Method for capturing self-secreted antibody by plasma cells

Abstract

The invention provides a method for capturing a self-secreted antibody by plasma cells, and relates to the technical field of biology. Specifically, the method comprises the following steps: marking the plasma cells with a capture reagent; carrying out single cell wrapping treatment on the labeled plasma cells to realize antibody capture; wherein the capture reagent has the activity of being combined with an antibody secreted by the plasma cells, and the plasma cells have the activity of secreting the antibody. Through the method, the antibody secreted by the plasma cell can be recaptured to the surface of the plasma cell membrane to form a structure similar to memory B cell BCR, so that the corresponding antigen protein specifically recognizes and is combined with the BCR on the surface of the plasma cell membrane, and the antigen-specific plasma cell is screened and sequenced.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for plasma cells to capture antibodies secreted by themselves. Background Art

[0002] Monoclonal antibodies (mAbs) are one of the most important types of biological drugs in the pharmaceutical market. Currently, more than 100 monoclonal antibodies have been approved by the US FDA for a variety of diseases, such as cancer, infectious diseases, autoimmune diseases, and neurological diseases. Given their safety and high target specificity, they have become the most promising class of biological drugs for market development. At the same time, the reactivity of antibodies determines the effectiveness and durability of immune protection after viral infection or vaccination, and it also plays a key role in a variety of autoimmune diseases and cancers. Therefore, the efficient development of fully human antibodies for antibody drug development remains an important topic, especially during viral pandemics, when efficient virus-neutralizing antibodies are urgently needed to treat diseases caused by viral infections.

[0003] The variable region of BCR (B cell antigen receptor) determines its antigen specificity, so it has great diversity. This diversity is mainly achieved through the recombination of the V(D)J genes encoding the variable region of antibodies, junctional diversification and somatic mutation. Therefore, it is very important to develop a high-throughput and efficient method for screening antigen-specific B cells. In mammals, antibodies are divided into five major isotypes or categories according to the heavy chains they contain, namely IgG, IgA, IgD, IgE and IgM. Each type of antibody has different structures, location distribution and functional characteristics. For example, IgE is mainly found in the skin, lungs and mucous membranes. After binding to mast cells, it activates the release of histamine and causes allergic reactions; IgA is mainly found in saliva, tears, mucus, breast milk and intestinal fluid, which can prevent the ingestion and inhalation of pathogens; IgM is mainly found in the blood and lymphatic system, which is the first line of defense against infection and also plays an important role in immune regulation; IgG is the most common antibody, accounting for about 70% to 75% of all immunoglobulins in the body, mainly found in blood and tissue fluids, protecting the body from viral and bacterial infections. Therefore, high-throughput acquisition of complete information on BCR sequences is very important for a more comprehensive understanding of antibody response characteristics.

[0004] Antigen-specific B cells include terminally differentiated plasma cells and memory B cells. Plasma cells can secrete a large amount of antibodies to achieve antibody-mediated humoral immunity, so they are also called antibody secreting cells (ASC). According to their lifespan, they can be divided into short-lived plasma cells and long-lived plasma cells. Long-lived plasma cells determine the long-term antibody immunity level in the body. The response of ASC plays an important protective role in pathogen infection and vaccine immunity. However, the secretion of antibodies against self-antigens by ASC has become a harmful factor in many autoimmune diseases. Although ASC is very important, research on the differentiation, phenotypic characteristics, heterogeneity and long-life mechanism of ASC is very limited. At present, most high-throughput methods for sorting antigen-specific B cells focus on memory B cells and ignore ASC, which limits a more comprehensive and accurate analysis of antibody immune responses.

[0005] Therefore, it is important to develop a platform that can capture antibodies secreted by plasma cells themselves back to the plasma cell membrane surface and study them. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art to at least a certain extent.

[0007] Therefore, in the first aspect of the present invention, the present invention proposes a method for plasma cells to capture antibodies secreted by themselves. According to an embodiment of the present invention, the method includes: labeling the plasma cells with a capture reagent; performing a single cell encapsulation process on the labeled plasma cells to achieve antibody capture; wherein the capture reagent has the activity of binding to the antibodies secreted by the plasma cells, and the plasma cells have the activity of secreting antibodies. In order to obtain information on antibodies secreted by plasma cells at the same time during the analysis or sequencing of antigen-specific B cells, the inventor creatively proposed to label an assembled capture reagent on the surface of plasma cells so that the antibodies secreted by them can be recaptured back to the cell surface to form a structure similar to the memory B cell BCR, so that the corresponding antigen protein can specifically recognize and bind to the BCR on the plasma cell membrane surface, thereby screening and sequencing antigen-specific plasma cells. In the subsequent single-cell library sequencing, it is possible to simultaneously analyze plasma cells and memory B cells. In addition, the method is convenient, efficient and low-cost, which is conducive to adoption and use by different laboratories.

[0008] According to an embodiment of the present invention, the method for plasma cells to capture antibodies secreted by themselves may further include at least one of the following additional technical features:

[0009] According to an embodiment of the present invention, the capture reagent includes rabbit anti-mouse CD138 antibody and bispecific nanoantibody (VHH-anti-rabbit-IgG&VHH-anti-mouse-kappa).

[0010] According to an embodiment of the present invention, the single cell encapsulation process is performed in a droplet generation device.

[0011] According to an embodiment of the present invention, the single cell encapsulation treatment further comprises: incubating the single cell encapsulation treatment product; and demulsifying the incubation treatment product to obtain plasma cells containing self-secretory antibodies.

[0012] According to an embodiment of the present invention, the labeling treatment of the rabbit anti-mouse CD138 antibody is performed at 1 to 5° C. for 20 to 40 minutes.

[0013] According to an embodiment of the present invention, the labeling treatment of the bispecific nanobody (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa) is a reaction at 1 to 5° C. for 20 to 40 minutes.

[0014] According to an embodiment of the present invention, the incubation treatment is performed at a temperature of 30° C. to 40° C. for 1 to 2 hours.

[0015] According to an embodiment of the present invention, the demulsification treatment is performed in the presence of a demulsifier.

[0016] According to an embodiment of the present invention, the demulsification treatment is carried out at 20 to 30° C. for 3 to 10 minutes.

[0017] In a second aspect of the present invention, the present invention proposes a plasma cell. According to an embodiment of the present invention, the plasma cell membrane surface contains antibodies secreted by itself, and the antibodies are captured by the method described in the first aspect. The antibodies secreted by the plasma cell itself are recaptured on the plasma cell membrane surface by the method described in the present invention, so that the plasma cell has a structure similar to that of the memory B cell BCR, which is conducive to the subsequent screening and sequencing of the plasma cell.

[0018] In the third aspect of the present invention, the present invention proposes a method for screening antigen-specific plasma cells. According to an embodiment of the present invention, the method comprises: using a protein antigen labeled with an oligo-barcode to perform antigen labeling treatment on the plasma cells described in the second aspect; sorting the antigen labeling treatment product to obtain the antigen-specific plasma cells; wherein the protein antigen has the activity of binding to the antibodies secreted by the plasma cell membrane surface itself. Through the method described in the present invention, the corresponding protein antigen can specifically recognize and bind to the BCR on the plasma cell membrane surface, thereby screening and obtaining antigen-specific plasma cells.

[0019] According to an embodiment of the present invention, the method for screening antigen-specific plasma cells may further include at least one of the following additional technical features:

[0020] According to an embodiment of the present invention, the antigen labeling treatment is performed at 1° C. to 5° C. for 20 min to 40 min.

[0021] According to an embodiment of the present invention, the sorting process is performed by flow cytometry sorting.

[0022] According to an embodiment of the present invention, the sorting process is performed in the following manner: combining the antigen-labeled product with an anti-His tag dye; performing DAPI staining on the combined product; and obtaining antigen-specific plasma cells based on the fluorescent signal of the staining product.

[0023] In the fourth aspect of the present invention, the present invention proposes the use of antigen-specific plasma cells screened by the method described in the third aspect in constructing a single-cell sequencing library and single-cell sequencing.

[0024] Beneficial effects:

[0025] 1) Low cost, high throughput and easy operation: This technical solution does not require the development of new instruments and equipment. With the help of the droplet generation method and equipment independently developed by BGI School of Life Sciences in the early stage, it can easily realize the transformation of millions of plasma cells at low cost and high throughput, so that the antibodies secreted by themselves can be recaptured on the cell membrane surface;

[0026] 2) By marking a capture reagent capable of capturing secreted antibodies on the surface of plasma cells, the antibodies secreted by plasma cells can be recaptured to the cell membrane surface, forming a structure similar to the BCR of memory B cells, so that antigen-specific plasma cells and memory B cells can be analyzed and sequenced simultaneously.

[0027] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0029] Figure 1 is an experimental flow chart according to an embodiment of the present invention;

[0030] Figure 2 is a droplet generating device according to an embodiment of the present invention;

[0031] Figure 3 This is a flow cytometry detection diagram of CD45R and CD138 expression on the surface of mouse hybridoma cells according to an embodiment of the present invention;

[0032] Figure 4 is a graph showing the ability of a hybridoma to capture an antibody after being labeled with a catch reagent by flow cytometry according to an embodiment of the present invention;

[0033] Figure 5 is the single cell encapsulation efficiency according to an embodiment of the present invention;

[0034] Figure 6 is the culture viability of a single hybridoma cell encapsulated by a droplet according to an embodiment of the present invention;

[0035] Figure 7 It is an antigen protein labeled oligo verification according to an embodiment of the present invention;

[0036] Figure 8 It is a flow cytometric detection of a single hybridoma cell capturing secreted antibodies and binding to fluorescent antigens according to an embodiment of the present invention;

[0037] Fig. 9 This is a schematic diagram of single-cell library construction and sequencing of plasma cell transcriptome, BCR and corresponding antigen oligo library construction according to an embodiment of the present invention. DETAILED DESCRIPTION

[0038] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention. If no specific techniques or conditions are specified in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used that do not specify the manufacturer are all conventional products that can be obtained commercially.

[0039] The present invention will be further described below by specific examples. It should be noted that the examples described below are only used to explain the present invention, but not to limit the present invention.

[0040] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the present invention belongs.

[0041] In this document, unless otherwise specified, the terms "include" or "comprising" are open expressions, that is, including the contents specified in the application but not excluding other contents.

[0042] As used herein, unless otherwise stated, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0043] In this document, unless otherwise specified, the terms "first" and "second" are used for descriptive purposes only and are not to be understood as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of the features. In the description of this application, "plurality" means at least two, such as two, three, etc., unless otherwise clearly specified.

[0044] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0045] In this article, unless otherwise specified, "cell barcode" or "oligo-barcode" refers to a nucleic acid molecule, which can be an RNA molecule or a DNA molecule. Different expressions are only used to indicate the different functions of these nucleic acid sequences. Those skilled in the art can understand the functions of the sequences represented by various expressions according to the context.

[0046] Based on the defects of existing technologies: 1) low throughput, long time consumption, and high workload: such as hybridoma technology; 2) limited detection parameters: such as hybridoma technology and phage display technology can only obtain antigen-specific antibody variable region sequence information; flow cytometry combined with sequencing can detect multiple cell surface protein information, but cannot be combined with BCR sequence information to correspond to the same cell; the newly developed Beacon, due to the limited detection channels of the instrument itself, can often only detect 2 to 4 parameters; 3) Detection of B cell types: most technologies can only detect antibody-secreting cells or memory B cells, and it is difficult to take both into account efficiently; 4) Lack of convenience and applicability: The newly developed Beacon has high instrument costs and limited detection parameters, which is not conducive to widespread promotion and application. Therefore, in the present invention, a capture reagent capable of capturing secreted antibodies is marked on the surface of plasma cells, and then a single plasma cell is incubated by droplet encapsulation, so that the antibodies secreted by a single plasma cell are recaptured on the cell membrane surface, forming a structure similar to the memory B cell BCR, and then antigen-specific B cells are identified and screened with oligo and fluorescently labeled antigen proteins, and subsequent single-cell library sequencing can be performed based on the antigen-specific B cells, so as to realize the integration of the full-length BCR sequence (including antibody variable region and constant region), transcriptome expression and antigen-specific information in the same single cell. The principle of the method of the present invention combines the advantages of flow cytometry and droplet microfluidics, antigen protein fluorescent labeling and oligo-barcode dual labeling technology, single-cell sequencing and single-molecule sequencing analysis technology, and makes full use of the advantages of convenient droplet generation technology based on negative pressure and sequencing platform developed by BGI in the early stage, so that the new method can not only be applied to antibody mining with low cost and high efficiency, but also is more conducive to a comprehensive analysis of antibody-mediated immune response mechanisms.

[0047] Specifically, the present invention proposes a method for plasma cells to capture antibodies secreted by themselves, by capturing the antibodies secreted by plasma cells themselves to the surface of their cell membranes, thereby screening them to obtain antigen-specific plasma cells, and performing high-throughput analysis, sorting and sequencing based on the antigen-specific plasma cells, which will be described in detail below.

[0048] Methods for plasma cells to capture their own secreted antibodies

[0049] The present invention proposes a method for plasma cells to capture antibodies secreted by themselves. According to an embodiment of the present invention, the method includes: labeling the plasma cells with a capture reagent; performing a single cell encapsulation treatment on the labeled plasma cells to achieve antibody capture; wherein the capture reagent has the activity of binding to the antibodies secreted by the plasma cells, and the plasma cells have the activity of secreting antibodies. Generally, after plasma cells generate antibodies, they will release them into the surrounding tissue fluid without attaching to the surface of plasma cells. In order to be able to obtain information on antibodies secreted by plasma cells during the subsequent analysis and sequencing of antigen-specific B cells, the inventor creatively proposed to label an assembled capture reagent on the surface of plasma cells so that the antibodies secreted by them can be recaptured back to the cell membrane surface, forming a structure similar to the memory B cell BCR, so as to achieve the purpose of simultaneously analyzing and sequencing plasma cells and memory B cells. In addition, the method is convenient, efficient and low-cost, which is conducive to adoption and use by different laboratories.

[0050] According to some embodiments of the present invention, the capture reagent includes rabbit anti-mouse CD138 antibody and bispecific nano antibody (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa), wherein the rabbit anti-mouse CD138 antibody can specifically bind to mouse plasma cells, and then the bispecific nano antibody (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa) can bind to the rabbit anti-mouse CD138 antibody, while capturing the antibodies secreted by the plasma cells, and finally achieving the effect of capturing the secreted antibodies back to the cell membrane surface. The capture reagent can specifically identify plasma cells, and the combination mode is flexible and variable, and changes and modifications can be made in different research backgrounds to flexibly adapt to scientific research needs.

[0051] In order to ensure that each plasma cell only captures the antibodies it secretes, the labeled plasma cells are subjected to single-cell encapsulation. The encapsulation process uses droplet microfluidics technology, which can encapsulate a single cell in a tiny droplet, each of which contains a single cell, ensuring that each plasma cell only captures the antibodies it secretes.

[0052] According to some embodiments of the present invention, the single cell encapsulation process is performed in a droplet generation device. The droplet generation device used in the present invention is a convenient droplet generation device based on negative pressure developed in the early stage by the BGI School of Life Sciences, and the droplet generation device uses the DNBelab C4 device developed by MGI.

[0053] In order to obtain B cells, after the single cell encapsulation treatment, the process further includes: incubating the single cell encapsulation treatment product; and demulsifying the incubation treatment product to obtain plasma cells containing self-secreted antibodies. Among them, the incubation treatment is to enable plasma cells to secrete antibodies and better capture the antibodies secreted by themselves; the demulsification treatment is to break the droplets generated by the encapsulation treatment and recover the single cells in the droplets. At this time, the single cells in the droplets are plasma cells that have captured the antibodies secreted by themselves, that is, the cell membrane surface of the plasma cells carries the antibodies secreted by themselves (the present invention refers to plasma cells carrying antibodies secreted by themselves as B cells).

[0054] According to some embodiments of the present invention, rabbit anti-mouse CD138 antibody labeling is performed at 1-5°C for 20-40 min, for example, 1°C, 2°C, 3°C, 4°C, 5°C, etc. for 20 min, 25 min, 30 min, 35 min, 40 min, etc. Therefore, the capture reagent can be better labeled on the surface of the plasma cell membrane, thereby laying a foundation for better capturing the antibodies secreted by the plasma cells themselves.

[0055] According to some embodiments of the present invention, the bispecific nanobody (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa) labeling is carried out at 1-5°C for 20-40 minutes, for example, it can be carried out at 1°C, 2°C, 3°C, 4°C, 5°C, etc. for 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, etc. Therefore, the capture reagent can be better labeled on the surface of the plasma cell membrane, thereby laying the foundation for better capturing the antibodies secreted by the plasma cells themselves.

[0056] According to some embodiments of the present invention, the incubation treatment is carried out at a temperature of 30-40°C for 1-2 hours, for example, it can be carried out at 30°C, 32°C, 35°C, 37°C, 40°C, etc. for 1 hour, 1.5 hours, 2 hours, etc.

[0057] According to some embodiments of the present invention, the demulsification treatment is performed in the presence of a demulsifier.

[0058] According to some embodiments of the present invention, the demulsification treatment is carried out at 20-30°C for 3-10 minutes, for example, at 20°C, 22°C, 25°C, 27°C, 30°C, etc. for 3 minutes, 5 minutes, 7 minutes, 10 minutes, etc. Therefore, the droplets can be completely broken and the single cells in the droplets can be released.

[0059] Plasma cells

[0060] The present invention provides a plasma cell. According to an embodiment of the present invention, the plasma cell membrane surface contains antibodies secreted by the plasma cell itself, and the antibodies are captured by the method described in the first aspect. The antibodies secreted by the plasma cell itself are recaptured on the plasma cell membrane surface by the method described in the present invention, so that the plasma cell has a structure similar to that of the memory B cell BCR, which is conducive to the subsequent screening and sequencing of the plasma cell.

[0061] Method for screening antigen-specific plasma cells

[0062] The present invention proposes a method for screening antigen-specific plasma cells. According to an embodiment of the present invention, the method comprises: using a protein antigen marked with an oligo-barcode to perform antigen labeling treatment on the above-mentioned plasma cells; sorting the antigen labeling treatment product to obtain the antigen-specific plasma cells; wherein the protein antigen has the activity of binding to the antibody secreted by the plasma cell membrane surface itself. Through the method described in the present invention, the corresponding protein antigen can specifically recognize and bind to the BCR on the plasma cell membrane surface, thereby screening and obtaining antigen-specific plasma cells.

[0063] Antigen labeling refers to the use of antigens to label antibodies on the cell membrane of plasma cells, thereby analyzing the capture of antibodies on the cell membrane and screening antigen-specific plasma cells; sorting is to obtain antigen-specific plasma cells that have the ability to recognize and bind to antigen molecules. By adopting these two steps, antigen-specific plasma cells can be quickly screened out, laying the foundation for subsequent library construction and sequencing.

[0064] According to some embodiments of the present invention, the antigen labeling treatment is carried out at 1°C to 5°C for 20min to 40min, for example, it can be carried out at 1°C, 2°C, 3°C, 4°C, 5°C, etc. for 20min, 25min, 30min, 35min, 40min, etc. Therefore, it can fully bind to the antibody on the cell membrane surface.

[0065] According to some embodiments of the present invention, the sorting process is performed by flow cytometry sorting.

[0066] In order to obtain antigen-specific plasma cells, the sorting process is carried out by the following method: combining the antigen-labeled product with the anti-His tag dye; performing DAPI staining on the combined product; and obtaining antigen-specific plasma cells based on the fluorescent signal of the staining product. Among them, the anti-His tag dye can bind to the antigen on the surface of the plasma cell membrane in the antigen-labeled product, so that the plasma cell carries a fluorescent signal. Through further staining and analysis, plasma cells carrying antigens can be screened and obtained, and the plasma cells have antigen specificity.

[0067] use

[0068] The present invention proposes the use of antigen-specific plasma cells screened by a method for screening antigen-specific plasma cells in constructing a single-cell sequencing library and single-cell sequencing.

[0069] According to some embodiments of the present invention, the RNA of the antigen-specific plasma cells is reverse transcribed, and the reverse transcription product is subjected to transcriptome library second generation sequencing. This method lays the foundation for subsequent sequencing of antigen-specific plasma cells and obtaining their transcriptome information and target antigen protein information.

[0070] According to some embodiments of the present invention, the RNA of the antigen-specific plasma cells is reverse transcribed; and the reverse transcription product is subjected to BCR enrichment treatment, and the BCR enrichment treatment is performed using a DNA probe for the BCR constant region; the BCR enrichment product is subjected to single-molecule library construction and three-generation single-molecule length long sequencing. Using the method described in the present invention, BCR can be enriched and used as a template for library construction, laying the foundation for subsequent sequencing of BCR to obtain its sequence information.

[0071] It should be noted that the "BCR" mentioned in the present invention refers to antibodies bound to the surface of plasma cells.

[0072] According to some embodiments of the invention, the DNA probe is modified with biotin.

[0073] According to some embodiments of the present invention, the DNA probe is complementary to at least a portion of the sequence of the cDNA of the BCR constant region.

[0074] According to some embodiments of the invention, the enrichment process is performed by magnetic beads.

[0075] According to some embodiments of the present invention, the enrichment process is specifically: hybridizing the cDNA of the BCR constant region with the DNA probe targeting the BCR constant region, and then enriching the BCR with magnetic beads, wherein the magnetic beads can capture the DNA probe labeled with biotin, thereby enriching the BCR.

[0076] The schematic flow diagram of the method of the present invention is as follows Figure 1 As shown in the figure, it is mainly divided into five parts: (1) preparation of single-cell suspension of plasma cells; (2) cell staining and labeling capture reagents; (3) droplet encapsulation of single cells; (4) oligo-barcode labeling of antigens; (5) flow cytometry analysis and sorting of antigen-specific plasma cells; (6) single-cell library construction and sequencing: including transcriptome and BCR library construction and sequencing.

[0077] Among them, single-cell sequencing of plasma cell transcriptome, BCR and corresponding antigen oligo library construction schematic diagram is as follows Fig. 9 As shown, during the process of reverse transcription of plasma cells to generate cDNA in single-cell library construction, both the cell's RNA and antigen oligo will carry cell label sequences. Part of the cDNA is used for transcriptome and Antigen-barcode sequencing, and the other part of the cDNA is used for BCR enrichment. Specifically, it is hybridized with a biotin-modified DNA probe specific to the BCR constant region, enriched with streptavidin magnetic beads, and then amplified by PCR. After single-molecule PCR full-length sequencing, the transcriptome of a single B cell, the full length of BCR, and the corresponding antigen information are integrated and analyzed.

[0078] The scheme of the present application will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present application and should not be considered as limiting the scope of the present application. If no specific technology or conditions are indicated in the embodiments, the technology or conditions described in the literature in this area or the product specification are carried out. The reagents used or the instruments that do not indicate the manufacturer are all conventional products that can be obtained commercially.

[0079] Example 1

[0080] 1. Test and optimize the labeling of cell membrane surface capture reagents:

[0081] The cells were labeled using rabbit anti-mouse CD138 antibody and bispecific nanoantibodies (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa). The specific steps are as follows:

[0082] (1) Take 2×10 6 Antibody secreting cells (hybridoma or immune mouse plasma cells) were resuspended with 200 μl cell staining solution and divided into two tubes (100 μl in each tube). 5 μl Abflo 488 Rabbit anti-mouse CD138 (Abclonal, Cat: A24153) was added to one tube (experimental group). After staining at 4°C for 30 minutes, 1 ml cell staining solution was added, centrifuged at 300 g for 5 minutes, and washed twice. The other tube (control group) was placed on ice without any operation.

[0083] (3) After washing, the experimental group cells were resuspended in 100 μl cell staining solution, in which different concentrations (0 ng / μl, 400 ng / μl, 4000 ng / μl) of bispecific nanoantibodies (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa) (reference: Tino Pleiner, et al. 2017) were diluted. The cells were incubated at 4°C for 45 minutes, washed with 1 ml cell staining buffer (centrifuged at 300 g for 5 min), and 100 μl cell staining solution containing 5 μl FITC mouse anti-human CD31 (Biolegend, catalog number: 303104) was added to test the capture efficiency of the capture reagent for mouse IgG antibodies. The results are shown in Figure 2. Figure 4 As shown, as the concentration of the added bispecific antibody increases, the capture ability of the capture reagent for mouse antibodies also increases;

[0084] (4) The supernatant was discarded and the experimental and control groups were resuspended in 500 μl of working buffer (composed of RPMI1640 + 20% fetal bovine serum FBS + 1% double antibody P / S + 100 μM non-essential amino acids + 100 μM β-mercaptoethanol + 0.1% F68) to a cell concentration of 1000 cells / μl.

[0085] 2. Droplet generation of single cell encapsulation and incubation:

[0086] In this step, the droplet generation equipment will be assembled. The droplet generation equipment and process are as follows Figure 2 As shown, droplet generation buffer, cell suspension and droplet generation oil are added to the droplet generation chip to generate droplets. The specific operation steps are as follows:

[0087] (1) Assemble the droplet generation device, add 200 μl of cell suspension, 200 μl of working buffer and 800 μl of droplet generation oil (BIO-RAD#cat:1864006) into the injection hole of the droplet generation chip, pull the syringe from 12 ml to 20 ml, and generate droplets by generating negative pressure;

[0088] (2) The generated droplets were removed and transferred to a 15 ml centrifuge tube and placed in a 37°C incubator for 1 to 2 h.

[0089] 3. Detection and optimization of cell culture viability in droplets:

[0090] (1) Take 0.5×10 6For each antibody-secreting cell (hybridoma or immune mouse plasma cell), add the cell viability dye calcein-AM (cat: 750001885) to the cell suspension at a ratio of 1:5000, stain at 37°C for 20 minutes, add 1 ml of cell staining solution (PBS + 1% FBS), centrifuge at 300g for 5 minutes, and wash twice;

[0091] (2) After washing, resuspend the cells in 500 μl of working buffer (composed of RPMI1640 + 20% fetal bovine serum FBS + 1% double antibody P / S + 100 μM non-essential amino acids + 100 μM β-mercaptoethanol + 0.1% F68) to generate droplets after the cell concentration reaches 1000 cells / μl;

[0092] (3) Gently transfer the droplets to a 15 ml centrifuge tube and place it in a 37 °C cell culture incubator for incubation. Take a small amount of droplets on a cell counting plate at 1 h, 2 h, and 4 h after incubation to take fluorescent photos. At the same time, take 100 μl of the droplets to break the emulsion and recover the B cells. Flow cytometry is used to detect the fluorescence intensity of the cell viability dye calcein am, as shown in Figure 2. Figure 6 As shown, the fluorescence intensity of the viability dye displayed by the cells in the droplets of the fluorescent image and the flow cytometry results showed that the cells maintained a good viability state within 4 hours of culture;

[0093] 4. Oligo-barcode labeled antigen:

[0094] The steps for oligo-barcode labeling antigen are as follows:

[0095] (1) Activation: First, take 100 μl of antigen protein and 1 μl of DBCO-PEG5-NHS and mix them evenly (molar concentration ratio is 1:25), and incubate at room temperature for 30 minutes. After the incubation, add 10 μl of 1 M Tris (pH 7.4) to terminate the reaction, and incubate at room temperature for 10 minutes.

[0096] (2) Purification: Add all the activated products to the ultrafiltration tube and centrifuge at 4℃13000g for 10min. Collect the filtrate into a 1.5ml centrifuge tube, then add 500μl PBS to the ultrafiltration tube, centrifuge at 4℃13000g for 5min, and collect the filtrate into a 1.5ml centrifuge tube (repeat the operation once). Finally, flip the ultrafiltration column and centrifuge the protein-DBCO trapped on the ultrafiltration column membrane. (Make sure the remaining liquid reaches 100 microliters)

[0097] (3) Oligo coupling: Take out the oligo powder and centrifuge at 10000 rpm for 10 min. Add the collected protein-DBCO liquid to the oligo powder and incubate at 37°C for 24 h to obtain antigen-oligo.

[0098] (4) SDS-PAGE verification of coupling effect: Pour the loading buffer into the electrophoresis tank, take 5 μl of marker for sample loading, take 8 μl of coupling product and mix it with 2 μl of SDS protein loading buffer and then load it.

[0099] 5. Flow cytometry to isolate antigen-specific B cells:

[0100] After the incubation is completed, the droplets are removed and the B cells are recovered by demulsification. Some cells can be taken for flow cytometry analysis to sort out antigen-specific B cells. The specific operation steps are as follows:

[0101] (1) Demulsification: Take out 200 μl of droplets, add 20 μl of demulsifier (1H,1H,2H,2H-perfluoro-1-octanol; 370533), and place at room temperature for 4-5 min. After demulsification, add culture medium and gently blow up the upper layer of B cells to collect B cells;

[0102] (2) Staining: The collected B cells were centrifuged at 300 g for 5 min, the supernatant was discarded, and the cells were resuspended in 100 μl of staining buffer, 1 μl of the antigen-oligo in step 4 was added, and the cells were incubated at 4°C for 30 min. After the incubation, 2 ml of PBS (containing 0.1% F68) was added, and the cells were centrifuged at 300 g for 5 min, and washed twice. The cells were then resuspended in 100 μl of staining buffer, 1 μl of anti-histag-AF647 was added, and the cells were incubated at 4°C for 30 min. After the incubation, 2 ml of PBS (containing 0.1% F68) was added, and the cells were centrifuged at 300 g for 5 min, and washed twice.

[0103] (3) Flow cytometry: The collected B cells were centrifuged at 300 g for 5 min, the supernatant was discarded, and the cells were resuspended in 200 μl of PBS. Then 0.2 μl of DAPI (cat: 564907) was added and detected by flow cytometry. B cells were sorted based on the fluorescent signal.

[0104] 6. Single cell transcriptome, antigen oligo and BCR library construction and sequencing analysis:

[0105] In this step, cell preparation and subsequent single-cell transcriptome and single-molecule library sequencing and analysis will be performed. The specific steps are as follows:

[0106] (1) The B cells sorted by flow cytometry are sequenced and analyzed according to the standard process of single-cell transcriptome. The sequencing results are compared with the known oligo information. Because the transcriptome information and antigen protein oligo information of the same B cell have the same cell-barcode, bioinformatics integration analysis can be performed to achieve the integration of antigen protein and corresponding B cell transcriptome and BCR information.

[0107] (2) Part of the cDNA was removed and the BCR was enriched using an RNA probe targeting the constant region of the antibody. Finally, the full-length sequence of the BCR was obtained through single-molecule sequencing analysis.

[0108] Example 2

[0109] Analysis of novel coronavirus-specific hybridoma cells. The specific process is as follows:

[0110] 1. COVID-19 specific hybridoma cell labeling capture reagent:

[0111] (1) First, test the expression of CD138 on the cell surface: This method uses plasma cells as the main cell type for research. The representative membrane protein of plasma cells is CD138. The antibody capture reagent uses this protein as an anchor target to mark the cells. Therefore, first verify the expression of CD138 protein on the membrane surface of hybridoma cells by staining with fluorescent antibodies against mouse CD138, such as Figure 3 As shown, 8D3 hybridoma cells highly expressed CD138 relative to control Jurkat cells;

[0112] (2) Then the hybridoma cell line was labeled with the capture reagent. The specific process was as follows: 1×10 6 Hybridoma cells (8D3 cell line or 2H2 cell line) were resuspended in 100 μl cell staining solution (PBS + 1% FBS), and 1 μl rabbit anti-mouse CD138 antibody rabbit anti-CD138-streptavidin (sinobiological, 50641-R004) was added. After staining at 4°C for 30 minutes, 2 ml of cell staining solution (PBS + 1% FBS) was added, and the cells were centrifuged at 300 g for 5 minutes and washed twice. After washing, the cells were washed with 100 μl After staining with 400 ng / μl of bispecific nanoantibodies (VHH-anti-rabbit-IgG & VHH-anti-mouse-kappa) at 4°C for 30 minutes, add 2 ml of cell staining solution, centrifuge at 300g for 5 minutes, and wash twice; discard the supernatant and resuspend the cells with 1000 μl working buffer (composed of RPMI1640 + 20% fetal bovine serum FBS + 1% bispecific P / S + 100 μM non-essential amino acids + 100 μM β-mercaptoethanol + 0.1% F68) to a cell concentration of 1000 cells / μl.

[0113] 2. Droplet generation of single cell encapsulation and incubation:

[0114] (1) Assemble the droplet generation equipment such as Figure 2As shown, 200 μl of cell suspension, 200 μl of working buffer and 800 μl of droplet generation oil (BIO-RAD#cat:1864006) were added to the injection holes of the droplet generation chip, and the syringe was quickly pulled from 12 ml to 20 ml to generate droplets using the principle of generating negative pressure;

[0115] (2) The device can achieve droplet encapsulation of hundreds of thousands of B cells within 10 minutes. Figure 5 As shown, more than 80% of the cells are in a single-cell package state, and nearly 20% of the cells are in a multi-cell package state. Of course, due to the Poisson distribution problem, nearly 75% of the generated droplets are empty droplets without cells.

[0116] (3) The generated droplets were removed and transferred to a 15 ml centrifuge tube and placed in a 37°C incubator for 1 to 2 h.

[0117] 3. Oligo-barcode marking of the receptor binding region (RBD) of the SARS-CoV-2 S protein:

[0118] (1) Activation: First, 100 μl of RBD protein was mixed with 1 μl of DBCO-PEG5-NHS (molar concentration ratio was 1:25) and incubated at room temperature for 30 min. After the incubation, 10 μl of 1 M Tris solution (pH 7.4) was added to terminate the reaction and incubated at room temperature for 10 min.

[0119] (2) Purification: Add all the activated products to the ultrafiltration tube and centrifuge at 4℃13000g for 10min. Collect the filtrate into a 1.5mL centrifuge tube, then add 500μl of PBS to the ultrafiltration tube, centrifuge at 4℃13000g for 5min, and collect the filtrate into a 1.5mL centrifuge tube (repeat the operation once). Finally, flip the ultrafiltration column and centrifuge the protein-DBCO trapped on the ultrafiltration column membrane (make sure the remaining liquid reaches 100μl).

[0120] (3) Oligo coupling: Take out the oligo powder and centrifuge at 10000 rpm for 10 min. Add the collected protein-DBCO liquid to the oligo powder and incubate at 37°C for 24 h to obtain RBD-oligo.

[0121] oligo sequence: TTGTCTTCCTAAGACCGCTTGGCCTCCGACTTTGACGTCCTT TCTGCGTGACGTCCTTCCTTCCNNNNNNNNBAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO: 1)

[0122] SDS-PAGE verification of coupling effect: Pour the loading buffer into the electrophoresis tank, take 5μl marker for sample loading, take 8μl coupling product and mix it with 2μl SDS protein loading buffer and then load it. The results of RBD protein coupling are attached. Figure 7 , which can achieve successful coupling of RBD protein to oligo;

[0123] 4. Flow cytometry sorting of COVID-19 specific hybridoma cells:

[0124] (1) Demulsification: Take out 200 μl of the droplets incubated in step 2, add 20 μl of demulsifier (1H,1H,2H,2H-perfluoro-1-octanol; 370533), and place at room temperature for 4-5 min. After demulsification, add culture medium and gently blow up the upper layer of cells to collect hybridoma cells;

[0125] (2) Staining: The collected hybridoma cells were centrifuged at 300 g for 5 min, the supernatant was discarded, and the cells were resuspended in 100 μl of staining buffer, 1 μl of RBD-oligo prepared in step 3 was added, and the cells were incubated at 4°C for 30 min. After the incubation, 2 ml of cell staining solution was added, and the cells were centrifuged at 300 g for 5 min, washed twice, and then resuspended in 100 μl of staining buffer, 1 μl of anti-histone tag fluorescent antibody anti-histag-AF647 (biolegend, 362611) was added, and the cells were incubated at 4°C for 30 min. After the incubation, 2 ml of cell staining solution was added, and the cells were centrifuged at 300 g for 5 min, and washed twice;

[0126] (3) Flow cytometry: The collected hybridoma cells were centrifuged at 300 g for 5 min, the supernatant was discarded, and the cells were resuspended in 200 μl of PBS. Then 0.2 μl of DAPI (cat: 564907) was added and detected by flow cytometry. The hybridoma cells were sorted based on the fluorescence signal.

[0127] The 8D3-experimental group was labeled with capture antibodies on the cell membrane surface, and the NC group was used as a control without labeling capture antibodies. After the two groups of cells were encapsulated in droplets and incubated, the droplets were broken to recover the cells, and the antigens were fluorescently labeled with APC to obtain RBD-APC, which was combined with cells. The intensity of cell surface antibody binding to antigens was detected by flow cytometry. The experimental results are shown in the figure. Figure 8 As shown, it can be seen that the capture reagent can efficiently capture the secreted antibodies.

[0128] 5. Single cell transcriptome, RBD-oligo and hybridoma cell antigen receptor library construction and sequencing analysis:

[0129] (1) The hybridoma cells sorted by flow cytometry were sequenced and analyzed according to the standard process of single-cell transcriptome to obtain transcriptome information and antigen-specific information;

[0130] (2) In Fig. 9 In the single-cell library construction process shown, after all mRNAs are reverse transcribed into cDNA and carry cell tag sequences, part of the cDNA is taken out, and the hybridoma cell antigen receptor is enriched using RNA probes targeting the antibody constant region. Finally, the full-length sequence of the hybridoma cell antigen receptor is obtained by single-molecule sequencing analysis (using instruments such as Oxford Nanopore or PacBio). The antigen receptor sequence information of 2H2 used in this experiment has been submitted to Genbank, and the query codes are: 2H2-VH (MW271803), 2H2-VL (MW271804), and the antigen receptor sequence information of 8D3 and its structural information binding to the corresponding antigen protein have been submitted to the Protein database, and the query codes are 8D3-(7W9F).

[0131] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0132] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. A method for plasma cells to capture antibodies secreted by themselves, characterized in that: include: performing a labeling treatment of the plasma cells with a capture reagent; The labeled plasma cells are subjected to single-cell encapsulation treatment to achieve antibody capture; Wherein, the capture reagent has the activity of binding to the antibody secreted by the plasma cell, and the plasma cell has the activity of secreting the antibody.

2. The method according to claim 1, characterized in that The capture reagents include rabbit anti-mouse CD138 antibodies and bispecific nanobodies.

3. The method according to claim 1, characterized in that The single cell encapsulation process is performed in a droplet generation device.

4. The method according to claim 3, characterized in that The single cell encapsulation process further comprises: Incubating the single-cell encapsulation product; The incubation product is subjected to demulsification treatment to obtain plasma cells containing self-secretory antibodies.

5. The method according to claim 2, characterized in that: The rabbit anti-mouse CD138 antibody labeling treatment is carried out at 1-5°C for 20-40 minutes; The labeling treatment of the bispecific nanobody is carried out at 1 to 5° C. for 20 to 40 minutes.

6. The method according to claim 4, characterized in that The incubation treatment is carried out at a temperature of 30° C. to 40° C. for 1 to 2 hours.

7. The method according to claim 4, characterized in that The demulsification treatment is carried out under the condition of the presence of a demulsifier; The demulsification treatment is carried out at 20 to 30° C. for 3 to 10 minutes.

8. A plasma cell, characterized in that The plasma cell membrane surface contains antibodies secreted by the plasma cell itself, and the antibodies are captured by the method according to any one of claims 1 to 7.

9. A method for screening antigen-specific plasma cells, characterized in that: include: Using a protein antigen labeled with an oligo-barcode to perform antigen labeling on the plasma cells of claim 8; Sorting the antigen-labeled product to obtain the antigen-specific plasma cells; The protein antigen has the activity of binding to the antibody secreted by the plasma cell membrane surface itself.

10. The method according to claim 9, characterized in that The antigen labeling treatment is carried out at 1°C to 5°C for 20min to 40min; The sorting process is performed by flow cytometry sorting.

11. The method according to claim 10, characterized in that The sorting process is carried out in the following manner: The antigen-labeled product is combined with an anti-His tag dye; The combined treatment products were subjected to DAPI staining; Based on the fluorescent signal of the dyeing treatment product, antigen-specific plasma cells are obtained.

12. Use of antigen-specific plasma cells screened by the method according to any one of claims 9 to 11 in constructing a single-cell sequencing library and single-cell sequencing.

Images