formula (I). The invention also provides a corresponding conjugate, and an application of the conjugate in preparation of drugs for treating and / or preventing related diseases. The conjugate disclosed by the invention has excellent tissue selectivity (not targeting other tissues such as the heart) while realizing CNS targeted delivery of the siRNA conjugate, and reduces toxic and side effects. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to a compound for conjugation with nucleic acid, a corresponding nucleic acid conjugate, and a preparation method and use thereof. Background Art

[0002] The development of small nucleic acid drug delivery vectors is one of the core barriers and technical difficulties recognized by the industry. Compared with traditional chemical drugs, siRNA has a large molecular weight and negative charge, a short half-life in the body, and is easily degraded by nucleases in the body, making it difficult to cross the cell membrane to exert its therapeutic effect. Therefore, the development of a small nucleic acid delivery system that can overcome natural biological barriers and achieve efficient transmembrane and in vivo transport has become a key issue that needs to be solved urgently.

[0003] GalNAc (N-acetylgalactosamine) is a high-affinity targeting ligand for asialoglycoprotein receptor (ASGPR), which is specifically and highly expressed on the surface of hepatocytes. The GalNAc delivery system is a major breakthrough in the field of liver targeting in the development of small nucleic acid drugs. So far, four GalNAc-siRNA conjugate drugs have entered the market. However, due to the immaturity of delivery technology, non-liver targeted delivery is still one of the main challenges facing nucleic acid drugs. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a conjugate of a novel structure of a polypeptide, a lipid molecule and siRNA, which achieves CNS (central nervous system) targeted delivery of siRNA conjugates while having excellent tissue selectivity (not targeting other tissues such as the heart) and reducing toxic side effects.

[0005] In a first aspect, the present invention provides a compound having a structure shown in formula (I):

[0006]

[0007] in,

[0008] Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide;

[0009] Domain B is a linker and can be attached to any position of the oligonucleotide;

[0010] n is 1 or 2;

[0011] R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen;

[0012] Indicates the site of covalent attachment of a group.

[0013] In a second aspect, the present invention provides a nucleic acid conjugate having a structure shown in formula (V):

[0014]

[0015] in,

[0016] Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide;

[0017] Domain B is a linker and can be attached to any position of the oligonucleotide;

[0018] n is 1 or 2;

[0019] R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen;

[0020] Nu is an oligonucleotide.

[0021] In a third aspect, the present invention provides use of the nucleic acid conjugate of the present invention in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by the expression of a gene in CNS tissue, eye tissue, muscle tissue, and kidney tissue.

[0022] In a fourth aspect, the present invention provides a method for treating a pathological condition or disease caused by the expression of a gene in CNS tissue, eye tissue, muscle tissue, and kidney tissue, comprising administering a nucleic acid conjugate of the present invention to a patient suffering from the disease.

[0023] In a fifth aspect, the present invention provides a kit comprising the nucleic acid conjugate of the present invention.

[0024] The beneficial effects of the present invention are:

[0025] The present invention innovatively organically conjugates polypeptides, lipid molecules and siRNA to obtain a series of siRNA conjugates with novel structures, which are widely used in the delivery of siRNA conjugates to CNS tissues, eye tissues, muscle tissues, kidneys and other tissues. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The HPLC spectrum of SA56.

[0027] Figure 2 HPLC spectrum of SA90.

[0028] Figure 3 The HPLC spectrum of SA83.

[0029] Figure 4The results of the activity test of the siRNA conjugates in the mouse thoracic cord in Example 5 are shown.

[0030] Figure 5 The results of the activity test of the siRNA conjugates in the mouse heart in Example 5 are shown. DETAILED DESCRIPTION

[0031] The specific embodiments of the present disclosure are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure, and are not used to limit the present disclosure.

[0032] The general, preferred, more preferred, most preferred, optional etc. definitions given in this specification for radicals in different formulae can be combined with one another.

[0033] definition

[0034] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the common meanings understood by technicians in the relevant field.

[0035] In the above and below, in particular, when describing the preparation method or use of the compounds or nucleic acid conjugates disclosed herein, the use of nucleoside monomers (nucleoside monomers) may sometimes be involved. Unless otherwise specified, the nucleoside monomers refer to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also referred to as Nucleoside phosphoramidites) used in phosphoramidite solid phase synthesis according to the type and order of nucleotides in the functional oligonucleotide or nucleic acid conjugate to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

[0036] In the context of the present disclosure, unless otherwise specified, "conjugation" refers to the connection between two or more chemical moieties, each having a specific function, in a covalently linked manner; accordingly, "conjugate" refers to a compound formed by covalently linking the chemical moieties. Further, "nucleic acid conjugate" means a compound formed by covalently linking one or more chemical moieties having a specific function to an oligonucleotide. Hereinafter, sometimes, especially in the embodiments, the nucleic acid conjugates of the present disclosure are also referred to as "conjugates". Nucleic acid conjugates should be understood as a general term for nucleic acid conjugates or a specific nucleic acid conjugate represented by a specific structural formula, depending on the context.

[0037] As used herein, a hyphen ("-") not between two letters or symbols is used to indicate the position of the point of attachment of a substituent. For example: -C1-C 10 Alkyl-NH2 through C1-C 10 Alkyl group connected.

[0038] Various hydroxyl protecting groups can be used in the present disclosure. In general, the protecting group makes the chemical functional group insensitive to specific reaction conditions, and can be attached and removed on the functional group in the molecule, without substantially damaging the rest of the molecule. Representative hydroxyl protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, and the above-mentioned documents are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under alkaline conditions, but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthine-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthine-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxyl protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), TMTr (4,4',4"-trimethoxytrityl), and tert-butyldimethylsilyl (TBS or TBDMS). Non-exclusive examples of hydroxyl protecting groups that can be used herein include alkyl acyl groups.

[0039] The term "subject", as used herein, refers to any animal, such as a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and poultry of any kind.

[0040] As used herein, "treat," "alleviate," or "ameliorate" are used interchangeably herein. These terms refer to an approach to obtaining beneficial or desired results, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Furthermore, a therapeutic benefit is obtained by eradication or amelioration of one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, although the subject may still be afflicted with the underlying disorder.

[0041] As used herein, "prevent" and "prevention" are used interchangeably. These terms refer to an approach to obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit," a conjugate or composition may be administered to a subject at risk for a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even though a diagnosis of the disease may not have yet been made.

[0042] As used herein, "D-configuration T7 polypeptide" refers to D T7 (HRPYIAH) (SEQ ID NO: 17).

[0043] As used herein, "L-configuration T7 polypeptide" refers to L T7 (HAIYPRH) (SEQ ID NO: 18).

[0044] As used herein, "D-configuration T12 polypeptide" refers to D T12(PWVPSWMPPRHT) (SEQ ID NO:19).

[0045] As used herein, "L-configuration T12 polypeptide" refers to L T12(THRPPMWSPVWP) (SEQ ID NO:20).

[0046] According to a first aspect of the present invention, there is provided a compound having a structure shown in formula (I):

[0047]

[0048] in,

[0049] Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide;

[0050] Domain B is a linker and can be attached to any position of the oligonucleotide;

[0051] n is 1 or 2;

[0052] R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen;

[0053] Indicates the site of covalent attachment of a group.

[0054] In some embodiments, Has any of the following structures:

[0055]

[0056]

[0057] in, Represents the site where the group is covalently bonded; R1 and R2 are independently hydrogen or any one of the following structures:

[0058]

[0059] in, represents the site where the group is covalently attached; k is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; m is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; n is an integer between 1 and 8, for example, 1, 2, 3, 4, 5, 6, 7, 8.

[0060] In some embodiments, Has any of the following structures:

[0061]

[0062] in,

[0063] Indicates the site where the group is covalently bonded; X is O, S or NH; Y is O or S;

[0064] p is an integer between 0 and 10, preferably an integer between 2 and 6, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; q is an integer between 1 and 6, for example, 1, 2, 3, 4, 5, 6; r is an integer between 0 and 6, preferably an integer between 0 and 3, for example, 0, 1, 2, 3, 4, 5, 6;

[0065] R3 and R4 are independently hydrogen or any one of the following structures:

[0066]

[0067] in, represents the site where the group is covalently attached; k is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; m is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; n is an integer between 1 and 8, for example, 1, 2, 3, 4, 5, 6, 7, 8.

[0068] In a specific embodiment, the compound has any one of the structures shown below:

[0069]

[0070]

[0071]

[0072]

[0073] According to a second aspect of the present invention, a nucleic acid conjugate is provided, which has a structure shown in formula (V):

[0074]

[0075] in,

[0076] Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide;

[0077] Domain B is a linker and can be attached to any position of the oligonucleotide;

[0078] n is 1 or 2;

[0079] R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen;

[0080] Nu is an oligonucleotide.

[0081] In some embodiments, Has any of the following structures:

[0082]

[0083]

[0084] in, Represents the site where the group is covalently bonded; R1 and R2 are independently hydrogen or any one of the following structures:

[0085]

[0086] in, represents the site where the group is covalently attached; k is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; m is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; n is an integer between 1 and 8, for example, 1, 2, 3, 4, 5, 6, 7, 8.

[0087] In some embodiments, Has any of the following structures:

[0088]

[0089] in,

[0090] Indicates the site where the group is covalently bonded; X is O, S or NH; Y is O or S;

[0091] p is an integer between 0 and 10, preferably an integer between 2 and 6, for example, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10; q is an integer between 1 and 6, for example, 1, 2, 3, 4, 5, 6; r is an integer between 0 and 6, preferably an integer between 0 and 3, for example, 0, 1, 2, 3, 4, 5, 6;

[0092] R3 and R4 are independently hydrogen or any one of the following structures:

[0093]

[0094] in, represents the site where the group is covalently attached; k is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; m is an integer between 2 and 18, preferably an integer between 4 and 12, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18; n is an integer between 1 and 8, for example, 1, 2, 3, 4, 5, 6, 7, 8.

[0095] In some embodiments, the oligonucleotide is a functional oligonucleotide. Functional oligonucleotide refers to such an oligonucleotide: the oligonucleotide can be activated by RNA (RNA activation, RNAa), RNA interference (RNA interference, RNAi), antisense nucleic acid technology, exon skipping (exon skipping) technology and other principles, up or down the expression of the target gene, or cause mRNA variable splicing. In some aspects, the functional oligonucleotide can also be a nucleic acid structure that is stably and specifically combined with the target protein. In addition, it is easily understood by those skilled in the art that polynucleotides (such as mRNA itself or its fragments) are also suitable for conjugation with the compounds provided by the present disclosure to form conjugates to achieve targeted delivery, such as CNS targeted delivery, so as to regulate the expression of proteins transcribed by mRNA. Therefore, in the context, the concept of "functional oligonucleotide" can also cover mRNA or its fragments.

[0096] In some embodiments, the functional oligonucleotide can interact with the target sequence, thereby affecting the normal function of the target sequence molecule, such as causing mRNA breakage or translation repression or exon skipping to trigger mRNA alternative splicing. In some embodiments, the functional oligonucleotide can be substantially complementary to the bases of the target sequence. In some embodiments, the functional oligonucleotide can be complementary to 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or more of the bases of the target sequence, or completely complementary to the target sequence. In some embodiments, the functional oligonucleotide can contain 1, 2 or 3 bases that are not complementary to the target sequence. In some embodiments, the functional oligonucleotide includes deoxyribonucleotides or ribonucleotides, and nucleotides with modifications. In some embodiments, the functional oligonucleotide can be a single-stranded DNA, RNA or DNA-RNA chimera, or a double-stranded DNA, RNA or DNA-RNA hybrids.

[0097] In some embodiments of the present disclosure, the oligonucleotide is selected from one of small interfering RNA, microRNA, anti-microRNA, microRNA antagonist, microRNA mimetic, decoy oligonucleotide, immunostimulant, G-quadrupole, alternative splicing, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide; optionally, the oligonucleotide is a single-stranded oligonucleotide, and the P atom in domain B is connected to the end of the single-stranded oligonucleotide, and the end of the single-stranded oligonucleotide refers to the first 4 nucleotides from one end of the single-stranded oligonucleotide; optionally, the P atom in domain B is connected to the end of the single-stranded oligonucleotide; optionally, the P atom in domain B is connected to the 3' end of the single-stranded oligonucleotide;

[0098] Optionally, the oligonucleotide is a double-stranded oligonucleotide comprising a sense strand and an antisense strand, the P atom in domain B is connected to the end of the double-stranded oligonucleotide, and the end of the double-stranded oligonucleotide refers to the first 4 nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in domain B is connected to the end of the sense strand or the antisense strand; optionally, the P atom in domain B is connected to the 5' end of the antisense strand; optionally, the P atom in domain B is connected to the 2', 3' or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphodiester bond.

[0099] In some embodiments, the "target sequence" is a target mRNA. In the context of the present disclosure, "target mRNA" refers to the mRNA corresponding to a gene abnormally expressed in tissues such as CNS tissues, eye tissues, muscle tissues and kidneys. It can be the mRNA corresponding to an overexpressed gene, or the mRNA corresponding to an underexpressed gene. Since most diseases originate from the overexpression of mRNA, in the present disclosure, the target mRNA particularly refers to the mRNA corresponding to the overexpressed gene. In some embodiments, the target mRNA can be the mRNA corresponding to the SOD1 (Superoxide Dismutase 1) gene, or the mRNA corresponding to the APP (Amyloid precursor protein) gene.

[0100] It is well known to those skilled in the art that siRNA contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group and a base. Usually, the length of an active, i.e., functional siRNA is about 12-40 nucleotides, and in some embodiments, about 15-30 nucleotides. Each nucleotide in the siRNA can be independently a modified or unmodified nucleotide. In order to increase stability, at least one nucleotide in the siRNA is a modified nucleotide.

[0101] In a specific embodiment, the nucleic acid conjugate has any one of the following structures:

[0102]

[0103]

[0104]

[0105] in, For siRNA.

[0106] According to a third aspect of the present invention, there is provided a use of a nucleic acid conjugate of the present invention in the preparation of a medicament for treating and / or preventing pathological conditions or diseases caused by gene expression in CNS tissue, eye tissue, muscle tissue and kidney tissue.

[0107] In some embodiments, the gene is the SOD1 gene or the APP gene.

[0108] In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), frontotemporal dementia, Parkinson's disease (PD), Huntington's disease (HD), epilepsy, migraine, spinocerebellar disease, prion disease, and Lafora disease.

[0109] According to a fourth aspect of the present invention, there is provided a method for treating a pathological condition or disease caused by gene expression in CNS tissue, eye tissue, muscle tissue and kidney tissue, comprising administering the nucleic acid conjugate of the present invention to a patient suffering from the disease.

[0110] In some embodiments, the gene is the SOD1 gene or the APP gene.

[0111] In some embodiments, the disease is amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), frontotemporal dementia, Parkinson's disease (PD), Huntington's disease (HD), epilepsy, migraine, spinocerebellar disease, prion disease, and Lafora disease.

[0112] According to a fifth aspect of the present invention, a kit is provided, comprising the nucleic acid conjugate of the present invention.

[0113] The following examples are merely illustrative of the present invention and are not intended to be limiting.

[0114] Example

[0115] Unless otherwise specified, the raw materials, reagents, etc. used in the following examples are all commercially available products.

[0116] Example 1 Synthesis of polypeptide

[0117] The peptides were synthesized using a general solid phase synthesis method, and the specific steps are as follows:

[0118] 1. The peptide starts from the C-terminus and connects the corresponding amino acids to the N-terminus in sequence (the left end is the N-terminus). The amount of each amino acid is calculated according to the weight of the target peptide. Each amino acid is a raw material with a special protective group;

[0119] 2. Place the resin in a 150 mL reactor and add 50 mL of dichloromethane (DCM) to soak for 2 hours;

[0120] 3. Wash the resin with N,N-dimethylformamide (DMF) and then drain it. Repeat this process four times to drain the resin.

[0121] 4. Weigh Fmoc-Lys(Boc)-OH (protected first amino acid at the C-terminus) + DCM + N,N-diisopropylethylamine (DIEA) and add them to the reactor, then place the reactor in a shaker at 30°C for 2 hours;

[0122] 5. Block with methanol solution (MeOH:DIEA:DCM=1:1:2) for half an hour, then wash four times with DMF and drain;

[0123] 6. Add 20% piperidine solution (piperidine / DMF=1:4) to the reactor to remove the Fmoc protecting group. After the removal of protection, wash four times with DMF and then drain;

[0124] 7. Take a small amount of resin and test it with the ninhydrin method. If the resin has color, it means that the deprotection is successful;

[0125] 8. Weigh Fmoc-Arg(Pbf)-OH (the second amino acid at the C-terminus with protection) + 1-hydroxybenzotriazole (HOBT) + N,N'-diisopropylcarbodiimide (DIC) and add them into the reactor, then place the reactor in a shaker at 30°C for 1 hour;

[0126] 9. Take a small amount of resin for testing, and use the ninhydrin method to test. If the resin has color, it means that the condensation is incomplete, and the reaction should continue; if the resin is colorless, it means that the reaction is complete. After the reaction is complete, wash the resin four times with DMF and then drain;

[0127] 10. Add a certain amount of 20% piperidine (piperidine / DMF = 1:4) to the reactor, shake it on a decolorizing shaker for 20 minutes to remove the Fmoc protecting group on the resin, wash it with DMF four times after deprotection, and then drain it to check whether the protection is removed;

[0128] 11. Take a small amount of resin and test it with the ninhydrin method. If the resin has color, it means that the deprotection is successful;

[0129] 12. Connect the remaining amino acids in sequence according to steps 8-11;

[0130] 13. Use a cleavage agent to remove all protective groups of the polypeptide and cut it off from the resin, centrifuge and dry it before purification;

[0131] 14. The purification personnel take the crude product to test the mass spectrum of the unoxidized sample. After the mass spectrum is correct, use the HPLC instrument (high performance liquid chromatography) for purification;

[0132] 15. After the target peptide is separated from the impurities by high performance liquid chromatography (HPLC), the target peptide is received by the central control test. If it is qualified, it is freeze-dried into powder and sent to QC for quality inspection. If it passes the inspection, it will be put into storage.

[0133] The synthesized peptides are as follows:

[0134]

[0135] SA56 sequence:Pal-HAIYPRHC(2-thiopyridine)-NH2, compound SA56 molecular formula:C 65 H 99 O 10 N 17 S2, molecular weight: 1341.72, LC-MS measured: 1342.88 (M+H). The HPLC spectrum of SA56 is as follows Figure 1 shown.

[0136]

[0137] SA90 sequence: Ac-HAIYPRHC(SPyr)-NH2, compound SA90 molecular formula: C 51 H 71 O 10 N 17S2, molecular weight: 1145.50, LC-MS measured: 1146.65 (M+H). The HPLC spectrum of SA90 is as follows Figure 2 shown.

[0138]

[0139] SA83 sequence:Pal-THRPPMWSPVWPC(2-mercaptopyridine)-NH2, compound SA83 molecular formula:C 95 H 138 O 16 N 22 S3, molecular weight: 1938.98, LC-MS measured: 1940.10 (M+H). The HPLC spectrum of SA83 is as follows Figure 3 shown.

[0140] Example 2 Synthesis of intermediate SA54

[0141]

[0142] 2.1 Preparation of intermediate 2-1

[0143]

[0144] Compound (R)-(+)-N-benzyl-3-hydroxypyrrolidine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (16.9mmol, 3.0g) and imidazole (3.0equiv, 50.7mmol, 3.45g) were placed in a clean dry reaction bottle, 50mL of acetonitrile was added, and tert-butyldimethylsilyl chloride (1.3equiv, 21.9mmol, 3.31g) was slowly added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 100mL of ethyl acetate was added to the reaction solution, and washed with 100mL of saturated sodium bicarbonate solution and 100mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1-5 / 1) to obtain a colorless oil compound 2-1 (4.9g, 16.8mmol, 99% yield). Compound 2-1 molecular formula: C 17 H 29 ONSi, molecular weight: 291.2, LC-MS measured: 292.4 (M+H).

[0145] 2.2 Preparation of intermediate 2-2

[0146]

[0147] Compound 2-1 (16.8mmol, 4.9g) was placed in a clean dry reaction bottle, 100mL of methanol was added, palladium carbon (wet basis, 10% Pd / C) (10% wt, 490.0mg) was added under hydrogen at room temperature, and then stirred at room temperature for 12 hours. After the reaction, the palladium carbon was filtered out, and the filtrate was concentrated to obtain a crude product of white solid compound 2-2 (3.31g, 16.5mmol, 98% yield), which was directly used in the next step without purification. Compound 2-2 molecular formula: C 10 H 23 ONSi, molecular weight: 201.1, LC-MS measured: 202.3 (M+H).

[0148] 2.3 Preparation of intermediate 2-3

[0149]

[0150] The compound N-benzyloxycarbonyl-L-serine (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (15.0 mmol, 3.58 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 22.5 mmol, 8.53 g), compound 2-2 (1.1 equiv, 16.5 mmol, 3.31 g) and N,N-diisopropylethylamine (3.0 equiv, 45.0 mmol, 5.78 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1-1 / 3) to obtain a white solid compound 2-3 (4.5 g, 10.65 mmol, 63% two-step yield). Compound 2-3 molecular formula: C 21 H 34 O5N2Si, molecular weight: 422.2, LC-MS measured: 423.3 (M+H). 1 H NMR (400MHz, CDCl3): δ7.35-7.29(m,5H),5.96(dd,J=14.3,8.3Hz,1H),5.10(s,2H),4.61-4.40(m,2H),3.85-3.68(m,2H),3.65-3.4 9(m,2H),3.41(d,J=12.7Hz,1H),3.31(s,1H),1.95(qdd,J=15.0,11.8,5.3Hz,2H),1.77(s,1H),0.86(s,9H),0.06(d,J=3.1Hz,6H).

[0151] 2.4 Preparation of intermediate 2-4

[0152]

[0153] Compound 2-3 (10.65mmol, 4.5g) was placed in a clean dry reaction bottle, 100mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.2equiv, 12.78mmol, 4.32g) was added at room temperature, and then stirred at room temperature for 12 hours. After the reaction, 150mL of ethyl acetate was added to the reaction solution, and washed with 150mL of saturated sodium bicarbonate solution and 150mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1-1 / 1) to obtain a light yellow oil compound 2-4 (7.56g, 10.43mmol, 98% yield). Compound 2-4 molecular formula: C 42 H 52 O7N2Si, molecular weight: 724.3, LC-MS measured: 747.4 (M+Na). 1 H NMR (400MHz, CDCl3): δ7.35-7.31(m,1H),7.28(d,J=4.7Hz,4H),7.27-7.23(m,2H),7.23-7.14(m,5H), 7.13-7.11(m,2H),6.80-6.78(m,1H),6.76(dd,J=7.7,5.4Hz,4H),5.72(dd,J=22.7,8.3Hz,1H),5.08- 4.99(m,2H),4.69-4.59(m,1H),4.35-4.30(m,1H),3.73(dd,J=4.5,3.7Hz,6H),3.65-3.44(m,2H),3.3 6-3.20(m,3H),1.86-1.81(m,1H),1.70(s,1H),0.80(d,J=13.1Hz,9H),-0.02(dd,J=14.9,4.2Hz,6H).

[0154] 2.5 Preparation of intermediate 2-5

[0155]

[0156] Compound 2-4 (10.43mmol, 7.56g) was placed in a clean dry reaction bottle, 100mL of methanol was added, palladium carbon (wet basis, 10% Pd / C) (10% wt, 750.0mg) was added under hydrogen at room temperature, and then stirred at room temperature for 12 hours. After the reaction, the palladium carbon was filtered off, and the filtrate was concentrated to obtain a crude product of white solid compound 2-5 (6.0g, 10.22mmol, 98% yield), which was directly used in the next step without purification. Compound 2-5 molecular formula: C 34 H 46 O5N2Si, molecular weight: 590.3, LC-MS measured: 591.6 (M+H).

[0157] 2.6 Preparation of intermediate 2-6

[0158]

[0159] The compound palmitic acid (commercially available, purchased from Shanghai Titan Technology Co., Ltd.) (9.29 mmol, 2.38 g) was placed in a clean dry reaction bottle, 100 mL of dichloromethane was added, and benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate (1.5 equiv, 13.94 mmol, 5.29 g), compound 2-5 (1.1 equiv, 10.22 mmol, 6.0 g) and N,N-diisopropylethylamine (3.0 equiv, 27.87 mmol, 3.6 g) were added at room temperature, followed by stirring at room temperature for 1 hour. After the reaction, 150 mL of dichloromethane was added to the reaction solution, and the mixture was washed with 150 mL of saturated sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered and concentrated. The obtained crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 10 / 1-1 / 3) to obtain a light yellow oil 2-6 (6.62 g, 7.99 mmol, 86% yield). Compound 2-6 molecular formula: C 50 H 76 O6N2Si, molecular weight: 828.5, LC-MS measured: 851.3 (M+Na).

[0160] 2.7 Preparation of intermediate 2-7

[0161]

[0162] Compound 2-6 (7.99mmol, 6.62g) was placed in a clean dry reaction bottle, 50mL of tetrahydrofuran was added, and tetrabutylammonium fluoride (2.0equiv, 15.98mmol, 15.98mL) was added at room temperature, and then stirred at room temperature for 2 hours. After the reaction, 100mL of ethyl acetate was added to the reaction solution, and washed with 100mL of saturated sodium bicarbonate solution and 100mL of saturated brine, the organic phase was dried, filtered and concentrated, and the crude product was separated and purified by silica gel column chromatography (dichloromethane / methanol = 50 / 1-10 / 1) to obtain a light yellow oil compound 2-7 (4.62g, 6.47mmol, 81% yield). Compound 2-7 molecular formula: C 44 H 62 O6N2, molecular weight: 714.4, LC-MS measured: 713.3 (MH).

[0163] 2.8 Preparation of compound SA54

[0164]

[0165] Compound 2-7 (6.47 mmol, 4.62 g) was placed in a clean dry reaction bottle and 50 mL of anhydrous dichloromethane was added. Compound 2-cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 12.94 mmol, 3.9 g) and 4,5-dicyanoimidazole (1.5 equiv, 9.71 mmol, 1.15 g) were added under argon protection at room temperature and stirred for one hour at room temperature. After the reaction, 50 mL of dichloromethane was added to the reaction solution and washed with 100 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered and concentrated. The crude product was purified by C18 reverse phase column (specification: 30 μm; Commercially available, purchased from Shanghai Boyun Biotechnology Co., Ltd.) (MeCN:H2O=75%:25%) to prepare a colorless oil SA54 (4.38 g, 4.79 mmol, 74% yield). Compound SA54 molecular formula: C 53 H 79 O7N4P, molecular weight: 914.5, LC-MS measured: 937.4 (M+Na). 1H NMR (400MHz, DMSO-d6): δ8.12-8.07(m,1H),7.31(dt,J=15.3,7.9Hz,4H),7.19(dd,J=14.1,5.3Hz,5H),6.87 (d,J=8.2Hz,4H),4.88-4.77(m,1H),4.51-4.49(m,1H),3.73(s,6H),3.70-3.59(m,2H),3.57-3.45(m,3H),3 .39(dd,J=12.0,4.7Hz,1H),3.22-3.15(m,1H),3.03(dt,J=14.6,7.1Hz,1H),2.78-2.70(m,2H),2.16-1.90( m,4H),1.44(s,2H),1.26-1.09(m,34H),1.06(d,J=6.7Hz,2H),1.00(d,J=6.7Hz,2H),0.84(t,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO-d6): δ147.06 (s), 146.73 (t, J = 31.8Hz).

[0166] Example 3 Preparation of siRNA conjugates General solid phase synthesis method

[0167] By solid phase phosphoramidite method, using the specially modified compounds prepared in the above steps and commercially purchased conventional modified monomers (phosphoramidite monomers for synthesizing modified nucleotides dT, Am, Cm, Gm, Um, Af, Cf, Gf, Uf, all purchased from Shanghai Zhaowei Technology Development Co., Ltd.), nucleoside monomers are connected one by one from the 3'-5' direction according to the nucleotide arrangement order. The specially modified anti-off-target compound is placed in the seed region of the antisense chain (any position from the 4th to the 8th position from the 5' end), and the delivery monomer compound is freely set to be placed at the 3' end or the 5' end according to the common monomer. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. Synthesis conditions used for the sense chain and antisense chain.

[0168] Instrument model: MerMade 12 Oligonucleotide syntheizer solid phase synthesizer, Beijing Haijing 6mL synthesis column, Si Tuofan SourceTM 15Q 4.6 / 100PE purification column.

[0169] The reagents used to synthesize siRNA conjugates were purchased from Suzhou Kelema Biotechnology Co., Ltd.

[0170] The specific synthesis steps are as follows:

[0171] The single-strand synthesis reaction process is extended from 3'-5' direction and completed on a solid phase synthesizer. It includes four main reaction steps:

[0172] a. DMTr removal reaction: Use dichloroacetic acid to remove the DMTr protecting group on the nucleotide to obtain the 5'-hydroxyl end;

[0173] b. Coupling reaction: The protected nucleotide phosphoramidite monomer is mixed with the activating agent ethylthiotetrazolyl, the phosphoramidite group is activated, the 5'-hydroxyl group is still protected by DMTr, and a condensation reaction occurs with the 5'-hydroxyl group connected to the solid phase support to generate a phosphite triester;

[0174] c. Oxidation reaction: Under the action of iodine, the phosphite triester obtained in the previous condensation reaction is converted into a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus);

[0175] d. Sulfidation reaction: Under the action of the thiolation reagent PADS (phenylacetyl disulfide), the phosphite triester obtained in the previous condensation reaction is converted into a thiophosphate (oxidation or thiolation is selected according to the sequence design).

[0176] e. Capping reaction: There may be a very small number of 5'-hydroxyl groups (less than 2%) that do not participate in the condensation reaction. Use acetic anhydride and 1-methylimidazole to react with them to form acetate caps that cannot participate in subsequent reactions, thereby preventing further reactions. This short fragment can be separated during purification.

[0177] Repeat the above four steps until the desired sequence is synthesized. The main chemical reaction equation is as follows

[0178] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and the antisense chain, wherein:

[0179] The cutting and deprotection conditions are as follows: first prepare the aminolysis solution (ammonia water: ethanol = 3:1 mixed solution to a volume of 2mL), add the solid phase carrier to the above reaction bottle, and shake it evenly. Ammonolysis at 50°C in a constant temperature water bath for 16 hours. After 16 hours of aminolysis, cool the water bath to warm (25°C ± 2°C), filter with a sand core funnel, collect the filtrate in a round-bottom flask, and rinse the filter residue with 50% ethanol aqueous solution, collect the filtrate, concentrate it on a rotary evaporator, and then transfer it to a glass bottle, take a small sample of the crude product and send it to the analysis department to detect the crude product LC-MS. The detection method is as follows: Use Waters Acquity UPLC-LTQ LCMS (column: ACQUITYUPLC BEH C18) to detect the purity of the above-mentioned sense chain and antisense chain and analyze the molecular weight. The measured value is consistent with the theoretical value, see Table 1.

[0180] The purification and desalting conditions are as follows: purification using an ion exchange chromatography column and desalting using a HiPrepTM26 / 10 Desalting gel column, followed by single-chain freeze-drying. After single-chain freeze-drying, sampling is required for LC-MS.

[0181] Example 4 Preparation of siRNA conjugates

[0182] 4.1 Preparation of conjugate SD004147

[0183] 4.1.1 Preparation of intermediate 4-1-2

[0184]

[0185] The intermediate 4-1-2 was prepared by the general solid phase synthesis method of Example 3, wherein the intermediate 4-1-1 was purchased from Shanghai Zhaowei Technology Development Co., Ltd.

[0186]

[0187] 4.1.2 Preparation of intermediate 4-1-3

[0188]

[0189] The disulfide bond of the intermediate 4-1-2 was cleaved by the following method to expose the thiol group of the nucleic acid.

[0190] 1 Prepare ultrapure water (purchased from Shanghai Titan Technology Co., Ltd.) as the reaction solvent and post-treatment reagent. Purge the reactor with high-purity nitrogen and prepare TCEP (tris(2-chloroethyl) phosphate) to a concentration of 0.2 mol / L (i.e., 57 mg / mL).

[0191] 2. Dissolve the nucleic acid in ultrapure water in a 15 ml sterile centrifuge tube, add TCEP solution, and clarify the reaction solution.

[0192] 3 Place in an oscillator and oscillate at room temperature for 2 hours.

[0193] 4 Sampling was sent for LC-MS, which showed that the reaction was complete.

[0194] 5 Prepare a 3K PALL desalting tube (purchased from Shanghai Titan Technology Co., Ltd.) to remove TCEP and small molecule impurities in the reaction solution through desalting.

[0195] 6 After desalting, the intermediate was sampled and sent for LC-MS.

[0196] 4.1.3 Preparation of conjugate single-chain 4-1-4

[0197]

[0198] The nucleic acid with naked thiol groups was covalently linked to the polypeptide via a disulfide bond by the following method.

[0199] 1 Prepare ultrapure water as the reaction solvent and post-treatment reagent, and purge the reactor with high-purity nitrogen.

[0200] 2. Mix the dissolved nucleic acid and polypeptide together, add 0.1M NaHCO3 solution, and shake the reaction solution at room temperature overnight.

[0201] 3. Take samples and send them for LC-MS.

[0202] 4 Prepare a 3K PALL desalting tube to remove TCEP and small molecule impurities in the reaction solution.

[0203] 5 After desalting, take samples and send them for LC-MS.

[0204] 6 Use reverse phase purification to obtain the final product and take samples for LC-MS testing.

[0205] 4.1.4 Preparation of conjugate SD004147

[0206] Finally, the obtained sense strand and antisense strand need to be annealed into a double strand.

[0207] Annealing operation is as follows: the sense chain and antisense chain obtained after purification are dissolved in water for injection respectively to prepare 0.1mg / mL-40mg / mL solution, and the mixture is calibrated with Thermo Scientific Nanodrop Eight at an equal molar ratio, heated at 90°C for 5 minutes, and then slowly cooled naturally to form a double-stranded structure through hydrogen bonding. Samples are taken for testing the SEC purity of the product, see Table 2, and the double-stranded samples are lyophilized.

[0208] 4.2 Preparation of conjugate SD004223

[0209] 4.2.1 Preparation of conjugate single-chain 4-2-1

[0210]

[0211] The conjugate single chain 4-2-1 was prepared from the intermediate 4-1-3 and SA83 by the preparation method of 4.1.3.

[0212] 4.2.2 Preparation of conjugate SD004147

[0213] The conjugate SD004223 was prepared from the single-chain 4-2-1 by the preparation method of 4.1.4.

[0214] 4.3 Preparation of conjugate SD004148

[0215] 4.3.1 Preparation of intermediate 4-3-1

[0216]

[0217] The intermediate 4-3-1 was prepared by the general solid phase synthesis method of Example 3, wherein the intermediate 4-1-1 was purchased from Shanghai Zhaowei Technology Development Co., Ltd., and the intermediate SA54 was prepared by Example 2.

[0218] 4.3.2 Preparation of intermediate 4-3-2

[0219]

[0220] Intermediate 4-3-2 was prepared by cleaving the disulfide bond using the preparation method of 4.1.2.

[0221] 4.3.3 Preparation of single-chain 4-3-3 conjugate

[0222]

[0223] The conjugate single-chain 4-3-3 was prepared from the intermediate 4-3-2 and SA90 by the preparation method of 4.1.3.

[0224] 4.3.4 Preparation of conjugate SD004148

[0225] The conjugate SD004148 was prepared from the single-chain 4-3-3 using the preparation method of 4.1.4.

[0226] Table 1 Delivery molecule conjugated siRNA number and sequence information

[0227]

[0228]

[0229] Table 2 Double-chain SEC-HPLC purity

[0230] Conjugate No. Double-strand SEC-HPLC purity SD004147 100％ SD004223 97％ SD004148 100％ SD003307 95％ SD00208 93％

[0231] In the sequences mentioned above and in Table 1, the symbols are used to represent the following modified nucleotides:

[0232] A = adenosine-3'-phosphate

[0233] C = cytidine-3'-phosphate

[0234] G = guanosine-3'-phosphate

[0235] U = Uridine-3'-phosphate

[0236] dT = thymidine deoxyribonucleotide

[0237] Am = 2'-O-methyladenosine-3'-phosphate

[0238] Ams = 2'-O-methyladenosine-3'-phosphorothioate

[0239] Cm=2'-O-methylcytidine-3'-phosphate

[0240] Cms = 2'-O-methylcytidine-3'-phosphorothioate

[0241] Gm=2'-O-methylguanosine-3'-phosphate

[0242] Gms = 2'-O-methylguanosine-3'-phosphorothioate

[0243] Um = 2'-O-methyluridine-3'-phosphate

[0244] Ums = 2'-O-methyluridine-3'-phosphorothioate

[0245] Af = 2'-fluoroadenosine-3'-phosphate

[0246] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0247] Cf = 2'-fluorocytidine-3'-phosphate

[0248] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0249] Gf = 2'-fluoroguanosine-3'-phosphate

[0250] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0251] Uf = 2'-fluorouridine-3'-phosphate

[0252] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0253] VP = Vinyl Phosphate

[0254]

[0255] Example 5 Testing the Activity of siRNA Conjugates in Mice

[0256] Select 6-8 week old SPF grade female ICR mice, the weight of the mice is 27 ± 2g. The above mice were weighed and observed before administration, and animals with uniform weight and normal state were selected for random grouping, 4 in each group, wherein the experimental group mice were given the conjugate, and the vehicle group mice were given artificial cerebrospinal fluid (aCSF), and the lateral ventricle was administered according to the dose of 0.15 mg conjugate per mouse. Four days after administration, the animals were euthanized, and the cerebral cortex, hippocampus, thoracic cord, liver, kidney, heart, lung, and liver tissues were taken, and the tissues were cut and placed in RNALater (Invitrogen, AM7021M) for subsequent RNA extraction. The tissue was placed in lysis buffer (Zhiang Biotechnology, MNTR / FX96) and ground (Shanghai Jingxin, JXFSTPRP-48L) to extract total RNA, which was reverse transcribed into cDNA (Takara, 6210B), and the expression level of SOD1 mRNA was detected by probe-based qPCR (Applied Biosystems, 4444964).

[0257] Target gene SOD1 primers:

[0258] Forward primer: GTCCTTTCCAGCAGTCACAT (SEQ ID NO: 11);

[0259] Reverse primer: GGTTCCACGTCCATCAGTATG (SEQ ID NO: 12);

[0260] Probe primer: CCAACATGCCTCTCTTCATCCGC (SEQ ID NO: 13);

[0261] Primers for internal reference gene β-actin:

[0262] Forward primer: CATTGCTGACAGGATGCAGAA (SEQ ID NO: 14);

[0263] Reverse primer: GCTCAGGAGGAGCAATGATCTT (SEQ ID NO: 15);

[0264] Probe primer: CTCTGGCTCCTAGCACC (SEQ ID NO: 16);

[0265] The results are expressed as the residual expression level of the siRNA administration group compared to the vehicle group (the vehicle group is 100%). The sequence of the conjugate used for injection is shown in Table 1. The results of the residual expression level of SOD1 mRNA are shown in Figure 4 and Figure 5As shown, the activities of the conjugates SD004147, SD004148 and SD004223 in the thoracic cord of CNS tissue were significantly better than those of the positive control SD003307 (see Figure 4 In non-CNS tissues, the conjugates SD004147 and SD004223 showed no SOD1 gene silencing activity in the heart, showing excellent tissue selectivity; the conjugate SD004148 had moderate SOD1 gene silencing activity in the heart, while the positive control SD00208 showed high SOD1 gene silencing activity in the heart (see Figure 5 ).

[0266] The positive control SD003307 is a compound of T7 peptide conjugated siRNA, which is a compound disclosed in patent WO2023185946A1. The positive control SD00208 is a compound of C16 conjugated siRNA, which is a compound disclosed in patent WO2020257194A1.

[0267] Example embodiments have been disclosed herein, and although specific terms are employed, they are used and described in a general and descriptive sense only and not for purposes of limitation. In some cases, as will be apparent to one skilled in the art from the time this application is filed, features, characteristics, and / or elements described in conjunction with a particular embodiment may be used alone or in combination with features, characteristics, and / or elements described in conjunction with other embodiments, unless expressly indicated otherwise. Therefore, it should be understood by those skilled in the art that various changes in form and detail may be made without departing from the spirit and scope of the invention as set forth in the claims.

Claims

1. A compound having a structure shown in formula (I): in, Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide; Domain B is a linker and can be attached to any position of the oligonucleotide; n is 1 or 2; R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen; Indicates the site of covalent attachment of a group.

2. The compound according to claim 1, wherein Has any of the following structures: in, Represents the site where the group is covalently bonded; R1 and R2 are independently hydrogen or any one of the following structures: in, represents the site where the group is covalently bonded; k is an integer between 2 and 18, preferably an integer between 4 and 12; m is an integer between 2 and 18, preferably an integer between 4 and 12; and n is an integer between 1 and 8.

3. The compound according to claim 1 or 2, wherein Has any of the following structures: in, Indicates the site where the group is covalently bonded; X is O, S or NH; Y is O or S; p is an integer between 0 and 10, preferably an integer between 2 and 6; q is an integer between 1 and 6; r is an integer between 0 and 6, preferably an integer between 0 and 3; R3 and R4 are independently hydrogen or any one of the following structures: in, represents the site where the group is covalently bonded; k is an integer between 2 and 18, preferably an integer between 4 and 12; m is an integer between 2 and 18, preferably an integer between 4 and 12; and n is an integer between 1 and 8.

4. The compound according to claim 1, wherein the compound has any one of the structures shown below:

5. A nucleic acid conjugate having a structure represented by formula (V): in, Domain A is a D-configuration T7 polypeptide, an L-configuration T7 polypeptide, a D-configuration T12 polypeptide, or an L-configuration T12 polypeptide; Domain B is a linker and can be attached to any position of the oligonucleotide; n is 1 or 2; R1, R2, R3, and R4 are independently hydrogen or any lipid molecule, excluding R1, R2, R3, and R4 being all hydrogen; Nu is an oligonucleotide.

6. The nucleic acid conjugate according to claim 5, wherein Has any of the following structures: in, Represents the site where the group is covalently bonded; R1 and R2 are independently hydrogen or any one of the following structures: in, represents the site where the group is covalently bonded; k is an integer between 2 and 18, preferably an integer between 4 and 12; m is an integer between 2 and 18, preferably an integer between 4 and 12; and n is an integer between 1 and 8.

7. The nucleic acid conjugate according to claim 5 or 6, wherein Has any of the following structures: in, Indicates the site where the group is covalently bonded; X is O, S or NH; Y is O or S; p is an integer between 0 and 10, preferably an integer between 2 and 6; q is an integer between 1 and 6; r is an integer between 0 and 6, preferably an integer between 0 and 3; R3 and R4 are independently hydrogen or any one of the following structures: in, represents the site where the group is covalently bonded; k is an integer between 2 and 18, preferably an integer between 4 and 12; m is an integer between 2 and 18, preferably an integer between 4 and 12; and n is an integer between 1 and 8.

8. The nucleic acid conjugate according to claim 5, wherein The oligonucleotide is selected from one of small interfering RNA, microRNA, anti-microRNA, microRNA antagonist, microRNA mimic, decoy oligonucleotide, immunostimulant, G-quadrupole, alternative splice, single-stranded RNA, antisense nucleic acid, nucleic acid aptamer, stem-loop RNA, mRNA fragment, and activating RNA; Optionally, the oligonucleotide is a single-stranded oligonucleotide or a double-stranded oligonucleotide; Optionally, the oligonucleotide is a single-stranded oligonucleotide, and the P atom in domain B is connected to the end of the single-stranded oligonucleotide, and the end of the single-stranded oligonucleotide refers to the first 4 nucleotides from one end of the single-stranded oligonucleotide; Optionally, the P atom in domain B is connected to the end of the single-stranded oligonucleotide; Optionally, the P atom in domain B is connected to the 3' end of the single-stranded oligonucleotide; Optionally, the oligonucleotide is a double-stranded oligonucleotide comprising a sense strand and an antisense strand, the P atom in domain B is connected to the end of the double-stranded oligonucleotide, and the end of the double-stranded oligonucleotide refers to the first 4 nucleotides from one end of the sense strand or the antisense strand; optionally, the P atom in domain B is connected to the end of the sense strand or the antisense strand; optionally, the P atom in domain B is connected to the 5' end of the antisense strand; optionally, the P atom in domain B is connected to the 2', 3' or 5' position of the nucleotide in the nucleic acid conjugate by forming a phosphodiester bond.

9. The nucleic acid conjugate according to claim 5, wherein The nucleic acid conjugate has any one of the following structures: in, For siRNA.

10. Use of the nucleic acid conjugate of any one of claims 5 to 9 in the preparation of a medicament for treating and / or preventing a pathological condition or disease caused by the expression of a gene in CNS tissue, eye tissue, muscle tissue and kidney tissue.

11. The use according to claim 10, wherein The gene is SOD1 gene or APP gene.

12. The use according to claim 10, wherein The diseases are amyotrophic lateral sclerosis (ALS), Alzheimer's disease (AD), frontotemporal dementia, Parkinson's disease (PD), Huntington's disease (HD), epilepsy, migraine, spinocerebellar disease, prion disease and Lafora's disease.

13. A method for treating a pathological condition or disease caused by the expression of a gene in CNS tissue, eye tissue, muscle tissue, and kidney tissue, comprising administering the nucleic acid conjugate of any one of claims 5 to 9 to a patient suffering from the disease.

14. A kit comprising the nucleic acid conjugate according to any one of claims 5 to 9.

Images