Double-stranded ribonucleic acid for inhibiting SERPINF2 protein expression, and modifier, conjugate and application thereof

Abstract

The present disclosure relates to a double-stranded ribonucleic acid for inhibiting SERPINF2 gene expression, and modifiers, conjugates and uses thereof. Specifically, the present disclosure relates to a double-stranded ribonucleic acid, a double-stranded ribonucleic acid modifier, a double-stranded ribonucleic acid conjugate, a prodrug, a pharmaceutical composition and use thereof for inhibiting SERPINF2 gene expression, and a method for inhibiting intracellular SERPINF2 gene expression. The double-stranded ribonucleic acid as well as the modifier, the conjugate and the prodrug thereof provided by the invention can be combined in cells to form an RNA induced silence complex (RISC), cut mRNA transcribed by the SERPINF2 gene, efficiently and specifically inhibit the expression of the SERPINF2 gene, are used for treating SERPINF2 gene mediated diseases, and have important application prospects in clinical disease treatment.

Description

Technical Field

[0001] The present disclosure belongs to the field of biomedicine. Specifically, the present disclosure relates to a double-stranded RNA, a double-stranded RNA modification, a double-stranded RNA conjugate, a prodrug, a pharmaceutical composition and uses capable of inhibiting SERPINF2 gene expression, and a method for inhibiting SERPINF2 gene expression in a cell. Background Art

[0002] Thrombosis is the formation of a blood clot within a blood vessel, which can block the normal flow of blood through the circulatory system. When a blood clot forms in a vein, it is called venous thromboembolism, which can lead to deep vein thrombosis and pulmonary embolism. When a clot forms in an artery, it is called atherothrombosis, which can lead to heart attack and stroke. The common treatment for thrombosis is usually non-selective anticoagulation. Unfortunately, however, this treatment lacks specificity and can lead to excessive bleeding.

[0003] SERPINF2, also known as A2AP, is a member of the large family of serine protease inhibitors (serpins). Elevated A2AP levels are associated with an increased risk of developing thrombosis-related diseases, such as venous thromboembolism, deep vein thrombosis, pulmonary embolism, prosthetic valve thrombosis, atherothrombosis, heart attack, stroke, fibrinolytic disorders, hypofibrinolysis, and bifibrinolysis. SERPINF2 is a plasma protease inhibitor that inhibits proteins such as plasmin, trypsin, tatriptase-3 / TMPRSS7, and chymotrypsin. A2-antiplasmin (A2AP) or a2-plasmin inhibitor (SERPINF2) is known as the main inhibitor of plasmin. A2AP rapidly inactivates plasmin to form a covalent plasmin-A2AP (protease-serine) complex, which in the blood is a marker of plasmin generation in clinical states associated with plasminogen activation. Activated factor XIII cross-links A2AP to fibrin during fibrin formation, and the cross-linking of A2AP to fibrin significantly enhances the resistance of fibrin to plasmin degradation.

[0004] In summary, by inhibiting the expression of SERPINF2 gene in patients, it is possible to prevent and treat diseases related to thrombosis, such as plasminogen deficiency, venous thrombosis, venous thromboembolism, deep vein thrombosis, pulmonary embolism, prosthetic valve thrombosis, post-thrombotic syndrome, atherosclerotic thrombosis, heart attack, stroke, fibrinolysis disorder, hypofibrinolysis, nonfibrinolysis, ischemic stroke, atrial fibrillation, myocardial infarction, peripheral arterial disease, dynamic thrombosis, coronary artery disease, microvascular thrombosis, ischemic brain injury, brain swelling, cerebral hemorrhage and death after thromboembolic stroke. At present, there are no drugs targeting only the expression of such genes on the market, so it is of great value to develop drugs targeting SERPINF2. Summary of the invention

[0005] Problem that the invention aims to solve

[0006] In view of the problems existing in the prior art, for example, more SERPINF2 inhibitors need to be developed for the treatment of SERPINF2-related diseases including unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory impairment, ischemic stroke, preeclampsia, fibrinolytic imbalance, fibrotic diseases, myocardial infarction, heart failure and thrombosis. The present disclosure aims to provide a series of double-stranded RNAs, double-stranded RNA modifications, double-stranded RNA conjugates, prodrugs and pharmaceutical compositions for inhibiting SERPINF2 gene expression, which can be effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of SERPINF2 genes, thereby being able to selectively and effectively inhibit SERPINF2 gene expression and achieve the purpose of disease treatment, and have important application prospects in clinical disease treatment.

[0007] Solutions for solving problems

[0008] The present invention aims to provide a composition comprising double-stranded ribonucleic acid (such as siRNA), double-stranded ribonucleic acid modifications, double-stranded ribonucleic acid conjugates or their prodrugs, which can be effectively applied to RNA-induced silencing complex (RISC)-mediated cleavage of RNA transcripts of the SERPINF2 gene, thereby selectively and effectively inhibiting the expression of the SERPINF2 gene and achieving the purpose of disease treatment.

[0009] [1] A double-stranded RNA, comprising a sense strand and an antisense strand, wherein the sense strand is reverse complementary to the antisense strand and / or substantially reverse complementary to form a double-stranded region of the double-stranded RNA;

[0010] The sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence;

[0011] The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 17.

[0012] [2] The double-stranded RNA according to [1], wherein the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558.

[0013] [3] The double-stranded RNA according to [1] or [2], wherein the sense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides; or the antisense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

[0014] [4]. The double-stranded RNA according to [3], wherein the nucleotide sequence of the sense strand is or comprises a sequence A that differs by no more than 1 nucleotide from a sequence consisting of 15 to 28 consecutive nucleotides, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33.

[0015] [5]. The double-stranded RNA according to [4], wherein the nucleotide sequence of the antisense strand is or comprises a sequence B that differs by no more than 1 nucleotide from a sequence that is reverse complementary and / or substantially reverse complementary to a sequence consisting of 15 to 28 consecutive nucleotides, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33, 558.

[0016] [6] The double-stranded ribonucleic acid according to any one of [1] to [5], wherein the length of the double-stranded region is 15-25 nucleotides, preferably 18-23 nucleotides, more preferably 18-21 nucleotides, and more preferably 19, 21 or 23 nucleotides.

[0017] [7] The double-stranded RNA according to any one of [1] to [6], wherein

[0018] The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or,

[0019] The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or,

[0020] The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or,

[0021] The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.

[0022] [8] The double-stranded RNA according to any one of [1] to [7], wherein the sense strand comprises any one of SEQ ID NOs: 34 to 133, 234 to 250, 426 to 427, 499 to 501, 513 to 518 shown in Table 1 and Table 1-1, and the antisense strand comprises any one of SEQ ID NOs: 134 to 233, 251 to 267, 428 to 429, 502 to 504, 519 to 525 shown in Table 1 and Table 1-1;

[0023] The sense strand and antisense strand are selected from the sense strand and antisense strand of any one siRNA shown in Table 1 or Table 1-1;

[0024] The sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA1 to siRNA100, siRNA228 to siRNA229, siRNA343 to siRNA345, and siRNA352 to siRNA358 shown in Table 1;

[0025] Preferably, the sense strand and the antisense strand are selected from the combination of sense strands or antisense strands shown in siRNA29, siRNA41, siRNA80, siRNA92, siRNA96, siRNA98, siRNA100, siRNA228, siRNA229 or siRNA343 to siRNA345 shown in Table 1;

[0026] Preferably, the sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA29 shown in Table 1;

[0027] Alternatively, the sense strand of the double-stranded RNA comprises the sequence of SEQ ID NO:62, and the antisense strand of the double-stranded RNA comprises the sequence of SEQ ID NO:162.

[0028] [9]. The double-stranded ribonucleic acid according to any one of [1] to [8], wherein each nucleotide in the sense strand is independently a modified nucleotide or an unmodified nucleotide, and / or each nucleotide in the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0029]

[10] The double-stranded RNA according to any one of [1] to [9], wherein any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond, and / or any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.

[0030]

[11] . The double-stranded RNA according to any one of [1] to

[10] , wherein the 5' terminal nucleotide of the antisense strand has a group selected from the group consisting of a 5'-hydroxyl group, a 5' phosphate group, or a 5' phosphate derivative group.

[0031]

[12] . The double-stranded RNA according to any one of [1] to

[11] , wherein the double-stranded RNA is siRNA.

[0032]

[13] . The double-stranded RNA according to any one of [1] to

[12] , wherein the double-stranded RNA is siRNA for inhibiting SERPINF2 gene expression.

[0033]

[14] . A modified double-stranded RNA, which is a modified double-stranded RNA as described in any one of [1] to

[13] , wherein the modified double-stranded RNA comprises at least one of the following chemical modifications:

[0034] (1) modification of at least one nucleotide in the sense strand,

[0035] (2) modification of the phosphodiester bond at at least one position in the sense strand,

[0036] (3) modification of at least one nucleotide in the antisense strand,

[0037] (4) modification of the phosphodiester bond at at least one position in the antisense strand;

[0038] Optionally, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A and sequence D, wherein the 3' end of sequence A in the sense strand is connected to sequence D consisting of 1-2 nucleotides, preferably sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded RNA modification comprises sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E consisting of 1-2 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A', wherein sequence A' is formed by excluding 1-2 nucleotides from the 3' end of sequence A in the sense strand;

[0039] Optionally, the sense strand and antisense strand of the double-stranded RNA modification are selected from the following sequence combinations:

[0040] The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0041] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E;

[0042] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0043] Alternatively, the nucleotide sequence of the sense strand is the sequence shown by sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown by sequence B connected to sequence E;

[0044] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B;

[0045] Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0046]

[15] . The double-stranded RNA modified substance according to

[14] , wherein the modification of the nucleotide is selected from 2'-fluoro modification, 2'-alkoxy modification, 2'-substituted alkoxy modification, 2'-alkyl modification, 2'-substituted alkyl modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.

[0047]

[16] . The double-stranded RNA modified substance according to

[14] or

[15] , wherein the modification of the nucleotide is selected from 2'-F modification, 2'-O-CH 3 Modification, 2'-O-CH 2 -CH 2 -O-CH 3 Modification, 2'-O-CH 2 -CH=CH 2 Modification, 2'-CH 2 -CH 2 -CH=CH 2 modification, 2'-deoxy modification, nucleotide derivative modification or a combination of any two or more thereof.

[0048]

[17] . The double-stranded RNA modification according to

[15] or

[16] , wherein the nucleotide derivative in the nucleotide derivative modification is selected from one or more of isonucleotides, LNA, ENA, cET, UNA or GNA.

[0049]

[18] The double-stranded ribonucleic acid modified substance according to any one of

[14] to

[17] , wherein the sense strand of the double-stranded ribonucleic acid modified substance comprises the following modifications along the direction from the 5' end to the 3' end: 3 to 5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH 3 modified ribonucleotides;

[0050] Preferably, along the 5' end to the 3' end direction, the 7th, 9th, 10th and 11th ribonucleotides in the sequence A of the sense strand are 2'-F modified ribonucleotides, and the remaining ribonucleotides in the sequence A of the sense strand are 2'-O-CH 3 modified ribonucleotides;

[0051] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 5, 7, 8 and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0052] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 9, 10 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0053] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 8, 9 and 10 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0054] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the 8th, 9th, 10th and 11th ribonucleotides in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides in the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0055] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0056] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0057] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0058] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0059] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 9, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0060] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0061] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0062] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 11, 12 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0063] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0064] Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides;

[0065] Alternatively, along the direction from the 5' end to the 3' end, the positive strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 11, 16 and 17 in sequence A of the positive strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the positive strand are 2'-methoxy-modified ribonucleotides.

[0066]

[19] The double-stranded RNA modified substance according to any one of

[14] to

[18] , wherein the sense strand comprises a phosphorothioate diester bond located at the following position along the 5' end to the 3' end:

[0067] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand;

[0068] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand;

[0069] Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; and / or

[0070] Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand;

[0071] or,

[0072] The sense strand contains phosphorothioate diester bonds located at the positions shown below:

[0073] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; and / or

[0074] Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand,

[0075] or,

[0076] The sense strand contains phosphorothioate diester bonds located at the positions shown below:

[0077] Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; optionally, in the direction from the 5' end to the 3' end, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group.

[0078]

[20] The double-stranded ribonucleic acid modified substance according to any one of

[14] to

[19] , wherein the antisense strand of the double-stranded ribonucleic acid modified substance comprises the following modifications along the direction from the 5' end to the 3' end: at least two or more ribonucleotides selected from positions 2 to 22 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0079] Preferably,

[0080] From the 5' end to the 3' end, the ribonucleotides at the 2nd, 6th, 14th and 16th positions in the sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in the sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0081] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0082] Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0083] Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0084] Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0085] Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0086] Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0087] Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 modified ribonucleotides;

[0088] Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 5, 7 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides.

[0089]

[21] . The double-stranded RNA modification according to any one of

[14] to

[20] , wherein the ribose group of the 5' terminal nucleotide of the antisense strand has any one selected from the following: a 5' hydroxyl group, a 5' phosphate group or a 5' phosphate derivative group, in the direction from the 5' end to the 3' end.

[0090]

[22] The double-stranded RNA modified substance according to any one of

[14] to

[21] , wherein the antisense strand comprises a phosphorothioate diester bond located at the following position:

[0091] Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand;

[0092] Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand;

[0093] Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; and / or

[0094] The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

[0095]

[23] The double-stranded RNA modified substance according to any one of

[14] to

[22] , wherein the sense strand of the double-stranded RNA modified substance has (a 1 )-(a 35 ) any structure shown in:

[0096] (a 1 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f 10 f 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0097] (a 2 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f 10 f 11f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0098] (and 3 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0099] (and 4 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3',

[0100] (and5 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0101] (and 6 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0102] (and 7 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0103] (and 8 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0104] (and 9 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0105] (and 10 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN6 -mN 7 -N 8 fN 9 fN 10 f-mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0106] (and 11 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 f-mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0107] (and 12 )5'-mN 1 -(s)-mN 2 -mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0108] (and13 )5'-mN 1 -(s)-mN 2 -mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0109] (and 14 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0110] (and 15 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0111] (and 16 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -N 15 f-mN 16 -mN 17 -mN 18 -mN 19 -3';

[0112] (and 17 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -N 15 f-mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0113] (and 18 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0114] (and 19 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0115] (and 20 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0116] (and 21 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0117] (and 22 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0118] (and 23 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0119] (and 24 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0120] (and 25 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0121] (and 26 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5-mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0122] (and 27 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0123] (and 28 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 fN 12 fN 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3';

[0124] (and 29 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 fN 12 fN 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0125] (and 30 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -3';

[0126] (and 31 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3';

[0127] (and 32 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -3';

[0128] (and 33 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3';

[0129] (and 34 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f 17 f-mN 18 -mN 19 -3';

[0130] (a 35 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3';

[0131] Among them, N 1 -N 23 are independently selected from ribonucleotides whose base is A, U, C or G,

[0132] The letter combination dT represents a deoxyribonucleotide whose base is thymine.

[0133] The lowercase letter m indicates that the ribonucleotide adjacent to the right of the letter m has a 2'-O-CH 3 Modified ribonucleotides,

[0134] The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide.

[0135] -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond.

[0136] Optionally, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group.

[0137]

[24] The double-stranded RNA modified substance according to any one of

[14] to

[23] , wherein the antisense strand of the double-stranded RNA modified substance has (b 1 )-(b 37 ) any structure shown in:

[0138] (b 1 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0139] (b 2 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0140] (b 3 )5'-P1mN 1 -(s)-N 2f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0141] (b 4 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0142] (b 5 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0143] (b 6 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 f-N 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0144] (b 7 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0145] (b 8 )5’-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0146] (b 9 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0147] (b 10 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0148] (b 11 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -[GNA]N 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0149] (b 12 )5'-P1mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-[GNA]N 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21-(s)-mN 22 -(s)-mN 23 -3',

[0150] (b 13 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0151] (b 14 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0152] (b 15 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0153] (b 16 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0154] (b 17 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0155] (b18 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0156] (b 19 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0157] (b 20 )5'-mN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 fN 9f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0158] (b 21 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0159] (b 22 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -N 6 f-mN 7 -N 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17-mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0160] (b 23 )5’-EVPmN 1 -(s)-N 2 f-(s)-N 3 f-N 4 f-N 5 f-mN 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0161] (b 24 )5’-EVPmN 1 -(s)-N 2 f-(s)-N 3 f-N 4 f-N 5 f-mN 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0162] (b 25 )5’-EVPmN 1 -(s)-N 2 f-(s)-N 3 f-N 4 f-N 5 f-mN 6 -N 7 f-mN8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0163] (b 26 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0164] (b 27 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19-(s)-mN 20 -(s)-mN 21 -3’,

[0165] (b 28 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0166] (b 29 )5’-EVPmN 1 -(s)-N 2 f-(s)-N 3 f-N 4 f-N 5 f-[GNA]N 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0167] (b 30 )5’-EVPmN 1 -(s)-N 2 f-(s)-N 3 f-N 4 f-N 5f-[GNA]N 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0168] (b 31 )5'-EVPmN 1 -(s)-N 2 f-(s)-N 3 fN 4 fN 5 f-[GNA]N 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3',

[0169] (b 32 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’,

[0170] (b 33 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’,

[0171] (b 34 )5’-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’,

[0172] (b 35 )5’-EVPmN 1 -(s)-N2 f-(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3',

[0173] (b 36 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3',

[0174] (b 37 )5'-EVPmN 1 -(s)-N 2 f-(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3';

[0175] Among them, N 1 -N 23 are independently selected from ribonucleotides whose base is A, U, C or G,

[0176] The letter combination dT represents a deoxyribonucleotide whose base is thymine.

[0177] The lowercase letter m indicates that the ribonucleotide adjacent to the right of the letter m has a 2'-O-CH 3 Modified ribonucleotides,

[0178] The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide.

[0179] P1 means that the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide.

[0180] EVP means that the nucleotide adjacent to the right of the letter combination is a 5'-trans vinylphosphonate nucleotide.

[0181] -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond.

[0182] [GNA] indicates that the adjacent ribonucleotide on the right is a ribonucleotide modified with GNA.

[0183] Optionally, the 5' terminal nucleotide of the antisense strand does not have P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

[0184]

[25] The double-stranded RNA modified substance according to any one of

[14] to

[24] , wherein the double-stranded RNA modified substance is a siRNA modified substance.

[0185]

[26] The double-stranded RNA modified substance according to any one of

[14] to

[25] , wherein the double-stranded RNA modified substance is a siRNA modified substance for inhibiting the expression of the SERPINF2 gene.

[0186]

[27] The double-stranded RNA modified substance according to any one of

[14] to

[26] , wherein the sense strand comprises a sequence selected from any one of SEQ ID NOs: 268 to 331, 430 to 432, 505 to 507 and 526 to 542 shown in Table 2, and the antisense strand comprises a sequence selected from any one of SEQ ID NOs: 332 to 419, 433 to 468, 480 to 498, 508 to 510 and 543 to 550 shown in Table 2;

[0187] Alternatively, the double-stranded RNA modification is a modification of a double-stranded RNA comprising: the sense strand of the double-stranded RNA comprises the sequence of SEQ ID NO: 62, and the antisense strand of the double-stranded RNA comprises the sequence of SEQ ID NO: 162;

[0188] The sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of the siRNA modifier shown in Table 2,

[0189] More preferably, the sense strand comprises the sense strand of any one of the siRNA modifications shown in Table 2, and the antisense strand comprises the antisense strand of the corresponding siRNA modification;

[0190] Further preferably, the sense strand of the double-stranded RNA modification comprises a sequence shown in any one of SEQ ID NOs: 276 and 526 to 541, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: SEQ ID NOs: 343, 434 to 436, 480 to 482 and 543 to 548;

[0191] Further preferably, the sense strand of the double-stranded RNA modification comprises a sequence shown in any one of SEQ ID NOs: 276, 526 and 534, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: SEQ ID NOs: 482, 547 and 548.

[0192]

[28] A double-stranded RNA modification, wherein the 3' end of the sense strand of the double-stranded RNA modification described in any one of

[14] -

[27] is modified to be a blunt end, and optionally, the protruding nucleotides extending out of the double-stranded region from the 3' end of the sense strand of the double-stranded RNA modification described in any one of

[14] -

[27] are excluded.

[0193]

[29] . A conjugate, wherein the conjugate comprises the double-stranded RNA as described in any one of [1]-

[13] , or the double-stranded RNA modification as described in any one of

[14] -

[28] ; and a conjugated group conjugated to the double-stranded RNA or the double-stranded RNA modification.

[0194]

[30] The conjugate according to

[29] , wherein the conjugated group has the structure shown below:

[0195]

[0196]

[0197]

[31] The conjugate according to

[29] or

[30] , wherein the conjugated group is linked to the 3' end of the sense strand.

[0198]

[32] The conjugate according to

[31] , wherein the conjugated group is conjugated to the 3' end of the sense strand via a phosphodiester bond;

[0199] Preferably, the sense strand and the antisense strand of the conjugate are at least partially complementary to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region;

[0200] or,

[0201] The sense strand and the antisense strand of the conjugate are at least partially complementary to each other to form a double-stranded region of the conjugate, and the 3' end of the sense strand forms a blunt end, while the 3' end of the antisense strand forms a blunt end.

[0202]

[33] The conjugate according to any one of

[29] to

[32] , wherein the conjugate has the structure shown below:

[0203]

[0204] The double helix structure refers to the double-stranded RNA or the modified double-stranded RNA.

[0205]

[34] The conjugate according to any one of

[29] to

[33] , wherein the conjugate is a siRNA conjugate.

[0206]

[35] The conjugate according to any one of

[29] to

[34] , wherein the conjugate is a siRNA conjugate for inhibiting SERPINF2 gene expression.

[0207]

[36] The conjugate according to any one of

[29] to

[35] , wherein the conjugate is formed by connecting any one of the siRNAs listed in Table 1 to a conjugation group, or the conjugate is formed by connecting any one of the siRNAs listed in Table 1-1 to a conjugation group, or the conjugate is formed by connecting any one of the siRNA modifications listed in Table 2 to a conjugation group;

[0208] Preferably, in the conjugate, the sense strand and the antisense strand connected to the conjugation group are selected from the combination of the sense strand and the antisense strand of the siRNA conjugate shown in Table 3;

[0209] More preferably, the conjugate is a conjugate of a double-stranded RNA or a modification thereof comprising SEQ ID NO: 62, 276 or 526-541 as a sense strand and SEQ ID NO: 162, 343, 434-436, 480-482 or 543-548 as an antisense strand;

[0210] Further preferably, the conjugate is a conjugate of a double-stranded ribonucleic acid or a modification thereof comprising SEQ ID NOs: 276, 526 and 534 as sense strands and SEQ ID NOs: 482, 547 and 548 as antisense strands;

[0211] Alternatively, preferably, the conjugate comprises a sense strand connected to a conjugated group as shown in SEQ ID NO: 420-425, 469-479, 511-512 or 551-557, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate;

[0212] Preferably, the conjugate comprises a sense strand connected to a conjugation group as shown in SEQ ID NO: 469 or 551 to 557, and the antisense strand comprises the antisense strand of the corresponding siRNA conjugate;

[0213] Further preferably, the conjugate comprises a sense strand connected to a conjugation group as shown in SEQ ID NO: 469 or 554, and the antisense strand comprises the antisense strand of a corresponding siRNA conjugate.

[0214]

[37] . A pharmaceutical composition, wherein the pharmaceutical composition comprises at least one of the following: a double-stranded RNA as described in any one of [1]-

[13] , a modified double-stranded RNA as described in any one of

[14] -

[28] , or a conjugate as described in any one of

[29] -

[36] .

[0215]

[38] . The pharmaceutical composition according to

[37] , wherein the pharmaceutical composition further comprises one or more pharmaceutically acceptable carriers.

[0216]

[39] Use of the double-stranded RNA according to any one of [1] to

[13] , the modified double-stranded RNA according to any one of

[14] to

[28] , the conjugate according to any one of

[29] to

[36] , or the pharmaceutical composition according to any one of

[37] to

[38] in at least one of the following:

[0217] (1) Inhibiting SERPINF2 gene expression, or preparing a drug for inhibiting SERPINF2 gene expression;

[0218] (2) for preventing or treating diseases related to abnormal expression of SERPINF2 gene, or for preparing drugs for preventing or treating diseases related to abnormal expression of SERPINF2 gene;

[0219] (3) Use for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression.

[0220]

[40] The use according to

[39] , wherein the disease associated with abnormal expression of the SERPINF2 gene is selected from the group consisting of the following diseases:

[0221] Unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory impairment, ischemic stroke, preeclampsia, fibrinolytic imbalance, fibrotic disease, myocardial infarction, heart failure, atrial fibrillation, cerebral hemorrhage, coronary artery disease and thrombosis, etc. and other related conditions, pathologies or syndromes not yet identified.

[0222]

[41] . A method for inhibiting SERPINF2 gene expression in a cell, wherein the method comprises contacting the cell with a double-stranded RNA as described in any one of [1]-

[13] , a double-stranded RNA modification as described in any one of

[14] -

[28] , a conjugate as described in any one of

[29] -

[36] , or a pharmaceutical composition as described in any one of

[37] -

[38] .

[0223]

[42] The method according to

[41] , wherein the cells are in vivo cells or in vitro cells.

[0224]

[43] The method according to

[41] or

[42] , wherein the cell is in a subject.

[0225]

[44] The method according to

[43] , wherein the subject is a mammal, preferably a human.

[0226]

[45] The method according to

[43] or

[44] , wherein the subject has at least one of the following characteristics:

[0227] Abnormal expression of SERPINF2 gene in vivo, more specifically abnormally high expression of SERPINF2 gene;

[0228] Suffering from diseases related to abnormal expression of SERPINF2 gene;

[0229] Having a disease that would benefit from decreased expression of the SERPINF2 gene.

[0230] Effects of the Invention

[0231] In some embodiments, the double-stranded RNA provided by the present disclosure can combine to form an RNA-induced silencing complex (RISC) in cells, cut the mRNA transcribed by the SERPINF2 gene, and efficiently and specifically inhibit the expression of the SERPINF2 gene, and is used to treat SERPINF2-related diseases including unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory disorder, ischemic stroke, preeclampsia, fibrinolysis imbalance, fibrotic diseases, myocardial infarction, heart failure, atrial fibrillation, cerebral hemorrhage, coronary artery disease and thrombosis.

[0232] Furthermore, the double-stranded ribonucleic acid in the present disclosure is siRNA, which targets, binds to and degrades the transcription product mRNA of the SERPINF2 gene, exerts the effect of RNA interference, and inhibits the protein expression of the SERPINF2 gene. It is a SERPINF2 inhibitor with high inhibition rate and good specificity.

[0233] In some embodiments, the present disclosure modifies double-stranded RNA to obtain modified double-stranded RNA. Such modified double-stranded RNA has high stability and is suitable for use in in vivo disease treatment.

[0234] Furthermore, the double-stranded RNA modification disclosed in the present invention is a siRNA modification, which has high stability and good inhibitory activity.

[0235] In some embodiments, the present invention discloses a conjugate of double-stranded RNA or double-stranded RNA modified substance obtained by connecting a conjugation group to double-stranded RNA or double-stranded RNA modified substance, which can be used for efficient targeted delivery to tissues and cells, reducing the impact of double-stranded RNA or double-stranded RNA modified substance on non-targeted normal tissues and cells, and improving its safety in clinical disease treatment.

[0236] Furthermore, the double-stranded RNA conjugate or the conjugate of the double-stranded RNA modification disclosed in the present invention is a siRNA conjugate, which maintains the inhibitory activity and stability of siRNA while having organ or tissue targeting, can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs.

[0237] Furthermore, the conjugated group in the present disclosure is a group (GalNAc) with a structure shown in Formula I. GalNAc can be used for targeted delivery into liver cells and tissues to efficiently inhibit the expression of SERPINF2 gene in the liver.

[0238] In particular, in the present invention, siRNA, its modifications and conjugates comprising the sense strand of SEQ ID NO: 62 and the antisense strand of SEQ ID NO: 162 can not only provide excellent inhibitory effects on SERPINF2 gene expression, but also can achieve an inhibition rate of more than 85% (e.g., more than 88%, such as more than 89%, more than 90%, more than 94%, more than 95%) at low concentrations under free uptake. At the same time, these siRNA, its modifications and conjugates can provide long-term inhibitory effects after administration. DETAILED DESCRIPTION

[0239] definition

[0240] For convenience, several terms used herein, in the specification, examples and appended claims are collected here. Unless otherwise specified or implied by the context, the following terms and phrases include the meanings provided below. Unless otherwise explicitly stated or obvious from the context, the following terms and phrases do not exclude the meanings that the term or phrase already has in the field to which it belongs. The definitions are provided to assist in describing specific embodiments and are not intended to limit the claimed invention, as the scope of the invention is limited only by the claims. Moreover, unless the context provides otherwise, terms in the singular shall include the plural, and terms in the plural shall include the singular.

[0241] In the claims and / or description of the present disclosure, the word "a" or "an" or "a / the" may mean "one", but may also mean "one or more", "at least one" and "one or more than one".

[0242] As used in the claims and description, the words "comprising," "having," "including," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0243] Throughout the application document, the term "about" means that a value includes the standard deviation of the error of the device or method used to determine the value. The numerical ranges and parameters used to define the present disclosure are all approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to the aforementioned test methods or devices. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in the present disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0244] The term "SERPINF2" used in the context of the present disclosure refers to well-known genes and polypeptides. SERPINF2 gene, SERPINF2 mRNA sequence is easily obtained using, for example, GenBank, UniProt, Online Mendelian Inheritance in Man (OMIM), etc.

[0245] The term "SERPINF2 gene" may be a wild-type SERPINF2 gene, or a SERPINF2 gene mutant with sequence variation. Many sequence variations in the SERPINF2 gene have been identified and can be found in, for example, NCBIdbSNP and UniProt (see, for example, ncbi.nlm.nih.gov / snp).

[0246] The terms "polypeptide", "protein" interchangeably refer to a string of at least two amino acid residues linked to each other by covalent bonds (e.g., peptide bonds), which may be recombinant polypeptides, natural polypeptides, or synthetic polypeptides. A polypeptide may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0247] The term "target sequence" as used in the context of the present disclosure refers to a continuous portion of the nucleotide sequence of an mRNA molecule formed during transcription of a target gene, including mRNA that is a product of RNA processing of a primary transcript.

[0248] In some embodiments, the target sequence may be a nucleotide sequence consisting of no less than 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 consecutively connected nucleotides. In some optional embodiments, the target sequence is a nucleotide sequence consisting of no less than 19, 20, 21, 25, 30, 35, 40, 50, 60, 70 or 100 consecutively connected nucleotides; illustratively, the target sequence is a nucleotide sequence consisting of 19, 20, 21, 25, 26, 27, 28, 29, 30, 32, 33, 37, 39, 54, 61, 62, 69, 70 or 109 consecutively connected nucleotides. In some optional embodiments, another shorter target sequence may be included in the target sequence. In some embodiments, one or more shorter target sequences may be included in the target sequence. It should be considered that two or more shorter target sequences contained in the same target sequence have the same characteristics, for example, target sequence X includes target sequences X-1 to X-4.

[0249] In some embodiments, the target gene is a SERPINF2 gene. In some embodiments, the target portion of the gene sequence (i.e., the portion corresponding to the target sequence in the mRNA sequence) will be at least long enough to act as a substrate for the cutting guided by the iRNA at or near the nucleotide sequence portion of the mRNA molecule formed during the transcription of the SERPINF2 gene.

[0250] In the art, "G", "C", "A", "T" and "U" generally represent the bases of guanine, cytosine, adenine, thymine and uracil, respectively, but it is also generally known in the art that "G", "C", "A", "T" and "U" each generally represent nucleotides containing guanine, cytosine, adenine, thymine and uracil as bases, respectively, which is a common way to represent deoxyribonucleic acid sequences and / or ribonucleic acid sequences, so in the context of the present disclosure, the meanings represented by "G", "C", "A", "T", "U" include the above-mentioned various possible situations. However, it should be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide (as further described below) or have an alternative replacement part. Those skilled in the art can appreciate that guanine, cytosine, adenine and uracil can be replaced by other parts without substantially changing the base pairing properties of an oligonucleotide (including a nucleotide having such a replacement part). For example, without limitation, a nucleotide comprising inosine as its base can be base paired with a nucleotide comprising adenine, cytosine or uracil. Therefore, a nucleotide containing uracil, guanine or adenine can be replaced by a nucleotide containing, for example, inosine in the nucleotide sequence of the dsRNA characterized by the present disclosure. In another example, adenine and cytosine anywhere in the oligonucleotide can be replaced by guanine and uracil, respectively, to form a GU wobble base pairing with the target mRNA. Sequences containing this type of replacement portion are suitable for the compositions and methods characterized by the present disclosure.

[0251] In the present application, "5'-nucleotide" refers to a nucleotide in which a phosphate group is linked to the 5' carbon of a pentose, which is the main type of nucleotide that exists freely in an organism. "3'-nucleotide" refers to a nucleotide in which a phosphate group is linked to the 3' carbon of a pentose, for example, it may include adenosine-3'-phosphate, guanosine-3'-phosphate, cytidine-3'-phosphate, uridine-3'-phosphate, 2'-deoxythymidine-3'-phosphate, 2'-O-methyladenosine-3'-phosphate, 2'-O-methyladenosine-3'-thiophosphate, 2'-fluoroadenosine-3'-phosphate, 2'-fluoroadenosine-3'-thiophosphate, 2'-O-methylguanosine-3'- ... guanosine-3'-phosphorothioate, 2'-fluoroguanosine-3'-phosphorothioate, 2'-O-methylcytidine-3'-phosphorothioate, 2'-fluorocytidine-3'-phosphorothioate, 2'-fluorocytidine-3'-phosphorothioate, 2'-O-methyluridine-3'-phosphorothioate, 2'-O-methyluridine-3'-phosphorothioate, 2'-fluorouridine-3'-phosphorothioate, 2'-fluorouridine-3'-phosphorothioate, 2'-deoxythymidine-3'-phosphorothioate. This definition can be applied to modified or unmodified nucleoside phosphoramidite monomers.

[0252] The terms "iRNA", "RNAi agent", "iRNA agent", "RNA interfering agent" used in the context of this disclosure are used interchangeably herein and refer to siRNAs as defined herein and mediate targeted cleavage of RNA transcripts through the RNA induced silencing complex (RISC) pathway. iRNAs direct sequence-specific degradation of mRNAs through a process known as RNA interference (RNAi). iRNAs modulate, e.g., inhibit, expression of a target gene in a cell, such as a cell of a subject, such as a mammalian subject.

[0253] The terms "double-stranded ribonucleic acid", "double-stranded RNA (dsRNA) molecule", "dsRNA" used in the context of this disclosure can be used interchangeably. The term "dsRNA" refers to a complex of ribonucleic acid molecules, which have a double-stranded structure, comprising two antiparallel and substantially complementary nucleic acid strands, referred to as "sense" and "antisense" orientations relative to a target gene, such as a SERPINF2 gene. In some embodiments, double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, such as mRNA, through a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi).

[0254] Typically, most of the nucleotides of each strand of the dsRNA molecule are ribonucleotides, but as described in detail herein, each or both of the two strands may also include one or more non-ribonucleotides, e.g., deoxyribonucleotides and / or modified nucleotides. In addition, as used in the present disclosure, "double-stranded RNA" may include ribonucleotides, phosphate backbones, etc., with chemical modifications. These modifications may include all types of modifications disclosed herein or known in the art.

[0255] The term "isonucleotide" used in the context of the present disclosure refers to a compound formed by a change in the position of the base on the ribose ring in a nucleotide, for example, a compound formed by the base not being attached to the 1'-position of the ribose ring but to the 2'-position or 3'-position of the ribose ring.

[0256] In some embodiments, the double-stranded ribonucleic acid of the present disclosure is siRNA, which interacts with the mRNA sequence transcribed by the target gene (e.g., the mRNA sequence transcribed by the SERPINF2 gene) to guide the cutting of the target RNA. Without being bound by theory, the long double-stranded RNA introduced into the cell is decomposed into siRNA by the type III endonuclease called Dicer (Sharp et al., "Genes and Development" (Genes Dev.) 2001, 15: 485). Dicer (ribonuclease III-like enzyme) processes dsRNA into 19-23 base pairs of short interfering RNA with characteristic double base 3' overhangs (Bernstein et al., (2001) Nature (Nature) 409: 363). These siRNAs are subsequently incorporated into RNA-induced silencing complexes (RISC), in which one or more helicases unwind the siRNA duplex, which makes it possible for complementary antisense strands to guide target recognition (Nykanen et al., (2001) Cell (Cell) 107: 309). Once bound to the appropriate target mRNA, one or more endonucleases within RISC cleave the target to induce silencing (Elbashir et al. (2001) Genes Dev. 15:188).

[0257] The term "overhanging nucleotides" as used in the context of this disclosure refers to one or more unpaired nucleotides that protrude from the duplex structure of a double-stranded ribonucleic acid when a 3' end of one strand of the dsRNA extends beyond the 5' end of the other strand, or vice versa. "Blunt end" or "blunt end" means that there are no unpaired nucleotides at that end of the double-stranded ribonucleic acid, i.e., no nucleotide overhang. A "blunt-ended" double-stranded ribonucleic acid is a dsRNA that is double-stranded throughout its length, i.e., has no nucleotide overhangs at either end of the molecule.

[0258] The term "antisense strand" refers to a nucleic acid strand in a double-stranded ribonucleic acid that includes a region that is substantially complementary to a target sequence (e.g., derived from human SERPINF2 mRNA). In the case where the complementary region is not completely complementary to the target sequence, mismatches are most tolerable in the terminal region, and if mismatches occur, they are typically within one or more regions of the terminal, such as 5' and / or 3' ends, 5, 4, 3, 2 or 1 nucleotide.

[0259] The term "sense strand" refers to the nucleic acid strand of a double-stranded RNA that contains a region that is substantially complementary to a region of the antisense strand.

[0260] The terms "complementary" or "reverse complement" are used interchangeably and have the meanings known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, the bases of one strand are paired with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) is always paired with the pyrimidine base cytosine (C). Each base pair includes a purine and a pyrimidine. When adenine on one strand is always paired with thymine (or uracil) on the other strand, and guanine is always paired with cytosine, the two strands are considered to be complementary to each other, and the sequence of the strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" means in the art that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form.

[0261] The term "substantially reverse complementary" means that there are no more than three base mismatches between the two nucleotide sequences involved, that is, there are 1, 2 or 3 base mismatches between the two nucleotide sequences involved; "completely complementary" means that there are no base mismatches between the two nucleotide sequences.

[0262] The terms "complementary," "fully complementary," and "substantially complementary" may be used with respect to base pairing between the sense and antisense strands of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0263] The term "at least partially complementary" refers to being substantially complementary to a continuous portion of a nucleotide sequence of interest (e.g., a sense strand and an antisense strand, or to an mRNA of interest, such as an mRNA encoding SERPINF2). For example, if more than 15 continuous nucleotide sequences of the sense strand are substantially complementary to more than 15 continuous nucleotide sequences of the antisense strand, then the sense strand is at least partially complementary to the antisense strand.

[0264] In the above and below, especially when describing the preparation method of the double-stranded RNA, double-stranded RNA modification, or conjugate or pharmaceutical composition of the present disclosure, unless otherwise specified, nucleoside monomer refers to a modified or unmodified nucleoside phosphoramidite monomer used in phosphoramidite solid phase synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid phase synthesis is a method used in RNA synthesis known to those skilled in the art. The nucleoside monomers used in the present disclosure are all commercially available.

[0265] The term "inhibit" may be used interchangeably with "reduce," "silence," "downregulate," "suppress," and other similar terms, and includes any level of inhibition.

[0266] The term "inhibiting the expression of a SERPINF2 gene" includes inhibiting the expression of any SERPINF2 gene (such as, for example, a mouse SERPINF2 gene, a rat SERPINF2 gene, a monkey SERPINF2 gene, or a human SERPINF2 gene) and a variant (such as a naturally occurring variant) or mutant of a SERPINF2 gene. Therefore, the SERPINF2 gene can be a wild-type SERPINF2 gene, a mutant SERPINF2 gene, or a transgenic SERPINF2 gene in the context of a genetically manipulated cell, cell group, or organism.

[0267] "Inhibiting SERPINF2 gene expression" includes any level of inhibition of SERPINF2 gene, such as at least partial inhibition of SERPINF2 gene expression, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0268] The term "independently" means that at least two groups (or ring systems) with the same or similar value ranges in the structure may have the same or different meanings in specific circumstances. For example, substituent X and substituent Y are independently hydrogen, hydroxyl, alkyl or aryl. When substituent X is hydrogen, substituent Y can be either hydrogen, hydroxyl, alkyl or aryl; similarly, when substituent Y is hydrogen, substituent X can be either hydrogen, hydroxyl, alkyl or aryl.

[0269] The term "alkyl" includes straight chain, branched chain or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and the like. 1-6 The "C" in "alkyl" 1-6 ” refers to a group containing 1, 2, 3, 4, 5 or 6 carbon atoms in a straight chain, branched chain or cyclic form.

[0270] The term "alkoxy" herein refers to an alkyl group attached to the remainder of the molecule via an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy and substituted alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentoxy, and the like.

[0271] "Substituted" as used herein means that any one or more hydrogen atoms on a particular atom are replaced by a substituent, as long as the valence of the particular atom is normal and the substituted compound is stable. When the substituent is oxo (ie, =O), it means that two hydrogen atoms are replaced.

[0272] The “substituents” described herein include all substituents mentioned herein, including but not limited to the terms “alkyl”, “alkoxy”, “heteroalkyl”, “alkenyl”, “alkynyl”, etc., and corresponding non-limiting or exemplary groups, wherein some non-limiting examples of the “substituents” include C 1-6 Alkyl, C 1-6 Alkoxy, C containing oxygen atom 1-6 Heteroalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, etc.

[0273] In this article, C m-n , means that the moiety has an integer number of carbon atoms in a given range. For example, "C 1-6 " means that the group may have 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms or 6 carbon atoms. For example, C 1-3 It means that the group may have 1 carbon atom, 2 carbon atoms, or 3 carbon atoms.

[0274] The term "treatment" means that after suffering from a disease, a subject is exposed to (e.g., administered) double-stranded RNA, a double-stranded RNA modification, a conjugate, or a pharmaceutical composition, thereby alleviating the symptoms of the disease compared to when the subject is not exposed to the disease, and does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means that the body has symptoms of the disease.

[0275] The term "prevention" means that before a subject develops a disease, by contacting (e.g., administering) the double-stranded RNA, double-stranded RNA modification, conjugate, or pharmaceutical composition of the present disclosure, the symptoms after the subject develops the disease are alleviated compared to when the subject does not develop the disease. It does not mean that the disease must be completely suppressed.

[0276] The term "effective amount" refers to such an amount or dosage of the double-stranded RNA, double-stranded RNA modification, conjugate or pharmaceutical composition of the present disclosure, which produces the desired effect in a patient in need of treatment or prevention after being administered to the patient in a single or multiple doses. The effective amount can be easily determined by the attending physician who is a person skilled in the art by considering a variety of factors such as: the species of the mammal; its size, age and general health; the specific disease involved; the extent or severity of the disease; the response of the individual patient; the specific antibody administered; the mode of administration; the bioavailability characteristics of the administered formulation; the selected dosing regimen; and the use of any concomitant therapy. The term "therapeutically effective amount" refers to such an amount or dosage of the double-stranded RNA, double-stranded RNA modification, conjugate or pharmaceutical composition of the present disclosure, which produces the desired therapeutic effect in a patient in need of treatment or prevention after being administered to the patient in a single or multiple doses.

[0277] The term "disease associated with abnormal expression of SERPINF2 gene" is a disease, disorder or condition associated with increased levels of plasminogen activators due to SERPINF2 activity. The term "disease associated with abnormal expression of SERPINF2 gene" includes diseases, disorders or conditions that will benefit from reducing SERPINF2 expression (i.e., "SERPINF2-related diseases"). Non-limiting examples of diseases associated with abnormal expression of the SERPINF2 gene include: unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory impairment, ischemic stroke, preeclampsia, fibrinolysis imbalance, fibrotic diseases, myocardial infarction, heart failure, atrial fibrillation, cerebral hemorrhage, coronary artery disease and thrombosis (Gebhart J, Kepa S, Hofer S, Koder S, Kaider A, Wolberg AS, Haslacher H, Quehenberger P, Eigenbauer E, Panzer S, Mannhalter C, Pabinger I, Fibrinolysis in patients with amild-to-moderate bleeding tendency of unknown cause. Ann Hematol. 2017 Mar; 96 (3): 489-495; Anjum N. Butte, Aiilyan K. Houng, Ik-Kyung Jang and Guy L. Reed et al., α 2-Antiplasmin Causes Thrombi to Resist Fibrinolysis Induced by Tissue Plasminogen Activator in Experimental Pulmonary Embolism.Circulation.1997,95:1886–1891;Chan,KY.,Lai,PS.,Squire,J.,Positional expression profiling indicates candidate genes in deletion hotspots of hepatocellular carcinoma.Mod Pathol 19,1546–1554(2006);Hiroyuki Matsuno,Osamu Kozawa,Naoki Yoshimi,Shigeru Akamatsu,Akira Hara,Hideki Mori,Kiyotaka Okada,Shigeru Ueshima,Osamu Matsuo,Toshihiko Uematsu etc.,Lack of α2-antiplasmin promotes pulmonary heart failure via overrelease of VEGF after acute myocardial infarction,Blood,Volume 100,Issue 7,2002,Pages 2487-2493;Nagai N,De Mol M,Lijnen HR,Carmeliet P,Collen D.Role of plasminogen system components in focal cerebral ischemic infarction:a gene targeting and gene transfer study in mice.Circulation.1999May;99(18):2440-2444.;Kawashita,E.,Ishihara,K.,Miyaji,H.etc.,α 2-抗纤溶酶作为空间记忆过程和年龄相关性认知衰退的潜在调节因子。《分子大脑》13卷,140页(2020年);里德·G·L、洪·A·K、辛格·S、王·D.α 2 -抗纤溶酶:缺血性中风的新见解与机遇。《血栓与止血学研讨会》。2017年3月;43(2):191 - 199页。勘误。《高血压杂志》。子痫前期中失衡的性激素产生与过度凝血因子丝氨酸蛋白酶抑制剂F2的关联:2019年7月;37(7):1537页。;卡彭特·S·L、马修·P.α2 - 抗纤溶酶及其缺乏:纤维蛋白溶解失衡。《血友病》。2008年11月;14(6):1250 - 1254页。;菅野洋、川下绘里、小加多明等,α2 - 抗纤溶酶通过脂肪甘油三酯脂肪酶 / 钙非依赖性磷脂酶A(2)合成前列腺素F(2α)调节小鼠皮肤纤维化的发展。《关节炎与风湿病》。2013年2月;65(2):492 - 502页。;于伊特·德·维利热·S、米德扎克·M、卡特·A·M、利斯曼·T、罗森达尔·F·R、格兰特·P·J、菲利波·H, RA.Proteolytic and genetic variation of the alpha-2-antiplasmin C-terminus in myocardial infarction.Blood.2011Jun 16;117(24):6694-701.; Zhang YN, Vernooij F, Ibrahim I, Ooi S, Gijsberts CM, Schoneveld AH, SenKW, den Ruijter HM, Timmers L, Richards AM, Jong CT, Mazlan I, Wang JW, Lam CS, deKleijn DP. Extracellular Vesicle Proteins Associated with Systemic Vascular Events Correlate with Heart Failure: An Observational Study in a Dyspnoea Cohort. PLoS One. 2016 Jan 28; 11(1): e0148073.).

[0278] The term "pharmaceutically acceptable excipient" or "pharmaceutically acceptable carrier" refers to auxiliary materials widely used in the field of drug production. The main purpose of using excipients is to provide a pharmaceutical composition that is safe to use, stable in nature and / or has specific functionality, and also to provide a method so that after the drug is administered to the subject, the active ingredient can be dissolved at a desired rate, or to promote the effective absorption of the active ingredient in the subject receiving the administration. Pharmaceutically acceptable excipients can be inert fillers or functional ingredients that provide a certain function to the pharmaceutical composition (for example, stabilizing the overall pH value of the composition or preventing the degradation of the active ingredient in the composition). Non-limiting examples of pharmaceutically acceptable excipients include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adhesive agents, glidants, wetting agents, gelling agents, absorption delay agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavoring agents, sweeteners, etc.

[0279] The term "pharmaceutical composition" refers to a mixture of one or more double-stranded RNAs, double-stranded RNA modifications, or conjugates thereof disclosed herein and a pharmaceutically acceptable excipient / carrier. The purpose of the pharmaceutical composition is to facilitate administration of the double-stranded RNAs, double-stranded RNA modifications, or conjugates thereof disclosed herein to an organism.

[0280] The pharmaceutical compositions of the present disclosure can be prepared using any method known to those skilled in the art, such as conventional mixing, dissolving, granulating, emulsifying, pulverizing, encapsulating, embedding and / or lyophilizing processes.

[0281] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to meet the requirements of the properties of the drug, the convenience of the patient and the medical staff, and other relevant factors.

[0282] The terms "individual", "patient" or "subject" used in the context of this disclosure include mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0283] All patents, patent applications and other identified publications are expressly incorporated herein by reference for the purposes of description and disclosure. Any citation of these publications herein does not constitute an admission that the publication becomes part of the common general knowledge in the art.

[0284] The term "corresponding siRNA" used in the context of the present disclosure refers to the same siRNA mentioned above. For example, when referring to "the sense chain comprises the sense chain of any one siRNA shown in Table 1 and Table 1-1 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA", it means that the sense chain and antisense chain contained are the sense chain and antisense chain shown under the number of the same siRNA shown in Table 1 and Table 1-1 herein. For example, when referring to the sense chain and the corresponding antisense chain of numbered siRNA29, when the sense chain comprises 5'-AGAACAACAUGAGCUUUGU-3' (SEQ ID NO: 62), the antisense chain comprises 5'-ACAAAGCUCAUGUUGUUCU-3' (SEQ ID NO: 162). Similarly, the term "corresponding siRNA modification" refers to the siRNA modification under the same siRNA number mentioned above, for example, when referring to "the sense chain comprises the sense chain of any siRNA modification shown in Table 2 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA modification", it means that the sense chain and antisense chain contained are from the siRNA modification under the same siRNA number shown in Table 2 herein. Similarly, the term "corresponding siRNA conjugate" refers to the siRNA conjugate under the same siRNA number mentioned above, for example, when referring to "the sense chain comprises the sense chain of any siRNA conjugate shown in Table 3 herein, and the antisense chain comprises the antisense chain of the corresponding siRNA conjugate", it means that the sense chain and antisense chain contained are from the siRNA conjugate under the same siRNA number shown in Table 3 herein.

[0285] Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure belongs.

[0286] dsRNA

[0287] The first aspect of the present disclosure provides a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the SERPINF2 gene. One strand of the double-stranded ribonucleic acid is an antisense strand, and the antisense strand is complementary to the mRNA sequence formed during the expression of the target gene (i.e., the SERPINF2 gene) and is used to guide the cutting of the target mRNA (i.e., the transcription product of the SERPINF2 gene). The other sense strand in the double-stranded ribonucleic acid includes a sequence that is at least partially complementary to the antisense strand (including being completely complementary to the antisense strand) to form a double-stranded region of the double-stranded ribonucleic acid.

[0288] In some embodiments, the double-stranded RNA is cut into small fragments of dsRNA, i.e., siRNA, as a substrate of the nuclease (Dicer). In some embodiments, the double-stranded RNA is siRNA. The siRNA assembles to form an RNA-induced silencing complex (RISC) RISC complex, cuts the target mRNA, and inhibits the expression of the SERPINF2 gene.

[0289] According to the target sequence derived from human SERPINF2 mRNA (NM_000934.4), siRNA binding to the target mRNA is designed. In some embodiments, the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 17.

[0290] In some embodiments, the nucleotide sequence shown in SEQ ID NO:7 includes the nucleotide sequence shown in any one of SEQ ID NOs:21 to 24. In some embodiments, the nucleotide sequence shown in SEQ ID NO:6 includes the nucleotide sequence shown in any one of SEQ ID NOs:18 to 20. In some embodiments, the nucleotide sequence shown in SEQ ID NO:10 includes the nucleotide sequence shown in any one of SEQ ID NOs:25 to 27 and 558. In some embodiments, the nucleotide sequence shown in SEQ ID NO:12 includes the nucleotide sequence shown in SEQ ID NO:28 and SEQ ID NO:29. In some embodiments, the nucleotide sequence shown in SEQ ID NO:15 includes the nucleotide sequence shown in SEQ ID NO:30 and SEQ ID NO:31. In some embodiments, the nucleotide sequence shown in SEQ ID NO:17 includes the nucleotide sequence shown in SEQ ID NO:32 and SEQ ID NO:33.

[0291] In some more specific embodiments, the target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1-5, 8, 9, 11, 13, 14, 16, 18-33 and 558.

[0292] In some embodiments, the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from a sequence that is reverse complementary to at least 15 consecutive nucleotides in the target sequence. Specifically, along the direction from the 5' end to the 3' end, a starting nucleotide is selected in the target sequence, and at least 15 nucleotides extending in the 3' direction including the starting nucleotide are used as the binding region of the siRNA. The antisense strand comprises a reverse complementary sequence of the nucleotide sequence corresponding to the binding region. It should be noted that the starting nucleotide can be a nucleotide at any position of the target sequence, as long as at least 15 consecutive nucleotides (including the nucleotide at the starting position) can be obtained by extending in the 3' direction of the target sequence based on the starting nucleotide.

[0293] In the present disclosure, the nucleotide sequence of the antisense strand and the target sequence can be completely complementary or substantially complementary. When the nucleotide sequence of the antisense strand and the target sequence are substantially complementary, there are no more than 3 mismatched bases between the nucleotide sequence of the antisense strand and the target sequence. For example, the mismatched bases are 1, 2 or 3. When the nucleotide sequence of the antisense strand and the target sequence are completely complementary, there are no mismatched bases between the nucleotide sequence of the antisense strand and the target sequence.

[0294] Further, the antisense strand consists of at least 15 nucleotides. In some embodiments, the antisense strand consists of 15-28 nucleotides. For example, the length of the antisense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0295] Preferably, the antisense strand consists of 18-25 nucleotides, more preferably 18-23 nucleotides, most preferably 19, 21 or 23 nucleotides.

[0296] In some optional embodiments, sequence B in the antisense strand is completely identical to the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0297] In some specific embodiments, sequence B in the antisense strand is identical to the reverse complementary sequence of a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably identical to the reverse complementary sequence of a sequence consisting of 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides.

[0298] In some optional embodiments, sequence B in the antisense strand differs by 1 nucleotide from the reverse complementary sequence of a sequence consisting of at least 15 consecutive nucleotides on the target sequence.

[0299] In some specific embodiments, sequence B in the antisense strand differs by 1 nucleotide from the reverse complementary sequence of a sequence consisting of 15-28 nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides.

[0300] In some specific embodiments, the nucleotides that are different from the target sequence are preferably located at the end of sequence B. For example, in some specific embodiments, the nucleotides that are different are located at the 3' end of sequence B. In other specific embodiments, the nucleotides that are different are located at the 5' end of sequence B.

[0301] In some embodiments, the sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence. The sense strand includes a region complementary to the antisense strand, and the nucleotide sequence of the sense strand is identical or substantially identical to the sequence of the region where the antisense strand binds to the target sequence. Therefore, the nucleotide sequence of the sense strand is at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand; or, the nucleotide sequence of the sense strand is compared with at least 15 consecutive nucleotides in the target sequence that bind to the antisense strand, and there are 1, 2, or 3 different nucleotides in the nucleotide sequence of the sense strand.

[0302] Further, the sense strand is composed of at least 15 nucleotides. In some embodiments, the sense strand is composed of 15-28 nucleotides. For example, the length of the sense strand is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 or 28 nucleotides.

[0303] Preferably, the sense strand consists of 18-25 nucleotides, more preferably 18-23 nucleotides, most preferably 19, 21 or 23 nucleotides.

[0304] In some optional embodiments, the sequence A in the sense strand is completely identical to a sequence consisting of at least 15 consecutive nucleotides in the target sequence.

[0305] In some specific embodiments, sequence A in the sense strand is completely identical to a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably 19, 21 or 23 consecutive nucleotides on the target sequence.

[0306] In some optional embodiments, sequence A in the sense strand differs by 1 nucleotide from a sequence of at least 15 consecutive nucleotides in the target sequence.

[0307] In some specific embodiments, sequence A in the sense chain differs by 1 nucleotide from a sequence consisting of 15-28 consecutive nucleotides on the target sequence, preferably 19-25 consecutive nucleotides on the target sequence, more preferably 19-23 consecutive nucleotides on the target sequence, and most preferably a sequence consisting of 19, 21 or 23 consecutive nucleotides on the target sequence.

[0308] In some specific embodiments, the nucleotides that are different from the target sequence are preferably located at the 3' end of sequence A. For example, in some specific embodiments, the nucleotides that are different are located at the 3' end of sequence A. In other specific embodiments, the nucleotides that are different are located at the 5' end of sequence A.

[0309] In the present disclosure, the length of the sense strand and the length of the antisense strand may be the same or different.

[0310] In some embodiments, the sense strand is the same length as the antisense strand, specifically, the length ratio of the sense strand / antisense strand is 15 / 15, 16 / 16, 17 / 17, 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, 25 / 25, 26 / 26, 27 / 27, or 28 / 28. Preferably, the length ratio of the sense strand / antisense strand is 18 / 18, 19 / 19, 20 / 20, 21 / 21, 22 / 22, 23 / 23, 24 / 24, or 25 / 25, more preferably 19 / 19, 20 / 20, 21 / 21, 22 / 22, or 23 / 23, and most preferably 19 / 19, 21 / 21, or 23 / 23.

[0311] In some embodiments, the sense strand is different from the antisense strand in length. For example, the sense strand / antisense strand length ratio is 18 / 19, 18 / 20, 18 / 21, 18 / 22, 18 / 23, 18 / 24, 18 / 25, 18 / 26, 19 / 18, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 18, 20 / 19, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 18, 21 / 19 , 21 / 20, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 18, 22 / 19, 22 / 20, 22 / 21, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 18, 23 / 19, 23 / 20, 23 / 21, 23 / 22, 23 / 24, 23 / 25 or 23 / 26 and the like; in some preferred embodiments, the length ratio of the sense strand / antisense strand is 19 / 21 or 21 / 23.

[0312] In the present disclosure, the sense strand and the antisense strand may be completely complementary or substantially complementary. When the two are substantially complementary, there are no more than 3 mismatched bases in the double-stranded region formed by the sense strand and the antisense strand.

[0313] In some embodiments, after the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, the sense strand, the antisense strand, or a combination thereof has protruding nucleotides extending out of the double-stranded region. The number of protruding nucleotides can be 1 or more, for example, 1 or 2. In addition, the protruding 1-2 nucleotides can be located at the 5' end, 3' end, or both ends of any antisense strand or sense strand, and each protruding nucleotide can be any type of nucleotide. For example, in the case where the sense strand is composed of a sequence A+D with a length of 21 and the antisense strand is composed of a sequence B+E with a length of 21, in the direction from the 5' end to the 3' end, the 1st to 19th nucleotides of sequence A are completely reverse complementary to the 1st to 19th nucleotides of sequence B, so that sequence D and sequence E form protruding nucleotides at the 3' end of their respective chains. For example, when the sense strand consists of a sequence A with a length of 19 and the antisense strand consists of a sequence B+E with a length of 21, nucleotides 1-19 of sequence A are completely reverse complementary to nucleotides 1-19 of sequence B in the direction from the 5' end to the 3' end, thereby forming a protruding nucleotide at the 3' end of sequence E on the antisense strand.

[0314] In some embodiments, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end.

[0315] In some embodiments, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end.

[0316] In some embodiments, the sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region.

[0317] In some embodiments, the sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3′ ends of the sense strand and the antisense strand both form blunt ends.

[0318] In the present disclosure, as described above, the nucleotide sequence of the antisense strand can be completely complementary or substantially complementary to the target sequence; the sense strand and the antisense strand can be completely complementary or substantially complementary. Therefore, in the following description of the target sequences SEQ ID NO: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558 and double-stranded ribonucleic acids (e.g., siRNA) that can be complementary to these target sequences, for each antisense strand of a double-stranded ribonucleic acid (e.g., siRNA), it includes the case where the target sequence (e.g., any one of SEQ ID NO: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558) that is complementary thereto is substantially complementary, that is, the nucleotide sequence of the antisense strand of each double-stranded ribonucleic acid (e.g., siRNA) may have a base mismatch with the corresponding target sequence; for each sense strand of a double-stranded ribonucleic acid (e.g., siRNA), it includes the case where the target sequence (e.g., SEQ ID NO: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33 and 558) that is complementary thereto is substantially complementary thereto. NO: 1-5, 8, 9, 11, 13, 14, 16, 18-33 and 558) compared with no more than 1, 2 or 3 bases, that is, the nucleotide sequence of the sense strand of each double-stranded ribonucleic acid (e.g., siRNA) may differ from the corresponding target sequence by no more than 1, 2 or 3 bases. In some embodiments, the base mismatch may be a mismatch that differs from the target sequence by no more than 3 bases, for example, the number of mismatched bases is 1, 2 or 3. It should be noted that, for any one of the target sequences SEQ ID NO: 1 to 17, the above description of the base mismatch of the target sequences SEQ ID NO: 1 to 5, 8, 9, 11, 13, 14, 16 and 18 to 33 and 558 and the double-stranded ribonucleic acid (e.g., siRNA) complementary thereto is also applicable; that is, the nucleotide sequence of the antisense strand of each double-stranded ribonucleic acid (e.g., siRNA) may have a base mismatch with the corresponding target sequence, and the nucleotide sequence of the sense strand of each double-stranded ribonucleic acid (e.g., siRNA) may have a difference of no more than 1, 2 or 3 bases from the corresponding target sequence. In some embodiments, the base mismatch may be a difference of no more than 3 bases from the target sequence, for example, the number of mismatched bases is 1, 2 or 3.

[0319] In some specific embodiments, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 34-133, 234-250, 426-427, 499-501, 513-518, and the antisense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 134-233, 251-267, 428-429, 502-504, 519-525.

[0320] In some preferred embodiments, the sense strand of the double-stranded ribonucleic acid comprises the sequence of SEQ ID NO:62, and the antisense strand of the double-stranded ribonucleic acid comprises the sequence of SEQ ID NO:162.

[0321] In other embodiments, the length of the double-stranded region is 19, 21 or 23 nucleotides, the nucleotide sequence of the antisense chain and the target sequence have no more than 3 mismatched bases, preferably, the number of mismatched bases is 1, 2 or 3; the difference between the sense chain and the target sequence is no more than 3 nucleotides, preferably, the number of nucleotides is 1, 2 or 3; the sense chain includes a region complementary to the antisense chain, and the nucleotide sequence of the sense chain is exactly the same as the sequence of the antisense chain in the target sequence binding region.

[0322] In some specific embodiments, the nucleotide sequence of the sense chain is a sequence A consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO:513 with a base A added to its 3' end, and the nucleotide sequence of the antisense chain is a sequence B that is the reverse complement of a sequence consisting of 18 consecutive nucleotides in the sequence shown in SEQ ID NO:519 with a base U added to its 5' end.

[0323] Exemplarily, the double-stranded RNA is any one of siRNA29, siRNA41, siRNA80, siRNA92, siRNA96, siRNA98, siRNA100, siRNA228, siRNA229, or siRNA343 to siRNA345 shown in Table 1.

[0324] Exemplarily, the double-stranded RNA is siRNA29 shown in Table 1.

[0325] In some specific embodiments, the double-stranded RNA of the present disclosure is selected from any siRNA as shown in Table 1 or Table 1-1. The siRNA provided by the present disclosure has high specificity for binding to the target mRNA (SERPINF2 mRNA), has good silencing activity of the target mRNA, can significantly inhibit the expression of the SERPINF2 gene, and is used to treat SERPINF2-related diseases including unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory disorder, ischemic stroke, preeclampsia, fibrinolysis imbalance, fibrotic diseases, myocardial infarction, heart failure and thrombosis.

[0326] In some embodiments, the present disclosure provides a siRNA combination comprising any one or a combination of two or more of the siRNAs shown in Table 1 or Table 1-1.

[0327] In some embodiments, each nucleotide of the sense strand is independently a modified nucleotide or an unmodified nucleotide. In some embodiments, each nucleotide of the antisense strand is independently a modified nucleotide or an unmodified nucleotide.

[0328] In some embodiments, any two nucleotides connected in the sense strand are connected by a phosphodiester bond or a phosphorothioate diester bond. In some embodiments, any two nucleotides connected in the antisense strand are connected by a phosphodiester bond or a phosphorothioate diester bond.

[0329] In some embodiments, the ribose group of the 5' terminal nucleotide of the sense strand is a 5' hydroxyl group.

[0330] In some embodiments, the ribose group of the 5' terminal nucleotide of the antisense strand has the following: 5' hydroxyl group, 5' phosphate group or 5' phosphate derivative group. Which group the 5' position of the ribose group has depends on the preparation method used, which can be known by those skilled in the art according to the corresponding preparation method.

[0331] Illustratively, the structure of the 5' phosphate group is: The structures of the 5' phosphate derivative group include but are not limited to: (EVP), wait.

[0332] When the ribose group of the 5' terminal nucleotide of the antisense strand has a 5' phosphate group or a 5' phosphate derivative group, the following structure is formed:

[0333] Wherein, Base represents a base, such as A, U, G, C or T; R' is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-deoxyribonucleotides.

[0334] Herein, when the ribose group of the 5' terminal nucleotide of the sense strand and / or antisense strand does not have a 5' phosphate group or a 5' phosphate derivative group but has a hydroxyl group, the structure of the 5' terminal nucleotide is as shown in the following formula:

[0335]

[0336] Wherein, Base represents a base, such as A, U, G, C or T, R is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino.

[0337] Double-stranded RNA modification

[0338] The second aspect of the present disclosure provides a double-stranded RNA modification. Further, the double-stranded RNA modification is a siRNA modification. The siRNA modification can improve the stability of siRNA while maintaining a high SERPINF2 mRNA inhibitory activity.

[0339] In some embodiments, the double-stranded RNA modification comprises at least one modification of nucleotide. The modification of nucleotide is selected from at least one of the modification of ribose group and the modification of base. In some embodiments, "modification of nucleotide" refers to a nucleotide or nucleotide derivative formed by replacing the 2' hydroxyl group of the ribose group of the nucleotide with other groups, or a nucleotide of a modified base on the nucleotide. The modification of the nucleotide does not cause the function of siRNA to inhibit gene expression to be significantly weakened or lost. For example, the modified nucleotide disclosed in JKWatts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13 (19-20): 842-55 can be selected. The stability of siRNA can be improved by modification of nucleotides, and its high inhibition efficiency of SERPINF2 gene can be maintained.

[0340] Exemplarily, the modified nucleoside has the structure shown below:

[0341] Wherein, Base represents a base, such as A, U, G, C or T, and the hydroxyl group at the 2' position of the ribose group is substituted by R. The hydroxyl group at the 2' position of these ribose groups can be substituted by various groups known to those skilled in the art, for example, R can be selected from halogen, alkyl, alkoxy, substituted alkyl and substituted alkoxy. For example, in some specific embodiments, the modified nucleotides include but are not limited to 2'-fluoro (2'-F) modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-deoxyribonucleotides.

[0342] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe, 2'-O-CH 3 ) modified nucleotides, etc.

[0343] In some embodiments, the 2'-substituted alkoxy modified nucleotide is 2'-methoxyethoxy (2'-O-CH 2 -CH 2 -O-CH 3 ) modified nucleotides, 2'-O-CH 2 -CH=CH 2 Modified nucleotides, etc.

[0344] In some embodiments, the 2'-substituted alkyl modified nucleotide is 2'-CH 2 -CH 2 -CH=CH 2 Modified nucleotides, etc.

[0345] In some embodiments, the modification of the nucleotide is the modification of the base. The modification of the base can be various types of modifications known to those skilled in the art. Exemplarily, the modification of the base includes but is not limited to m 6 A, Ψ, m 1 A.m 5 A.ms 2 i 6 A.i 6 A.m 3 C.m 5 C. ac 4 C.m 7 G、m 2,2 G、m 2 G、m 1 G, Q, m 5 U、mcm 5 U、ncm 5 U、ncm 5 Um、D、mcm 5 s 2 U、Inosine(I)、hm 5 C.s 4 U.s. 2 U, azobenzene, Cm, Um, Gm, t 6 A, yW, ms 2 t 6 A or its derivatives.

[0346] In some embodiments, nucleotide derivatives refer to compounds that can replace nucleotides in nucleic acids, but have structures different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxyribonucleotides. In some embodiments, nucleotide derivatives can be isonucleotides, bridged nucleic acids (BNAs) or acyclic nucleotides. BNAs refer to constrained or inaccessible nucleotides. BNAs can contain five-membered rings, six-membered rings, or seven-membered rings with a "fixed" C3'-endosugar condensed bridge structure. The bridge is usually incorporated into the 2'-, 4'-positions of the ribose to provide a 2', 4'-BNA nucleotide, such as LNA, ENA, cET, etc.

[0347] The nucleoside of LNA is shown in formula (1), the nucleoside of ENA is shown in formula (2), and the nucleoside of cET is shown in formula (3):

[0348]

[0349] Here, Base refers to base.

[0350] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), wherein UNA is shown in formula (4) and GNA is shown in formula (5):

[0351]

[0352] In the above formula (4) and formula (5), Base refers to a base, and R is selected from H, OH or alkoxy (—O-alkyl).

[0353] In some embodiments, nucleotide derivative modification refers to that the nucleotide in the nucleic acid is replaced by a nucleotide derivative. Exemplarily, the nucleotide derivative is selected from isonucleotides, LNA, ENA, cET, UNA or GNA.

[0354] In some embodiments, the nucleotides in the nucleic acid are replaced with isonucleotides, which are also referred to as isonucleoside modifications in the context of the present disclosure. In some embodiments, isonucleoside modifications include incorporating isonucleosides at one or more sites of the sense strand and / or antisense strand of a double-stranded ribonucleic acid (e.g., siRNA) to be modified to replace natural nucleosides for coupling at the corresponding positions.

[0355] In some embodiments, the isonucleoside modification adopts D-isonucleoside modification. In other embodiments, the isonucleoside modification adopts L-isonucleoside modification. In still other embodiments, the isonucleoside modification adopts D-isonucleoside modification and L-isonucleoside modification.

[0356] In some embodiments, the double-stranded RNA modification comprises a modification of the phosphodiester bond at at least one position. In some embodiments, the modification of the phosphodiester bond refers to that at least one oxygen atom in the phosphodiester bond is replaced by a sulfur atom to form a thiophosphate diester bond. The thiophosphate diester bond can stabilize the double-stranded structure of the double-stranded RNA (e.g., siRNA) and maintain the specificity of base pairing. Exemplarily, the thiophosphate diester bond structure is as follows:

[0357]

[0358] In some embodiments, the double-stranded RNA modification comprises at least one of the following chemical modifications:

[0359] (1) modification of at least one nucleotide in the sense strand,

[0360] (2) modification of the phosphodiester bond at at least one position in the sense strand,

[0361] (3) modification of at least one nucleotide in the antisense strand,

[0362] (4) Modification of the phosphodiester bond at at least one position in the antisense strand.

[0363] Furthermore, the double-stranded RNA modification product is a siRNA modification product comprising at least one chemical modification among (1) to (4).

[0364] In the present disclosure, after the sequence A in the sense strand and the sequence B in the antisense strand are at least partially complementary to form a double-stranded region, the 3' ends of the sequence A and the sequence B may be any of the following:

[0365] (1) The 3' ends of sequence A and sequence B are both blunt-ended;

[0366] (2) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B forms a blunt end;

[0367] (3) The 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence A forms a blunt end;

[0368] (4) The 3' end of sequence A has 1-2 protruding nucleotides extending beyond the double-stranded region, and the 3' end of sequence B has 1-2 protruding nucleotides extending beyond the double-stranded region.

[0369] In some embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0370] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, and there are no protruding nucleotides at the 3' ends of the sense strand and the antisense strand, 1-2 nucleotides are added to the 3' end of at least one of the sense strand and the antisense strand as protruding nucleotides. For example, the sense strand comprises sequence A and sequence D, wherein sequence D is 1-2 nucleotides connected to the 3' end of sequence A of the sense strand; the antisense strand comprises sequence B and sequence E, wherein sequence D is 1-2 nucleotides connected to the 3' end of sequence B of the antisense strand. In some preferred embodiments, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E. Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0371] Exemplarily, two deoxyribonucleotides (e.g., dTdT) are added to the 3' end of sequence A of the sense strand as sequence D, and two deoxyribonucleotides (e.g., dTdT) are added to the 3' end of sequence B of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (e.g., dTdT) are added only to the 3' end of sequence B of the antisense strand as sequence E. Alternatively, two deoxyribonucleotides (e.g., dTdT) are added only to the 3' end of sequence A of the sense strand as sequence D.

[0372] In some embodiments, when the nucleotide sequences of the sense strand and the antisense strand are at least partially complementary to form a double-stranded region, and there is no protruding nucleotide at the 3' end of the sense strand, a sequence D consisting of 1-2 nucleotides is added to the 3' end of the sense strand as a protruding nucleotide. Then, after the nucleotide sequence formed by connecting sequence A to sequence D is chemically modified, the sequence D consisting of 1-2 nucleotides is excluded, thereby further forming a modified product. Accordingly, in the double-stranded RNA modified product, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B. Alternatively, in the double-stranded RNA modified product, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0373] In some embodiments, when sequence A is complementary to sequence B to form a double-stranded region, the 3' end of sequence A has 1-2 nucleotides protruding out of the double-stranded region, the protruding nucleotides at the 3' end of sequence A are excluded as the nucleotide sequence of the sense strand. The sequence excluding the protruding nucleotides at the 3' end is called sequence A'. Accordingly, the nucleotide sequence of the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded RNA modified substance is the sequence shown in sequence B. Alternatively, the nucleotide sequence of the sense strand of the double-stranded RNA modified substance is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand of the double-stranded RNA modified substance is the sequence shown in sequence B connected to sequence E.

[0374] Herein, the ribose group of the 5' terminal nucleotide of the sense strand is the 5' hydroxyl group.

[0375] Herein, the nucleotide structure having a 5' hydroxyl group of the ribose group of the 5' terminal nucleotide of the sense strand is as shown in Formula X:

[0376]

[0377] Wherein, Base represents a base, such as A, U, G, C or T; R is hydroxyl or hydrogen or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino.

[0378] In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: 3-5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH 3Modified ribonucleotides. Optionally, along the 5' end to the 3' end direction, the sense strand includes one or more of the thiophosphate diester bonds at the following positions: between the first nucleotide and the second nucleotide at the 5' end, between the second nucleotide and the third nucleotide at the 5' end, between the first nucleotide and the second nucleotide at the 3' end, and between the second nucleotide and the third nucleotide at the 3' end. In a preferred embodiment, along the 5' end to the 3' end direction, the sense strand includes one or two of the thiophosphate diester bonds at the following positions: between the first nucleotide and the second nucleotide at the 5' end, between the second nucleotide and the third nucleotide at the 5' end. In a preferred embodiment, along the 5' end to the 3' end direction, the sense strand includes one of the thiophosphate diester bonds at the following positions: between the first nucleotide and the second nucleotide at the 5' end.

[0379] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 9, 10 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0380] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 5, 7, 8, and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0381] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 9, 10, and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0382] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 8, 9, and 10 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0383] In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the 8th, 9th, 10th and 11th ribonucleotides in the sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides in the remaining positions in the sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end. Optionally, the sense strand includes the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end.

[0384] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0385] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0386] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0387] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 8, and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0388] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 9, 11, and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0389] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0390] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 11, and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0391] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 7, 11, 12, and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0392] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0393] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0394] In some embodiments, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification includes the following modifications: the ribonucleotides at positions 3, 7, 11, 16, and 17 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides. Optionally, the sense strand includes one or more of the following phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0395] In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleotide modification includes thioate phosphorodiester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0396] In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleotide modification includes a phosphorothioate diester bond at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end. In some embodiments, along the 5' end to the 3' end direction, the sense strand of the double-stranded ribonucleotide modification includes a phosphorothioate diester bond at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end.

[0397] In some specific embodiments, the double-stranded ribonucleotide modification sense strand has the following characteristics: 1 )-(a35 ) any one of the structures shown in .

[0398] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: at least two or more ribonucleotides (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10) selected from positions 2-22 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Optionally, along the 5' end to the 3' end direction, the antisense strand includes one or more of the following positions of phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end. In a preferred embodiment, along the 5' end to the 3' end direction, the antisense strand includes the following positions of phosphorothioate diester bonds: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end. Optionally, the antisense strand has sequence E (e.g., dTdT).

[0399] In some embodiments, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0400] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0401] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0402] In some embodiments, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 14 and 16 in the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0403] In some embodiments, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0404] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0405] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0406] In some embodiments, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0407] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0408] In some embodiments, along the 5' end to the 3' end direction, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 5, 7, and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH 3 Modified ribonucleotides. Along the 5' end to the 3' end direction, the antisense strand includes phosphorothioate diester bonds at the following positions: between the first nucleotide and the second nucleotide starting from the 5' end, between the second nucleotide and the third nucleotide starting from the 5' end, between the first nucleotide and the second nucleotide starting from the 3' end, and between the second nucleotide and the third nucleotide starting from the 3' end.

[0409] In some embodiments, along the 5' end to the 3' end direction, the nucleotide at the 5' end of the antisense strand has a 5' phosphate group or a 5' phosphate derivative group. Exemplarily, the structure of the 5' phosphate group is: The structures of the 5' phosphate derivative group include but are not limited to: (EVP), wait.

[0410] In some specific embodiments, the antisense strand of the double-stranded ribonucleotide modification has the following characteristics: 1 )-(b 37 ) any one of the structures shown in .

[0411] In some optional embodiments, the sense strand comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 268 to 331, 430 to 432, 505 to 507, and 526 to 542, and the antisense strand comprises a nucleotide sequence as shown in any one of 332 to 419, 433 to 468, 480 to 498, 508 to 510, and 543 to 550.

[0412] In some preferred embodiments, the double-stranded RNA modification is a modification of double-stranded RNA comprising the following: the sense strand of the double-stranded RNA comprises a sequence selected from SEQ ID NO: 62, and the antisense strand of the double-stranded RNA comprises a sequence selected from SEQ ID NO: 162. Preferably, the sense strand of the double-stranded RNA modification comprises a sequence shown in SEQ ID NO: 276 or 526 to 541, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: sequences shown in SEQ ID NO: 343, 434 to 436, 480 to 482, and 543 to 548. More preferably, the sense strand of the double-stranded RNA modification comprises a sequence shown in any one of SEQ ID NO: 276, 526 and 534, and the antisense strand of the double-stranded RNA modification comprises a sequence selected from the following: SEQ ID NO: 482, 547 and 548.

[0413] In some embodiments, the double-stranded RNA modifications include, but are not limited to, the siRNA modifications shown in Table 2.

[0414] In some embodiments, the present invention further comprises excluding nucleotides with terminal protrusions of the above-mentioned double-stranded RNA modification to form a blunt end, thereby producing further double-stranded RNA modification, in particular, the 3' end of the sense strand of the above-mentioned double-stranded RNA modification is modified to be a blunt end, optionally, by excluding the protruding nucleotides extending out of the double-stranded region at the 3' end of the sense strand of the above-mentioned double-stranded RNA modification.

[0415] Conjugate of double-stranded RNA or double-stranded RNA modification

[0416] The third aspect of the present disclosure provides a conjugate of double-stranded RNA or double-stranded RNA modification (referred to herein as double-stranded RNA conjugate, or conjugate), which is obtained by conjugating the double-stranded RNA provided by the first aspect of the present disclosure or the double-stranded RNA modification provided by the second aspect with a conjugation group.

[0417] In the present disclosure, the sense strand and the antisense strand of the conjugate form a double-stranded region of the double-stranded RNA conjugate, and a blunt end is formed at the 3' end of the sense strand of the double-stranded RNA conjugate. In some embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate has 1-2 protruding nucleotides extending out of the double-stranded region. In other embodiments, the 3' end of the sense strand of the double-stranded RNA conjugate forms a blunt end, and the 3' end of the antisense strand of the double-stranded RNA conjugate forms a blunt end.

[0418] In some preferred embodiments, the double-stranded RNA conjugate is obtained by conjugating a double-stranded RNA modification with a conjugation group, wherein the sense strand and the antisense strand of the double-stranded RNA modification are at least partially complementary to form a double-stranded region of the double-stranded RNA modification, and the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the conjugation group is conjugated with the 3' end of the sense strand having the blunt end to form a double-stranded RNA conjugate.

[0419] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. In addition, the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected to a conjugated group to form a double-stranded RNA conjugate.

[0420] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. In addition, the 3' end of the sense strand of the double-stranded RNA modification forms a blunt end, and the 3' end of the sense strand of the double-stranded RNA modification is connected to a conjugated group to form a double-stranded RNA conjugate.

[0421] Exemplarily, the sense strand of the double-stranded RNA modification is a sequence shown by sequence A connected to sequence D, and the antisense strand is a sequence shown by sequence B connected to sequence E. In addition, the 3' end of the sense strand of the double-stranded RNA modification has a sequence D consisting of protruding 1-2 nucleotides, and after excluding the sequence D at the 3' end of the sense strand in the double-stranded RNA modification, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.

[0422] Exemplarily, the sense strand of the double-stranded RNA modification is a sequence shown by sequence A connected to sequence D, and the antisense strand is a sequence shown by sequence B. In addition, the 3' end of the sense strand of the double-stranded RNA modification has a sequence D consisting of protruding 1-2 nucleotides, and after excluding the sequence D at the 3' end of the sense strand in the double-stranded RNA modification, a conjugation group is connected to the 3' end of sequence A to form a double-stranded RNA conjugate.

[0423] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B connected to sequence E. Wherein, the 3' end of sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence after excluding the protruding nucleotide at the 3' end of sequence A (also known as sequence A') is used as the nucleotide sequence for connecting the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

[0424] Exemplarily, the sense strand of the double-stranded RNA modification is the sequence shown in sequence A, and the antisense strand is the sequence shown in sequence B. Wherein, the 3' end of sequence A has a protruding nucleotide extending out of the double-stranded region, and the sequence after excluding the protruding nucleotide at the 3' end of sequence A (also known as sequence A') is used as the nucleotide sequence for connecting the conjugated group. Therefore, the nucleotide sequence of the sense strand of the double-stranded RNA conjugate is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B.

[0425] Illustratively, the siRNA conjugate shown as N-ER-FY029045M3L96 is a conjugate obtained by a modification of N-ER-FY029045M3 and a conjugation group, wherein, based on the sequence of N-ER-FY029045M3, the 3' end of the sense strand of the conjugate originally has a protruding nucleotide -smUsmU extending out of the double-stranded region, and before combining with the conjugation group, the protruding -smUsmU nucleotide at the 3' end of the sense strand is excluded to form a conjugate containing 5'-mCsmUsmGmGmAmACfmAAfUfCfmCmGmAmAmCmAmGmCmUmA-3' (SEQ ID NO:270) as the nucleotide sequence for connecting the L96 conjugation group (i.e., L96 is connected by a phosphodiester bond after the sequence is synthesized to the blunt end). Therefore, the sequence forming the siRNA conjugate is: the positive strand is 5'-mCsmUsmGmGmAmACfmAAfUfCfmCmGmAmAmCmAmGmCmUmAL96-3' (SEQ ID NO:420), and the antisense strand is 5'-P1mUsAfsmGmCmUGfmUUfCfmGmGmAmUUfmGUfmUmCmCmAmGsmGsmA-3' (SEQ ID NO:334).

[0426] In some alternative embodiments, the sense strand of the double-stranded RNA conjugate has (d 1 )-(d 32 ) shows the structure:

[0427] (d 1 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f 10 f 11 f-mN 12 -mN13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3',

[0428] (d 2 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3',

[0429] (d 3 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -N 5 f-mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0430] (d 4 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -N 5f-mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0431] (d 5 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0432] (d 6 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN21 -L-3';

[0433] (d 7 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 f-mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0434] (d 8 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 f-mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0435] (d 9 )5'-mN 1 -(s)-mN 2 -mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 fN 11 f-mN12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0436] (d 10 )5'-mN 1 -(s)-mN 2 -mN 3 -mN 4 -mN 5 -mN 6 -mN 7 -N 8 fN 9 fN 10 fN 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0437] (d 11 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0438] (d 12 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0439] (d 13 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -N 15 f-mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0440] (d 14 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -N 15 f-mN 16 -mN 17 -mN 18 -mN 19 -mN20 -mN 21 -L-3';

[0441] (d 15 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0442] (d 16 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0443] (d 17 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 fN 8 fN 9 f-mN 10-mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0444] (d 18 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 fN 8 fN 9 f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0445] (d 19 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0446] (d 20 )5'-mN 1 -(s)-mN 2 -(s)-N3 f-mN 4 -mN 5 -mN 6 -mN 7 -mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0447] (d 21 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0448] (d 22 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -N 9 f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN18 -mN 19 -mN 20 -mN 21 -L-3';

[0449] (d 23 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0450] (d 24 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -N 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0451] (d 25 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8-mN 9 -mN 10 -N 11 fN 12 fN 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -L-3';

[0452] (d 26 )5'-mN 1 -(s)-mN 2 -(s)-mN 3 -mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 fN 12 fN 13 f-mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0453] (d 27 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -L-3';

[0454] (d 28 )5'-mN 1-(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0455] (d 29 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -L-3';

[0456] (d 30 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN16 -N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0457] (d 31 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f 17 f-mN 18 -mN 19 -L-3';

[0458] (d 32 )5'-mN 1 -(s)-mN 2 -(s)-N 3 f-mN 4 -mN 5 -mN 6 -N 7 f-mN 8 -mN 9 -mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f 17 f-mN 18 -mN 19 -mN 20 -mN 21 -L-3';

[0459] Among them, N 1 -N 21 The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide whose ribose group has a 2'-O-CH 3Modified ribonucleotide, lowercase letter f means that the ribonucleotide adjacent to the left of letter f is a ribonucleotide with 2'-F modification in the ribose group of the nucleotide, -(s)- means that the two adjacent nucleotides are connected by a phosphorothioate diester bond, and L represents a conjugated group (e.g., L96). L96 is also the conjugated group GalNAc shown in formula I.

[0460] In some alternative embodiments, the antisense strand of the double-stranded RNA conjugate has the above-mentioned (b 1 )-(b 37 ) any one of the structures shown in .

[0461] Further, the double-stranded RNA conjugate is a siRNA conjugate, wherein the siRNA molecule connected to the conjugation group in the siRNA conjugate can be an unmodified siRNA, or a siRNA modification. The siRNA molecule modified with the conjugation group has good tissue and organ targeting and the ability to promote cell endocytosis while maintaining high inhibitory activity and stability, which can reduce the impact on other tissues or organs and reduce the amount of siRNA molecules used, thereby achieving the purpose of reducing toxicity and reducing costs. Optionally, any one of the siRNA molecules shown in Table 1 or Table 1-1 or Table 2 is selected to be connected to the conjugation group to obtain a double-stranded RNA conjugate.

[0462] The conjugation site of siRNA and conjugation group can be at the 3' end or 5' end of the siRNA sense strand, at the 5' end of the antisense strand, or in the internal sequence of siRNA. In some embodiments, the conjugation site of siRNA and conjugation group is at the 3' end of the siRNA sense strand.

[0463] In some embodiments, the conjugated group can be connected to the phosphate group, 2'-hydroxyl group or base of the nucleotide. In some embodiments, the conjugated group can also be connected to the 3'-hydroxyl group, in which case the nucleotides are connected by 2',5'-phosphodiester bonds. When the conjugated group is connected to the end of the siRNA chain, the conjugated group is usually connected to the phosphate group of the nucleotide; when the conjugated group is connected to the internal sequence of the siRNA, the conjugated group is usually connected to the ribose sugar ring or the base. Various connection methods can be referred to in the literature: Muthiah Manoharanet.al.siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencingin vivo in hepatocytes.ACS Chemical biology, 2015, 10(5): 1181-7.

[0464] In the present disclosure, the conjugated group can be a ligand conventionally used in the field of siRNA administration. In some embodiments, the conjugated group can be selected from one or more of the ligands formed by the following targeting molecules or their derivatives: lipophilic molecules, such as cholesterol, bile acid, vitamins (such as vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as membrane-permeable peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folic acid (folate); receptor ligands expressed by hepatocytes, such as asialoglycoproteins, asialosugar residues, lipoproteins (such as high-density lipoproteins, low-density lipoproteins, etc.), glucagon, neurotransmitters (such as adrenaline), growth factors, transferrin, etc.

[0465] In some specific embodiments, the conjugated group has the structure of Formula I, Formula III, Formula IV, Formula V, Formula VI, Formula VII, Formula VIII, Formula IX as shown above.

[0466] The conjugated group shown in Formula I is GalNAc. GalNAc has liver targeting property and can deliver siRNA molecules to liver tissue with high specificity, thereby specifically inhibiting the high expression of SERPINF2 gene in the liver.

[0467] In some specific embodiments, GalNAc is conjugated to the 3' end of the sense strand via a phosphodiester bond to obtain a siRNA conjugate with the structure shown in the following formula II:

[0468]

[0469] The double helix structure is unmodified siRNA or siRNA modification.

[0470] In some embodiments, the double-stranded ribonucleic acid conjugates include, but are not limited to, siRNA conjugates as shown in Table 3.

[0471] Prodrug

[0472] "Prodrugs" as described herein refer to compounds that can be converted into active compounds through certain chemical or physiological processes (e.g., enzymatic processes and metabolic hydrolysis). Therefore, the term "prodrug" also refers to a precursor of a pharmaceutically acceptable biologically active compound.

[0473] In this article, considering the situation that the 5' terminal nucleotide of the antisense chain has a 5' hydroxyl group (i.e., no phosphate group), such an antisense chain will first be phosphorylated in vivo to convert the 5' terminal nucleotide into a nucleotide carrying a phosphate group, and then play a role in the body. Therefore, in the present invention, such siRNA, siRNA modifications, and siRNA conjugates are also referred to as prodrugs. For example, in this application, the siRNA modification or conjugate with M6 pattern modification is a prodrug of the siRNA modification or conjugate with M2 pattern modification, because the difference between M2 pattern modification and M6 pattern modification is whether there is P1 at the 5' end of the antisense chain. Similarly, the relationship between M7 pattern modification and M3 pattern modification is the same. Therefore, the double-stranded ribonucleic acid herein includes its corresponding prodrug.

[0474] Pharmaceutical composition

[0475] The fourth aspect of the present disclosure provides a pharmaceutical composition, comprising one or more of the double-stranded ribonucleic acid described in the first aspect, the modified double-stranded ribonucleic acid described in the second aspect, and the conjugate described in the third aspect.

[0476] In some embodiments, the pharmaceutical composition contains siRNA as described above as an active ingredient and a pharmaceutically acceptable carrier. In the present disclosure, the purpose of using the pharmaceutical composition is to promote administration to an organism, which is conducive to the absorption of the active ingredient and thus exerts biological activity. The pharmaceutical composition of the present disclosure can be administered in any form, including injection (intra-arterial, intravenous, intramuscular, intraperitoneal, subcutaneous), mucosal, oral (oral solid preparations, oral liquid preparations), rectal, inhalation, implantation, local (e.g., eye) administration, etc. Non-limiting examples of oral solid preparations include, but are not limited to, powders, capsules, lozenges, granules, tablets, etc. Non-limiting examples of liquid preparations for oral or mucosal administration include, but are not limited to, suspensions, tinctures, elixirs, solutions, etc. Non-limiting examples of topical preparations include, but are not limited to, emulsions, gels, ointments, creams, patches, pastes, foams, lotions, drops, or serum preparations. Non-limiting examples of parenteral preparations include, but are not limited to, solutions for injection, dry powders for injection, suspensions for injection, emulsions for injection, etc. The pharmaceutical compositions of the present disclosure can also be formulated into controlled-release or delayed-release dosage forms (eg, liposomes or microspheres).

[0477] In the present disclosure, the route of administration can be varied or adjusted in any applicable manner to meet the requirements of the properties of the drug, the convenience of the patient and the medical staff, and other relevant factors.

[0478] In some embodiments, the present disclosure provides a kit, comprising: a) the double-stranded RNA, double-stranded RNA modification, conjugate, or pharmaceutical composition thereof described in the present disclosure; and b) the following instructions for use:

[0479] (1) Inhibit SERPINF2 gene expression;

[0480] (2) For preventing or treating diseases related to abnormal expression of the SERPINF2 gene;

[0481] (3) For use in treating a subject suffering from a disease that would benefit from decreased SERPINF2 gene expression.

[0482] Medical Uses

[0483] The fifth aspect of the present disclosure provides at least one of the following uses of the double-stranded ribonucleic acid, double-stranded ribonucleic acid modification or its conjugate described in the present disclosure:

[0484] (1) Inhibiting SERPINF2 gene expression, or preparing a drug for inhibiting SERPINF2 gene expression;

[0485] (2) for preventing or treating diseases related to abnormal expression of SERPINF2 gene, or for preparing drugs for preventing or treating diseases related to abnormal expression of SERPINF2 gene;

[0486] (3) Use for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression.

[0487] The present disclosure further provides the use of siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions in at least one of the above (1)-(3).

[0488] In the present disclosure, abnormal expression of SERPINF2 gene causes one or more of the following diseases related to abnormal expression of SERPINF2 gene: unexplained bleeding, pulmonary embolism, hepatocellular carcinoma, acute myocardial infarction, focal cerebral infarction, spatial memory disorder, ischemic stroke, preeclampsia, fibrinolysis imbalance, fibrotic disease, myocardial infarction, heart failure, atrial fibrillation, cerebral hemorrhage, coronary artery disease and thrombosis, etc.

[0489] The siRNA molecule causes the expression of the SERPINF2 gene to be inhibited by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98% or at least about 99%, thereby achieving the treatment of diseases related to abnormal expression of the SERPINF2 gene.

[0490] In some embodiments, the present disclosure provides a method for inhibiting SERPINF2 gene expression in a cell, comprising contacting the double-stranded RNA, double-stranded RNA modification, or conjugate or pharmaceutical composition thereof described in the present disclosure with the cell.

[0491] Furthermore, the method for inhibiting the expression of SERPINF2 gene in cells is to introduce the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions described in the present disclosure into cells.

[0492] In some embodiments, the cell is an in vivo cell or an in vitro cell. In some specific embodiments, the cell is in a subject.

[0493] In some embodiments, the present disclosure provides a method for preventing or treating a disease, comprising administering to a subject the double-stranded RNA, double-stranded RNA modification, double-stranded RNA conjugate or pharmaceutical composition described in the present disclosure.

[0494] In some embodiments, the present disclosure provides a method for preventing or treating a disease, comprising administering to a subject an effective amount of double-stranded RNA, double-stranded RNA modification, or a conjugate or pharmaceutical composition thereof. In some embodiments, the effective amount is a therapeutically effective amount.

[0495] Can be administered to the subject by any suitable route known in the art. In some embodiments of the present disclosure, the route includes but is not limited to: oral or parenteral route, including intravenous administration, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), pulmonary administration, nasal administration, rectal administration and topical administration (including oral administration and sublingual administration) at least one. In some embodiments of the present disclosure, the frequency of administration may be once or more per day, per week, per month or per year. The dosage of siRNA described herein can be determined according to various parameters, especially the age, weight and sex of the subject.

[0496] Furthermore, the method for preventing or treating a disease is to administer the siRNA molecules (including unmodified siRNA, siRNA modifications, siRNA conjugates) or pharmaceutical compositions described in the present disclosure to a subject.

[0497] In the present disclosure, "subject" includes a human or non-human animal, preferably a vertebrate, and more preferably a mammal. The subject may include a transgenic organism. Most preferably, the subject is a human. Further, the subject has at least one of the following characteristics:

[0498] (1) abnormal expression of SERPINF2 gene in vivo, more specifically, abnormally high expression of SERPINF2 gene;

[0499] (2) suffering from diseases related to abnormal expression of SERPINF2 gene;

[0500] (3) People who suffer from diseases that would benefit from reduced SERPINF2 gene expression, such as people who suffer from or are prone to diseases associated with abnormal SERPINF2 gene expression.

[0501] Table 1 siRNA sequence information

[0502]

[0503]

[0504]

[0505]

[0506]

[0507] Table 1-1siRNA sequence information

[0508]

[0509]

[0510] Table 2 siRNA modifications

[0511]

[0512]

[0513]

[0514]

[0515]

[0516]

[0517]

[0518]

[0519]

[0520] In the above table, each of the capital letters "G", "C", "A", "dT" and "U" generally represents a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base, respectively; mA, mU, mC, mG: represent 2-methoxy modified nucleotides; Af, Gf, Cf, Uf: represent 2'-fluoro modified nucleotides; the lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate diester bond; P1 indicates that the nucleotide adjacent to the right of P1 is a 5'-phosphate nucleotide; EVP indicates that the nucleotide adjacent to the right of it is a 5'-trans vinylphosphonate nucleotide; [GNA] indicates that the ribonucleotide adjacent to the right of it is a ribonucleotide modified with GNA; optionally, the 5' terminal nucleotide of the antisense chain does not carry P1 or EVP indicates that the ribose group of the nucleotide has a 5' hydroxyl group.

[0521] Table 3 siRNA conjugates

[0522]

[0523]

[0524]

[0525]

[0526]

[0527] In the above table, the capital letters "G", "C", "A", "dT" and "U" each generally represent a nucleotide containing guanine, cytosine, adenine, thymine and uracil as a base respectively; mA, mU, mC, mG: represent 2'-methoxy modified nucleotides; Af, Gf, Cf, Uf: represent 2'-fluoro modified nucleotides; the lowercase letter s indicates that the two nucleotides adjacent to the letter s are connected by a thiophosphate diester bond; P1: indicates that the nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide; [GNA] indicates that the ribonucleotide adjacent to the right side is a ribonucleotide modified with GNA; EVP: indicates that the nucleotide adjacent to the right side is a 5'-trans vinyl phosphonate nucleotide; L96 is the conjugate group GalNAc shown in formula I; optionally, the 5' terminal nucleotide of the antisense chain does not carry P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

[0528] In Table 1, Table 1-1, Table 2 and Table 3, if there is no P1 or EVP on the left side of the 5' terminal nucleotide of the sense strand, the modified sense strand and the modified sense strand connected to the conjugated group, it means that the ribose group of the 5' terminal nucleotide does not have a 5' phosphate group or a 5' phosphate derivative group, but has a 5' hydroxyl group, and its structure is shown in Formula X:

[0529]

[0530] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, 2'-deoxynucleotide. For the case of siRNA modifications and conjugates, that is, in Tables 2 and 3, if the left side of the 5' terminal nucleotide of the antisense strand and the modified antisense strand is not marked with P1 or EVP, it means that the ribose group of the 5' terminal nucleotide does not have a 5' phosphate group or a 5' phosphate derivative group, and its structure is also shown in Formula X.

[0531] In Table 1, Table 1-1, Table 2 and Table 3, the 3' position of the 3' terminal nucleotide of the sense strand and the modified sense strand, and the 3' terminal nucleotide of the antisense strand and the modified antisense strand is a hydroxyl group.

[0532] Example

[0533] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples (although representing specific embodiments of the present disclosure) are given for illustrative purposes only, because after reading the detailed description, various changes and modifications made within the spirit and scope of the present disclosure will become apparent to those skilled in the art.

[0534] The experimental techniques and experimental methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods in the following examples that do not specify specific conditions are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through regular commercial channels unless otherwise specified.

[0535] The siRNA, siRNA modifications, and siRNA conjugates involved in the following examples were synthesized by Tianlin Biotechnology (Shanghai) Co., Ltd. The cells and reagents used in the examples are shown in Table 4:

[0536] Table 4

[0537]

[0538] Example 1: Synthesis of siRNA

[0539] 1.1 siRNA sequence design

[0540] Based on the human SERPINF2 gene mRNA sequence, different sites were selected to design multiple pairs of SERPINF2 siRNAs. All designed single siRNAs can target all transcripts of the target gene (as shown in Table 5). These multiple pairs of siRNAs have the lowest homology with all other non-target sequences after alignment by sequence similarity software.

[0541] Table 5

[0542] Target Gene Species Gene ID NM_ID SERPINF2 Homo sapiens 5345 NM_000934.4

[0543] The target sequence for designing siRNA is as follows, and the target sequence is derived from the mRNA sequence of SERPINF2 gene (referring to NM_000934.4). For the purpose of convenient comparison, the following target sequence is represented by the DNA sequence corresponding to the mRNA. In the synthesis process of the present embodiment, for the situation of adding ribonucleotides, the corresponding position of T is uracil ribonucleotide U or modified U.

[0544] Target sequence I:

[0545] CAAGGAGCCCGCAGAGGAA(SEQ ID NO:1)

[0546] Target sequence II:

[0547] TTGGGCCGGCAGCTAACTA(SEQ ID NO:2)

[0548] Target sequence III:

[0549] CACTTACCCTCCTCAAGTT(SEQ ID NO:3)

[0550] Target sequence IV:

[0551] GGCCAGACTGCCCTGAAGA(SEQ ID NO:4)

[0552] Target sequence V:

[0553] CCTTCACTGCCGACCTGTT(SEQ ID NO:5)

[0554] Target sequence VI:

[0555] CAGGATGTACCTGCAGAAAGGATTTCCCATCAAAGAAGATTTCCTGGAACAATCCGAACAGCTA TT(SEQ ID NO:6)

[0556] Target sequence VI-1:

[0557] CAGGATGTACCTGCAGAAAGGA(SEQ ID NO:18)

[0558] Target sequence VI-2:

[0559] TTCCCATCAAAGAAGATTTCCTGGAACAAT(SEQ ID NO:19)

[0560] Target sequence VI-3:

[0561] TTCCTGGAACAATCCGAACAGCTATT(SEQ ID NO:20)

[0562] Target sequence VII:

[0563] CGGGAAAGCAGGAAGATGACCTGGCAAACATCAACCAATGGGTGAAGGAGCACGGAGGGG AAGATTCAGGAATTCCTCTCTGGGCTGCCGGAAGACACCGTGTTGCTTCTCCTCAACGCCATCCACT TCCAGGGTTT(SEQID NO:7)

[0564] Target sequence VII-1:

[0565] CGGGAAAGCAGGAAGATGACCTGGCAAACATCAACCAATGGGTGAA (SEQ ID NO: 21) Target sequence VII-2:

[0566] CCACGGAGGGGAAGATTCA(SEQ ID NO:22)

[0567] Target sequence VII-3:

[0568] TGCCGGAAGACACCGTGTTGCTT(SEQ ID NO:23)

[0569] Target sequence VII-4:

[0570] TCCTCAACGCCATCCACTTCCAGGGTTT(SEQ ID NO:24)

[0571] Target sequence VIII:

[0572] AGCCTTACCCAGAGAGACT(SEQ ID NO:8)

[0573] Target sequence IX:

[0574] TCACGGTGCCCGTGGAAATGAT(SEQ ID NO:9)

[0575] Target sequence X:

[0576] GGTGGCTCATTTCCCCTTTAAGAACAACATGAGCTTTGTGGTCCTTGTACCCACCCACTTTGAATGGAACG (SEQ ID NO: 10)

[0577] Target sequence X-1:

[0578] GGTGGCTCATTTCCCCTTTAAGAA(SEQ ID NO:25)

[0579] Target sequence X-2:

[0580] TCCCCTTTAAGAACAACATGAGCTTTGTGG(SEQ ID NO:26)

[0581] Target sequence X-3:

[0582] GTCCTTGTACCCACCCACTTTGAATGGAACG(SEQ ID NO:27)

[0583] Target sequence X-4:

[0584] TTTAAGAACAACATGAGCTTTGTGGTCCT(SEQ ID NO:558)

[0585] Target sequence XI:

[0586] GGTCCGGCTGCCTAAGCTGTATCTGAAAC(SEQ ID NO:11)

[0587] Target sequence XII:

[0588] CCCGCGGAGACAAGCTTTTCGGCCCTGACTTAA(SEQ ID NO:12)

[0589] Target sequence XII-1

[0590] CCCGCGGAGACAAGCTTTT(SEQ ID NO:28)

[0591] Target sequence XII-2

[0592] GCTTTTCGGCCCTGACTTAA(SEQ ID NO:29)

[0593] Target sequence XIII:

[0594] GGGCAGTCTGAGAGAGGCCATTCTTTCCCAAC(SEQ ID NO:13)

[0595] Target sequence XIV:

[0596] GCCTGACCCTCATCTTTCTT(SEQ ID NO:14)

[0597] Target sequence XV:

[0598] TAGCTGCTCCCCACGTCAGCTGGGACACCCGACTTTTGTTTACCAGAGAAAAAA(SEQ ID NO:15)

[0599] Target sequence XV-1:

[0600] TAGCTGCTCCCCACGTCAGCTGGGACACC(SEQ ID NO:30)

[0601] Target sequence XV-2:

[0602] TGGGACACCCCGACTTTTGTTTTACCAGAGAAAAAA(SEQ ID NO:31)

[0603] Target sequence XVI:

[0604] CCTCGAGATCCCAACACTGCCAGCATTTCCC(SEQ ID NO:16)

[0605] Target sequence XVII:

[0606] AAGGATCCCATGAGCTCCTTAAGGCTCTTTTTGTAAGGTTTTTGTAGTGATTTTTATGCCACCTGA A(SEQ ID NO:17)

[0607] Target sequence XVII-1:

[0608] AAGGATCCCATGAGCTCCTTAAGGCTCTTTTTGTAAGGTTTTT (SEQ ID NO:32)

[0609] Target sequence XVII-2:

[0610] GTTTTTGTAGTGATTTTTATGCCACCTGAA(SEQ ID NO:33)

[0611] 1.2 Description of synthesis method:

[0612] By solid phase phosphoramidite method, nucleoside monomers are connected one by one from 3'-5' direction according to the arrangement order of nucleotides. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and capping. Among them, when two nucleotides are connected by phosphodiester bond, the connection of the next nucleoside monomer includes four steps of deprotection, coupling, oxidation and capping. When two nucleotides are connected by thiophosphate diester bond, the connection of the next nucleoside monomer includes four steps of deprotection, coupling, sulfurization and capping.

[0613] The synthesis conditions are given as follows:

[0614] The nucleoside monomer was provided in a 0.1 M acetonitrile solution. The deprotection reaction conditions in each step were the same, namely, the temperature was 25° C., the reaction time was 70 seconds, the deprotection reagent was a dichloroacetic acid solution in dichloromethane (3% V / V), and the molar ratio of dichloroacetic acid to the 4,4'-dimethoxytrityl protecting group on the solid phase carrier was 5:1.

[0615] The coupling reaction conditions for each step were the same, including a temperature of 25° C., a molar ratio of the nucleic acid sequence connected to the solid support to the nucleoside monomer of 1:10, a molar ratio of the nucleic acid sequence connected to the solid support to the coupling reagent of 1:65, a reaction time of 600 seconds, and a coupling reagent of 0.5 M acetonitrile solution of 5-ethylthio-1H-tetrazole.

[0616] The oxidation reaction conditions in each step were the same, including a temperature of 25° C., a reaction time of 15 seconds, and an oxidizing agent of 0.05 M iodine water. The molar ratio of iodine to the nucleic acid sequence connected to the solid phase support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran: water: pyridine = 3:1:1 (volume ratio).

[0617] The conditions of each step of the sulfurization reaction are the same, including a temperature of 25°C, a reaction time of 300 seconds, and a sulfurizing agent of hydrogenated xanthan. The molar ratio of the sulfurizing agent to the nucleic acid sequence connected to the solid phase support in the coupling step is 120:1. The reaction is carried out in a mixed solvent of acetonitrile: pyridine = 1:1 (volume ratio). The capping conditions are the same for each step, including a temperature of 25°C and a reaction time of 15 seconds. The capping agent solution is a mixed solution of CapA and CapB in a molar ratio of 1:1 (i.e., CapA: 20% (v / v) acetic anhydride acetonitrile solution, CapB: N-methylimidazole / pyridine / acetonitrile volume ratio of 20:30:50 solution), and the molar ratio of the capping agent to the nucleic acid sequence connected to the solid phase support is acetic anhydride: N-methylimidazole: nucleic acid sequence connected to the solid phase support = 1:1:1.

[0618] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase carrier is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and the antisense chain; finally, the two chains are heated and annealed to obtain the product, and freeze-dried to obtain freeze-dried powder.

[0619] In Example 1, modified or unmodified 3'-nucleoside phosphoramidite monomers were used for synthesis in a 3'-5' manner, so the nucleotides at the 5' ends of the obtained sense strand and antisense strand all had a hydroxyl group on the ribose group instead of a phosphate group. In addition, for the case where the nucleotide at the 5' end has a 5' phosphate group or a 5' phosphate derivative group, it can be obtained using a specific 3'-nucleoside phosphoramidite monomer according to the specific siRNA, such as a case with a 5'-phosphate group or 5'-EVP.

[0620] The synthesized siRNAs are shown in Table 1 and Table 1-1, and the synthesized siRNA modifications are shown in Table 2.

[0621] Example 2: Synthesis of siRNA conjugate (GalNAc-siRNA)

[0622] 2.1 The siRNA conjugate has the structure shown in the following formula II:

[0623]

[0624] 2.2 Synthesis of siRNA conjugates

[0625] In the first step, DMTr-L96 and succinic anhydride are reacted to obtain compound L96-A:

[0626]

[0627] Preparation process: DMTr-L96, succinic anhydride, 4-dimethylaminopyridine and diisopropylethylamine were added to dichloromethane, stirred at 25°C for 24 hours, and then the reaction solution was washed with 0.5M triethylamine phosphate, the aqueous phase was washed three times with dichloromethane, and the organic phases were combined and evaporated to dryness under reduced pressure to obtain a crude product. Then, column chromatography was used for purification to obtain pure L96-A.

[0628] In the second step, L96-A and NH 2 -SPS reaction to obtain L96-B:

[0629]

[0630] Preparation process: L96-A, O-benzotriazole-tetramethyluronium hexafluorophosphate (HBTU) and diisopropylethylamine (DIPEA) were mixed and dissolved in acetonitrile, stirred at room temperature for 5 minutes to obtain a uniform solution, and aminomethyl resin (NH 2-SPS, 100-200 mesh) to the reaction liquid, start the shaking reaction at 25°C, filter after the reaction for 18 hours, and wash the filter cake with dichloromethane and acetonitrile in turn to obtain a filter cake. The obtained filter cake is capped with a CapA / CapB mixed solution to obtain L96-B, which is a solid phase carrier containing a conjugated molecule, and then the nucleoside monomer is connected to the conjugated molecule under a coupling reaction, and then the siRNA sense chain connected to the conjugate molecule is synthesized according to the siRNA molecule synthesis method described above, and the siRNA antisense chain is synthesized using the siRNA molecule synthesis method described above, and annealing is performed to generate the siRNA conjugate of this application.

[0631] The synthesized siRNA conjugates are shown in Table 3.

[0632] Example 3: siRNA and siRNA modifications inhibit SERPINF2 gene expression

[0633] 3.1 Experimental Materials:

[0634] Huh7 cells were purchased from the Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences, catalog number SCSP-526;

[0635] RNA extraction kit, catalog number QIAGEN-74106;

[0636] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number 13778-150;

[0637] DMEM medium, purchased from Gibco, catalog number 11965118;

[0638] Reverse transcription kit ( Ⅲ1st Strand cDNA Synthesis Kit (+gDNA wiper), purchased from Vazyme, catalog number R312-02;

[0639] TaqMan TM Gene expression master mix, purchased from Applied Biosystems, catalog number 4369016;

[0640] Opti-medium: purchased from Gibco, product number 31985070;

[0641] SERPINF2 probe, purchased from Thermo; catalog number: Hs00168686_m1;

[0642] TaqMan Gene Expression Assay (GAPDH), purchased from Thermo, catalog number Hs99999905_m1.

[0643] 3.2 Experimental methods:

[0644] 3.2.1 Huh7 cells were resuspended in DMEM medium without PS (penicillin-streptomycin mixture) to a density of 2×10 5 / mL of cell suspension was plated in a 96-well plate, and 100 μL of cell suspension was added to each well, i.e. 20,000 cells / well.

[0645] 3.2.2 Dry powders of the siRNA to be tested and siRNA modifications (collectively referred to as siRNA in the experimental process of this example for ease of description) were centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0646] 3.2.3 Preparation of 2 nM siRNA diluent Z and 0.2 nM siRNA diluent W

[0647] (1) Preparation of 0.1 μM siRNA stock solution X and 0.01 μM siRNA stock solution Y:

[0648] a) Take 2 μL of the 100 μM siRNA stock solution prepared in step 3.2.2 above, add 18 μL of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 10 μM;

[0649] b) taking 2 μL of the 10 μM siRNA dilution prepared in step a), adding 18 μL of ultrapure distilled water to obtain a siRNA dilution with a final concentration of 1 μM;

[0650] c) taking 2 μL of the 1 μM siRNA dilution prepared in step b), adding 18 μL of ultrapure distilled water to obtain a siRNA stock solution X with a final concentration of 0.1 μM;

[0651] d) taking 2 μL of the 0.1 μM siRNA stock solution X prepared in step c), adding 18 μL of ultrapure distilled water to obtain a siRNA stock solution Y with a final concentration of 0.01 μM;

[0652] (2) Take 2 μL of the above-prepared siRNA stock solution X and siRNA stock solution Y, respectively, and add 98 μL of Opti-medium to obtain 2 nM siRNA dilution solution Z and 0.2 nM siRNA dilution solution W, respectively.

[0653] 3.2.4 Transfection of Huh7 cells

[0654] (1) Take 3 μL RNAiMAX transfection reagent, add 97 μL Opti-medium, and obtain RNAiMAX transfection reagent diluent; RNAiMAX transfection reagent diluent and 2nM siRNA diluent Z prepared in step 3.2.3 were mixed in a volume ratio of 1:1 to prepare a transfection mixture, which was allowed to stand for 5 minutes. 10 μL of the transfection mixture was added to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, siRNA concentration in this system was 0.1 nM);

[0655] (2) Take 3 μL RNAiMAX transfection reagent, add 97 μL Opti-medium, and obtain RNAiMAX transfection reagent diluent; RNAiMAX transfection reagent diluent and 0.2 nM siRNA diluent W prepared in step 3.2.3 were mixed in a volume ratio of 1:1 to prepare a transfection mixture, which was allowed to stand for 5 minutes. 10 μL of the transfection mixture was added to a 96-well plate to transfect the Huh7 cells cultured in step 3.2.1 (final volume 100 μL, the concentration of siRNA in this system was 0.01 nM).

[0656] The cells were cultured for 24 hours after the above transfection; 2 replicates were set for each concentration (0.1 nM and 0.01 nM).

[0657] 3.2.5 According to the instructions of the reverse transcription kit, extract the total RNA of Huh7 cells obtained in step 3.2.4:

[0658] 3.2.6 Reverse transcribe total RNA into cDNA according to the following steps:

[0659] a) Remove gDNA using gDNA enzyme according to the table below;

[0660] Table 6

[0661] Volume / μL 5×gDNA wiper Mix 2 Sample(RNA) 8

[0662] 42°C, 2 min;

[0663] b) Add the following reagents to the system obtained in step a) and perform reverse transcription procedure

[0664] Table 7

[0665]

[0666]

[0667] 50℃, 15min; 85℃, 5s.

[0668] c) The reverse transcription product obtained in step b) was stored at 4°C for real-time PCR analysis.

[0669] 3.2.7 Real-time PCR analysis

[0670] a) Prepare qPCR reaction mixture as shown in the table below. Keep all reagents on ice during the entire operation.

[0671] Table 8

[0672]

[0673] b) Perform qPCR procedure as follows

[0674] 50°C, 2 minutes, 95°C, 10 minutes;

[0675] 95°C, 15 seconds, 60°C, 1 minute (40 cycles of this operation).

[0676] 3.2.8 Result Analysis

[0677] a) Quant Studio 6Flex software was used with default settings to automatically calculate the Ct value;

[0678] b) Calculate the relative expression of genes using the following formula:

[0679] ΔCt=Ct(SERPINF2 gene)–Ct(GAPDH)

[0680] ΔΔCt=ΔCt(test sample group)-ΔCt(Mock group)

[0681] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0682] Inhibition rate (%) = (relative expression of mRNA in the Mock group - relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%

[0683] The Mock group refers to a group to which no siRNA is added compared with the test sample group.

[0684] 3.3 Results of Silencing Experiment

[0685] The siRNAs to be tested at concentrations of 0.1 nM and 0.01 nM were selected to test the inhibition rate of the target SERPINF2 mRNA. The results are shown in Table 9 below.

[0686] Table 9

[0687]

[0688]

[0689]

[0690] Note: “-” results are not shown.

[0691] As shown in Table 9, the siRNA, its modifications and conjugates of the present invention can significantly inhibit the expression of SERPINF2 gene at 0.1 nM and 0.01 nM. Among them, in particular, the siRNA and its modifications and conjugates containing SEQ ID NO: 62 and SEQ ID NO: 162 as the sense strand and antisense strand, wherein the siRNA and its modifications have a 24h inhibition rate of about 75% or more, or even about 90% or more at 0.1 nM; the 24h inhibition rate at 0.01 nM is about 60% or more, or even about 70% or more; wherein the siRNA conjugate has a 24h inhibition rate of about 85% or more, or even about 95% or more at 0.1 nM; and the 24h inhibition rate at 0.01 nM is about 80% or more, or even about 90% or more.

[0692] 3.4IC 50 Measurement results

[0693] The following siRNA concentration ranges were set (nM): 10, 2.5, 0.625, 0.156, 0.039, 0.0097, 0.0024, 0.0006, and IC was determined in a similar manner as in 3.2. 50 Determination.

[0694] Result analysis:

[0695] a) Quant Studio 6Flex software was used with default settings to automatically calculate Ct values;

[0696] b) Calculate the relative expression of genes using the following formula:

[0697] ΔCt=Ct(SERPINF2 gene)–Ct(GAPDH)

[0698] ΔΔCt=ΔCt(test sample group)-ΔCt(Mock group), where the Mock group represents the group without siRNA added compared with the test sample group;

[0699] mRNA expression relative to the Mock group = 2 -ΔΔCt

[0700] Inhibition rate (%) = (relative expression of mRNA in the Mock group – relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%

[0701] Calculation process: The log value of siRNA concentration was used as the X-axis and the percentage inhibition rate was used as the Y-axis. The "log (inhibitor) vs. response-variable slope" function module of the analysis software GraphPad Prism 8 was used to fit the dose-effect curve to obtain the IC of each siRNA. 50 value.

[0702] The fitting formula is: Y = Bottom + (Top-Bottom) / (1 + 10^((logIC 50 -X)*HillSlope))

[0703] Among them: Top represents the percentage inhibition rate at the top platform, and the Top standard of the curve is generally between 80% and 120%; Bottom represents the percentage inhibition rate at the bottom platform, and the Bottom of the curve is generally between -20% and 20%; HillSlope represents the slope of the percentage inhibition rate curve.

[0704] Table 10

[0705] <![CDATA[ siRNA ID ]]> <![CDATA[ IC 50 (nM) ]]> N-ER-FY029032M3 1.5053 N-ER-FY029045M2 0.0138 N-ER-FY029060M2 0.0230 N-ER-FY029088M2 0.0144 N-ER-FY029090M2 0.0275 N-ER-FY029097M2 0.0210 N-ER-FY029097M3 0.0092 N-ER-FY029099M2 0.0188 N-ER-FY029028M2 0.1411 N-ER-FY029033M2 0.5621 N-ER-FY029113M2 0.3207 N-ER-FY029095M2 0.0802 N-ER-FY029111M2 0.2647 N-ER-FY029093M2 0.3778 N-ER-FY029036M2 0.5146 N-ER-FY029115M2 0.1297 N-ER-FY029116M2 0.1125 N-ER-FY029117M2 0.1379

[0706] As can be seen from Table 10, the siRNA provided in the present application has a higher SERPINF2 gene inhibition activity in Huh7 cells.

[0707] Example 4: Delivery System Validation

[0708] 4.1 Experimental Materials:

[0709] Human primary hepatocytes PHH cells were provided by Shanghai WuXi AppTec Pharmaceuticals Co., Ltd.;

[0710] PHH medium: invitroGRO CP Meduim serum free BIOVIT, catalog number: S03316

[0711] RNAiMAX transfection reagent, purchased from Invitrogen, catalog number: 13778-150;

[0712] RNA Extraction Kit 96Kit, purchased from QIAGEN, catalog number: QIAGEN-74182;

[0713] Reverse transcription kit ( Ⅲ1st Strand cDNA Synthesis Kit (+gDNA wiper), purchased from Vazyme, catalog number R312-02;

[0714] FastStart Universal Probe master, purchased from Roche, catalog number: 04914058001;

[0715] SERPINF2 and GAPDH primers were provided by Shanghai WuXi AppTec Co., Ltd.

[0716] 4.2 Experimental methods:

[0717] siRNA conjugates (final concentration of siRNA conjugates was 5 nM and 0.5 nM, duplicate wells) were transfected into PHH cells by the following process: frozen PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 10 5 cells / mL, applied simultaneously The siRNA conjugates were transfected into cells using RNAiMax transfection reagent and seeded into 96-well plates at a density of 54,000 cells per well. 100 μL of PHH medium was added to each well. The cells were placed in a 5% CO 2 , 37°C incubator. After 48 hours, remove the culture medium and collect the cells for total RNA extraction. Use according to the kit product instructions. Total RNA was extracted using 96Kit.

[0718] siRNA conjugates (final concentrations of siRNA conjugates were 100 nM and 10 nM, in duplicate) were freely taken up by PHH cells, and the process was as follows: cryopreserved PHH cells were taken, revived, counted, and the number of cells was adjusted to 6 × 10 5 54,000 cells / mL were added to the siRNA conjugates and seeded into 96-well plates at a density of 54,000 cells per well, with 100 μL of culture medium per well. The cells were placed in 5% CO 2 , 37°C incubator. After 48 hours, remove the culture medium and collect the cells for total RNA extraction. Use according to the kit product instructions. Total RNA was extracted using 96Kit.

[0719] The extracted total RNA was reverse transcribed into cDNA by reverse transcription reaction in a similar manner as in Example 3.

[0720] The SERPINF2 cDNA obtained by reverse transcription was quantitatively amplified by qPCR. GAPDH cDNA will be amplified in parallel as an internal control. The PCR reaction program is: 95°C, 10 minutes, then enter the cycling mode, 95°C, 15 seconds, then 60°C, 60 seconds, for a total of 40 cycles.

[0721] 4.3 Results Analysis

[0722] a) Quant Studio 7 software was used with default settings to automatically calculate the Ct value;

[0723] b) Calculate the relative expression of genes using the following formula:

[0724] ΔCt=Ct(SERPINF2 gene)–Ct(GAPDH)

[0725] ΔΔCt=ΔCt(test sample group)-ΔCt(Mock group)

[0726] mRNA expression relative to the Mock group = 2 -ΔΔCt .

[0727] Inhibition rate (%) = (relative expression of mRNA in the Mock group – relative expression of mRNA in the test sample group) / relative expression of mRNA in the Mock group × 100%;

[0728] The Mock group refers to a group without the addition of siRNA conjugates compared with the test sample group.

[0729] Table 11

[0730]

[0731]

[0732] L96 in the above table is the conjugate group GalNAc shown in Formula I. As can be seen from Table 11, the siRNA conjugates provided by the present application have high SERPINF2 gene inhibition activity in PHH cells. Among them, in particular, the conjugates of siRNA containing SEQ ID NO: 62 and SEQ ID NO: 162 as the sense strand and the antisense strand, in which the inhibition rate at 100 nM for 48 h is about 90% or more when entering PHH through free uptake; in which the inhibition rate at 5 nM for 48 h is about 90% or more when entering PHH through transfection.

[0733] Example 5: Silencing effect of siRNA conjugates in mice expressing the human SERPINF2 (hSERPINF2) gene

[0734] (1) Construction of hSERPINF2 gene overexpressing mouse model using AAV

[0735] C57BL / 6 male mice aged 6-8 weeks (provided by Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) were introduced into the facility. After 3-5 days of adaptive feeding, a single injection of adeno-associated virus AAV (pAAV[Exp]-CBh>SEAP:{SERPINF2 part CDS+UTR}, virus provided by Yunzhou Biotechnology (Guangzhou) Co., Ltd.) carrying the hSERPINF2 gene was performed via the tail vein for target gene overexpression modeling. The administration volume was 100 μL (6×10 11 vg) / head, and then fed with normal feed.

[0736] (2) Investigation of the efficacy of silencing siRNA in hSERPINF2 mouse model

[0737] 14 days after AAV virus injection, the mice were divided into groups (6 mice per group) and subcutaneously administered a single 3 mpk dose of the siRNA conjugate of the present application and PBS (purchased from Gibco, catalog number 10010-023). SEAP protein expression (i.e., hSERPINF2 protein expression) was detected on days 7, 14, 21, 28, 35, 42, 49, 56, 63, and 70 after administration.

[0738] Inhibition rate = (1-relative expression of SEAP protein in the sample group / relative expression of SEAP protein in the blank group) * 100%. The results are shown in the following table:

[0739] Table 12 Inhibition rate of hSERPINF2 by siRNA conjugates

[0740]

[0741] Note: “-” results are not shown.

[0742] It can be seen from Table 12 that at a dose of 3 mpk, the siRNA conjugate N-ER-FY029028M2L96 of the present application has the most excellent inhibitory activity on the hSERPINF2 gene in vivo, and the inhibition rate during the 70th day of the test measurement is above 50%.

[0743] Example 6 Inhibitory effect of siRNA conjugates on SERPINF2 gene expression in wild-type mice

[0744] Wild-type C57BL / 6 male mice aged 6-8 weeks (Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were randomly divided into groups according to body weight after 7 days of adaptive feeding, with 6 mice in each group, and subcutaneously administered a single dose of 3 mg / kg of the siRNA conjugate of the present application and PBS (purchased from Gibco, catalog number 10010-023), with an injection volume of 5 μL / g. The mice were euthanized 14 days after administration, and 30 mg of two portions of mouse left lobe liver tissue were collected and quickly frozen in liquid nitrogen. After freeze-grinding into tissue homogenate, tissue RNA was extracted and target gene mRNA expression was detected. The results are shown in the following table.

[0745] Table 13

[0746]

[0747]

[0748] It can be seen from Table 13 that at a dose of 3 mpk, the siRNA conjugate N-ER-FY029028M8L96 of the present application has the highest inhibitory activity against the SERPINF2 gene in vivo, with an inhibition rate of 85.43% during the 14th day of the test.

[0749] Example 7 Inhibitory Effect of siRNA Conjugates on SERPINF2 Gene Expression in Mice

[0750] Wild-type C57BL / 6 male mice aged 6-8 weeks (Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.) were randomly divided into groups according to body weight after 7 days of adaptive feeding, with 6 mice in each group, and subcutaneously administered a single dose of 3 mg / kg of the siRNA conjugate of the present application and PBS (purchased from Gibco, catalog number 10010-023), with an injection volume of 5 μL / g. The mice were euthanized 14 days after administration, and 30 mg of two portions of mouse left lobe liver tissue were collected and quickly frozen in liquid nitrogen. After freeze-grinding into tissue homogenate, tissue RNA was extracted and target gene mRNA expression was detected. The results are shown in the following table.

[0751] Table 14

[0752]

[0753] It can be seen from Table 14 that at a dose of 3 mpk, the siRNA conjugate of the present application has a high inhibitory activity on the SERPINF2 gene in vivo, and the inhibition rate during the experimental determination on the 14th day was above 86%.

[0754] Example 8 In vitro stability test of rat liver homogenate

[0755] 1. Experimental reagents and consumables

[0756]

[0757] 2. Experimental Procedure

[0758] 2.1 Preparation of liver homogenate

[0759] 2.1.1 Grinding fluid configuration

[0760]

[0761]

[0762] 2.1.2 Tissue homogenization

[0763] The rat liver tissue and grinding solution were mixed into liver homogenate at 100 mg:5 mL and 100 mg:2.5 mL (concentrations were 20 mg / mL and 40 mg / mL, respectively); after preparation, grinding beads were added into the homogenizer, and the grinding parameters were set as follows.

[0764] Running speed 60Hz Run time 30s Pause time 15s Number of runs 4 times Operating temperature -20℃

[0765] 2.2 Sample configuration

[0766] The siRNA conjugate sample was prepared with enzyme-free water to a 1 mg / mL solution for later use. The internal standard sample was prepared with enzyme-free water to a concentration of 0.125 mg / mL.

[0767] 2.3 Sample incubation

[0768] (1) Add 250 μL of prepared liver homogenate to a 2 mL enzyme-free tube.

[0769] (2) Add 50 μL of nucleic acid sample based on step 1;

[0770] (3) The system is 300 μL of biological sample, vortexed, and allowed to stand for 5 min;

[0771] (4) Divide into 2 tubes, 100 μL each;

[0772] (5) System incubation time: 48h

[0773] 2.4 Biological sample processing

[0774] Vortex and mix every 100 μL of biological sample system, add 300 μL of clarity OTX lysis buffer and vortex, let stand for 30 min, add 100 μL of internal standard solution, vortex, let stand for 5 min, centrifuge for 1 min, and set aside (total sample volume is about 500 μL);

[0775] 2.5 Solid Phase Extraction:

[0776] (1) Solid phase extraction reagent configuration

[0777] Activator: Take 200 mL of methanol into the mobile phase bottle and mark it as activator;

[0778] Balance solution: prepare 1M phosphate buffer solution [877mL sodium dihydrogen phosphate (1.56g / L) + 123mL sodium dihydrogen phosphate (3.58g / L)], dilute 100 times, adjust the pH to 5.5 with phosphoric acid, and mark it as balance solution;

[0779] Flushing solution: Take 500 mL of the balance solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, adjust the pH to 5.5 with phosphoric acid, mix well, and mark as flushing solution;

[0780] Eluent: weigh 7.9 g of ammonium bicarbonate into a 1 L mobile phase bottle, add 1 L of water, take 500 mL of ammonium bicarbonate solution into a 1 L mobile phase bottle, add 500 mL of acetonitrile, adjust pH to 9 with sodium hydroxide, mix well, and mark as eluent;

[0781] (2) Extraction steps, as shown in the following table:

[0782]

[0783]

[0784] 2.6 Post-processing

[0785] The eluate (twice, 600 mL each time, 1200 mL in total) was placed in a 2 mL EP tube and concentrated under vacuum for 6 hours at a speed of 1800 rpm; 100 μL of mobile phase (initial ratio) was added to the concentrated sample for re-dissolution, centrifuged at low speed for 2 min, and 10 μL of the supernatant was injected into a high-resolution mass spectrometer. The LC-MS / MS method was used to semi-quantitatively detect the antisense strand of the siRNA conjugate of the present application and the antisense strand ratio of the main metabolites.

[0786] It can be concluded from this experiment that the siRNA conjugates N-ER-FY029028M40L96 and N-ER-FY029028M44L96 of the present disclosure have excellent in vitro stability in rat liver homogenate, which is better than N-ER-FY029028M11L96.

[0787] The above embodiments of the present disclosure are merely examples for clearly illustrating the present disclosure, and are not intended to limit the implementation methods of the present disclosure. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation methods here. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present disclosure shall be included in the protection scope of the claims of the present disclosure.

Claims

1. A double-stranded RNA, comprising a sense strand and an antisense strand, wherein the sense strand is reverse complementary to the antisense strand and / or substantially reverse complementary to form a double-stranded region of the double-stranded RNA; in, The sense strand comprises a sequence A that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides in the target sequence, and the antisense strand comprises a sequence B that differs by no more than 3 nucleotides from the reverse complementary sequence of at least 15 consecutive nucleotides in the target sequence; The target sequence is selected from the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 17.

2. The double-stranded RNA according to claim 1, wherein The target sequence is selected from the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 8, 9, 11, 13, 14, 16, 18-33 and 558, the sense strand comprises a sequence A consisting of at least 15 consecutive nucleotides in the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 8, 9, 11, 13, 14, 16, 18-33 and 558, and the antisense strand comprises a sequence B that is reverse complementary and / or substantially reverse complementary to a sequence consisting of at least 15 consecutive nucleotides in the nucleotide sequence as shown in any one of SEQ ID NOs: 1-5, 8, 9, 11, 13, 14, 16, 18-33 and 558; Preferably, the sense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides; or, the antisense strand consists of 15-28 nucleotides, preferably 18-25 nucleotides, more preferably 18-23 nucleotides, more preferably 19, 21 or 23 nucleotides.

3. The double-stranded RNA according to claim 1 or 2, wherein The nucleotide sequence of the sense strand is or comprises a sequence A that differs by no more than 1 nucleotide compared to a sequence consisting of 15 to 28 consecutive nucleotides, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33; wherein the nucleotide sequence of the antisense strand is or comprises a sequence B that differs by no more than 1 nucleotide from a sequence that is reverse complementary and / or substantially reverse complementary to a sequence consisting of 15 to 28 consecutive nucleotides, preferably 18 to 25 consecutive nucleotides, more preferably 18 to 23 consecutive nucleotides, more preferably 19, 21 or 23 consecutive nucleotides in the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 5, 8, 9, 11, 13, 14, 16, 18 to 33, 558; Optionally, the length of the double-stranded region is 15-25 nucleotides, preferably 18-23 nucleotides, more preferably 18-21 nucleotides, more preferably 19, 21 or 23 nucleotides; Optionally, the sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the sense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the antisense strand forms a blunt end; or, The sense strand and the antisense strand are at least partially complementary to form the double-stranded region, and the 3' end of the antisense strand has 1-2 protruding nucleotides extending out of the double-stranded region, and the 3' end of the sense strand forms a blunt end; or, The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand each have 1-2 protruding nucleotides extending out of the double-stranded region; or, The sense strand and the antisense strand are at least partially complementary to each other to form the double-stranded region, and the 3' ends of the sense strand and the antisense strand both form blunt ends.

4. The double-stranded RNA according to any one of claims 1 to 3, wherein The sense strand comprises any one selected from SEQ ID NOs: 34-133, 234-250, 426-427, 499-501, 513-518 shown in Table 1 and Table 1-1, and the antisense strand comprises any one selected from SEQ ID NOs: 134-233, 251-267, 428-429, 502-504, 519-525 shown in Table 1 and Table 1-1; The sense strand and antisense strand are selected from the sense strand and antisense strand of any one siRNA shown in Table 1 or Table 1-1; The sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA1 to siRNA100, siRNA228 to siRNA229, siRNA343 to siRNA345, and siRNA352 to siRNA358 shown in Table 1; Preferably, the sense strand and the antisense strand are selected from the combination of sense strands or antisense strands shown in siRNA29, siRNA41, siRNA80, siRNA92, siRNA96, siRNA98, siRNA100, siRNA228, siRNA229 or siRNA343 to siRNA345 shown in Table 1; Preferably, the sense strand and the antisense strand are selected from the combination of the sense strand and the antisense strand of siRNA29 shown in Table 1; Alternatively, the sense strand of the double-stranded RNA comprises the sequence of SEQ ID NO: 62, and the antisense strand of the double-stranded RNA comprises the sequence of SEQ ID NO: 162, Optionally, the 5' terminal nucleotide of the antisense strand has a group selected from the group consisting of a 5'-hydroxyl group, a 5' phosphate group, or a 5' phosphate-derived group.

5. A modified double-stranded RNA, which is a modified double-stranded RNA according to any one of claims 1 to 4, wherein the modified double-stranded RNA comprises at least one of the following chemical modifications: (1) modification of at least one nucleotide in the sense strand, (2) modification of the phosphodiester bond at at least one position in the sense strand, (3) modification of at least one nucleotide in the antisense strand, (4) modification of the phosphodiester bond at at least one position in the antisense strand; Optionally, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A and sequence D, wherein the 3' end of sequence A in the sense strand is connected to sequence D consisting of 1-2 nucleotides, preferably sequence D consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the antisense strand of the double-stranded RNA modification comprises sequence B and sequence E, wherein the 3' end of sequence B in the antisense strand is connected to sequence E consisting of 1-2 nucleotides, preferably sequence E consisting of 1-2 thymine deoxyribonucleotides; and / or, the nucleotide sequence of the sense strand of the double-stranded RNA modification comprises sequence A', wherein sequence A' is formed by excluding 1-2 nucleotides from the 3' end of sequence A in the sense strand; Optionally, the sense strand and antisense strand of the double-stranded RNA modification are selected from the following sequence combinations: The nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown by sequence A connected to sequence D, and the nucleotide sequence of the antisense strand is the sequence shown by sequence B connected to sequence E; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B; Alternatively, the nucleotide sequence of the sense strand is the sequence shown in sequence A', and the nucleotide sequence of the antisense strand is the sequence shown in sequence B connected to sequence E.

6. The double-stranded RNA modified substance according to claim 5, wherein Along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: 3-5 ribonucleotides selected from the 3rd, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th and 17th positions in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Preferably, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 7, 9, 10 and 11 in sequence A of the sense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 5, 7, 8 and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 9, 10 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 8, 9 and 10 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the 8th, 9th, 10th and 11th ribonucleotides in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides in the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9, 11, 13 and 15 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 9, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 8 and 9 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 9, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 9 and 11 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 11 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 7, 11, 12 and 13 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 11 and 16 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 11 and 17 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the sense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 3, 7, 11, 16 and 17 in sequence A of the sense strand are 2'-fluoro-modified ribonucleotides; the ribonucleotides at the remaining positions in sequence A of the sense strand are 2'-methoxy-modified ribonucleotides; or, Wherein, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: at least two or more ribonucleotides selected from positions 2 to 22 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Preferably, From the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 8, 9, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, in the direction from the 5' end to the 3' end, the ribonucleotides at positions 2, 6, 14 and 16 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 7 in sequence B of the antisense strand is a ribonucleotide modified with the nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 3, 4, 5, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, the ribonucleotide at position 6 in sequence B of the antisense strand is a ribonucleotide modified with a nucleotide derivative GNA, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, along the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 7, 10 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides; Alternatively, in the direction from the 5' end to the 3' end, the antisense strand of the double-stranded ribonucleotide modification comprises the following modifications: the ribonucleotides at positions 2, 5, 7 and 14 in sequence B of the antisense strand are 2'-F modified ribonucleotides, and the ribonucleotides at the remaining positions in sequence B of the antisense strand are 2'-O-CH3 modified ribonucleotides, Preferably, the ribose group of the 5' terminal nucleotide of the antisense strand has any one selected from the following: a 5' hydroxyl group, a 5' phosphate group or a 5' phosphate derivative group.

7. The double-stranded RNA modified substance according to claim 5 or 6, wherein The sense strand comprises phosphorothioate diester bonds located at the following positions along the 5' to 3' terminus: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the sense strand; and / or Between the second nucleotide and the third nucleotide starting from the 3' end of the sense strand; or, The sense strand contains phosphorothioate diester bonds located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; and / or Between the second nucleotide and the third nucleotide starting from the 5' end of the sense strand, or, The sense strand contains phosphorothioate diester bonds located at the positions shown below: between the first nucleotide and the second nucleotide starting from the 5' end of the sense strand; optionally, in the direction from the 5' end to the 3' end, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group; or, The antisense strand contains phosphorothioate diester bonds located at the positions shown below: Between the first nucleotide and the second nucleotide starting from the 5' end of the antisense strand; Between the second nucleotide and the third nucleotide starting from the 5' end of the antisense strand; Between the first nucleotide and the second nucleotide starting from the 3' end of the antisense strand; and / or The antisense strand is located between the second nucleotide and the third nucleotide starting from the 3' end.

8. The double-stranded RNA modified substance according to any one of claims 5 to 7, wherein The positive strand of the double-stranded RNA modification has the following characteristics: (a1)-(a 35 ) any structure shown in: <h2 style=";text-align:left;direction:ltr">(a1)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(a2)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(a3)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(a4)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(a5)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a6)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a7)5'-mN1-(s)-mN2-(s)-mN3-mN4-N5f-mN6-N7f-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a8)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a9)5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-mN8-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-mN3-mN4-mN5-mN6-mN7-N8f-N9f-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 20 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’; (a 21 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-N8f-N9f-mN 10 -mN 11 -mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-mN7-mN8-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 24 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -3’; (a 25 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-N9f-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -3'; <h2 style=";text-align:left;direction:ltr">(a<h2 style=";text-align:left;direction:ltr"> 29 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-mN2-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> fN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3'; (a 30 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -3’; (a 31 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -3’; (a 32 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -3’; (a 33 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -mN 16 -N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3’; (a 34 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-N 17 f-mN 18 -mN 19 -3’; (a 35 )5’-mN1-(s)-mN2-(s)-N3f-mN4-mN5-mN6-N7f-mN8-mN9-mN 10 -N 11 f-mN 12 -mN 13 -mN 14 -mN 15 -N 16 f-N 17 f-mN 18 -mN 19 -mN 20 -mN 21 -3’; Among them, N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G, The letter combination dT represents a deoxyribonucleotide whose base is thymine. The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide. The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide. -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond. Optionally, the ribose group of the 5' terminal nucleotide of the sense strand has a 5' hydroxyl group; Alternatively, the antisense strand of the double-stranded RNA modification has the following characteristics: (b1)-(b 37 ) any structure shown in: <h2 style=";text-align:left;direction:ltr">(b1)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b2)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b3)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', (b4)5’-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN 10 -mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -N 16 f-mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’, <h2 style=";text-align:left;direction:ltr">(b5)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b6)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b7)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b8)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b9)5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-[GNA]N6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> )5'-P1mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-[GNA]N7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> )5'-mN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-N6f-mN7-N8f-N9f-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', (b 23 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’, (b 24 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’, (b 25 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-mN6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’, <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 26 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 27 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 28 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-mN7-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', (b 29 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-dT-(s)-dT-3’, (b 30 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -(s)-mN 20 -(s)-mN 21 -3’, (b 31 )5’-EVPmN1-(s)-N2f-(s)-N3f-N4f-N5f-[GNA]N6-N7f-mN8-mN9-N 10 f-mN 11 -mN 12 -mN 13 -N 14 f-mN 15 -mN 16 -mN 17 -mN 18 -mN 19 -mN 20 -mN 21 -(s)-mN 22 -(s)-mN 23 -3’, <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 32 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 33 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 34 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-mN5-mN6-N7f-mN8-mN9-N<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 35 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-dT-(s)-dT-3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 36 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -3', <h2 style=";text-align:left;direction:ltr">(b<h2 style=";text-align:left;direction:ltr"> 37 <h2 style=";text-align:left;direction:ltr"> )5'-EVPmN1-(s)-N2f-(s)-mN3-mN4-N5f-mN6-N7f-mN8-mN9-mN<h2 style=";text-align:left;direction:ltr"> 10 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 11 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 12 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 13 <h2 style=";text-align:left;direction:ltr"> -N<h2 style=";text-align:left;direction:ltr"> 14 <h2 style=";text-align:left;direction:ltr"> f-mN<h2 style=";text-align:left;direction:ltr"> 15 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 16 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 17 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 18 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 19 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 20 <h2 style=";text-align:left;direction:ltr"> -mN<h2 style=";text-align:left;direction:ltr"> 21 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 22 <h2 style=";text-align:left;direction:ltr"> -(s)-mN<h2 style=";text-align:left;direction:ltr"> 23 <h2 style=";text-align:left;direction:ltr"> -3'; Among them, N1-N 23 are independently selected from ribonucleotides whose base is A, U, C or G, The letter combination dT represents a deoxyribonucleotide whose base is thymine. The lowercase letter m indicates that the ribonucleotide adjacent to the right side of the letter m is a ribonucleotide with a 2'-O-CH3 modification in the ribose group of the nucleotide. The lowercase letter f indicates that the ribonucleotide adjacent to the left side of the letter f is a ribonucleotide with a 2'-F modification in the ribose group of the nucleotide. P1 means that the nucleotide adjacent to the right of the letter is a 5'-phosphate nucleotide. EVP means that the nucleotide adjacent to the right of the letter combination is a 5'-trans vinylphosphonate nucleotide. -(s)- indicates that the two adjacent nucleotides are connected by a phosphorothioate diester bond. [GNA] indicates that the adjacent ribonucleotide on the right is a ribonucleotide modified with GNA. Optionally, the 5' terminal nucleotide of the antisense strand does not have P1 or EVP, indicating that the ribose group of the nucleotide has a 5' hydroxyl group.

9. A conjugate, wherein: The conjugate comprises the double-stranded ribonucleic acid as described in any one of claims 1 to 4, or the double-stranded ribonucleic acid modification as described in any one of claims 5 to 8; and a conjugated group conjugated to the double-stranded ribonucleic acid or the double-stranded ribonucleic acid modification.

10. Use of the double-stranded ribonucleic acid according to any one of claims 1 to 4, the double-stranded ribonucleic acid modification according to any one of claims 5 to 8, and the conjugate according to claim 9 in at least one of the following: (1) Inhibiting SERPINF2 gene expression, or preparing a drug for inhibiting SERPINF2 gene expression; (2) for preventing or treating diseases related to abnormal expression of SERPINF2 gene, or for preparing drugs for preventing or treating diseases related to abnormal expression of SERPINF2 gene; (3) Use for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression, or for preparing a medicament for treating a subject suffering from a disease that would benefit from reduced SERPINF2 gene expression.

Images