CircApbb1 molecule, circApbb1 expression quantity targeting siRNA, adeno-associated virus vector, preparation method and application

Abstract

The invention discloses a circApbb1 molecule, a circApbb1 expression quantity targeting siRNA, an adeno-associated virus vector, a preparation method and application, and belongs to the field of molecular biology application. According to the present invention, the siRNA capable of knocking down circApbb1 expression is designed, and the adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green of the siRNA is constructed, such that the adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green is constructed, through detection, circApbb1 is remarkably up-regulated in the heart of a mouse with atherosclerosis, the prepared siRNA adeno-associated virus vector can effectively reduce the expression quantity of circApbb1 in the heart of the mouse, reduce the area of atherosclerotic plaque, inhibit the progress of atherosclerosis and improve the heart function, and the purpose of treating atherosclerosis by using circApbb1 is achieved. The important supplement is provided for the biological function of circApbb1, and a new technical means is provided for the treatment of atherosclerosis.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology applications, and in particular to a circApbb1 molecule, a siRNA targeting the expression level of circApbb1, an adeno-associated virus vector, a preparation method and an application thereof. Background Art

[0002] Atherosclerosis (AS) is an important pathological basis for the onset of cardiovascular diseases such as coronary heart disease, myocardial infarction and heart failure. It is considered to be a chronic and complex disease caused by the interaction of multiple factors. Its main characteristics include the accumulation of subendothelial lipids and the formation of atherosclerotic plaques. The pathogenesis of atherosclerosis is very complex, among which genetic, epigenetic and environmental factors also play an important role in the occurrence and development of atherosclerosis. Studies have shown that hypercholesterolemia can cause cardiac pathological remodeling and eventually lead to damage to cardiac contractile function. Therefore, there is an urgent need to find effective treatment measures to address this serious health problem.

[0003] Circular RNA (circRNA) is a non-coding RNA molecule with a circular structure, which is ubiquitous in eukaryotes. Due to its closed covalent structure and resistance to nuclease exonucleases, circRNA is more stable than linear RNA. In recent years, the rapid development and application of high-throughput sequencing technology has made it possible to isolate and identify circRNA. More circRNAs have been discovered and proven to be related to the pathophysiological processes of various cardiovascular diseases, but their specific mechanisms of action are still unclear. Therefore, screening and validating a new type of circRNA and applying it to the diagnosis and treatment of atherosclerosis can provide new diagnostic and therapeutic targets for atherosclerosis at the RNA level. Summary of the invention

[0004] In order to solve the above technical problems, the present invention aims to provide a circApbb1 molecule, a siRNA targeting the expression level of circApbb1, an adeno-associated virus vector, a preparation method and an application thereof. By designing a circApbb1 siRNA and constructing an adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green of the siRNA, the formation of atherosclerosis is intervened, thereby realizing the treatment of atherosclerosis with circApbb1.

[0005] To achieve the above object, the first aspect of the present invention provides:

[0006] A circular non-coding RNA circApbb1 molecule, wherein the nucleotide sequence of circApbb1 is shown in SEQ ID NO.1:

[0007] ATTCCTTCTGGAACCCCAACGCTTTCGAGACGGATTCCGATCTACCGGCTGGATGGATGAGGGTACAGGACACCTCAGGGACCTACTACTGGCACATCCCAACAGGGACCACCCAGTGGGAACCCCCAGGCCGGGCCTCCCCCTCACAGGGGAGCAGCCCCCAAGAAGAGTCCCAGCTCACCTGGACTGGCTTTGCTCACCAAGAAGGCTTTGAGGAAGGAGAGTTTTGGAAGGATGAACCCAGTGAGGAGGCCCCAATGGAGTTGGGACTGAAGGACCCCGAGGAGGCGACATTGTCCTTCCCAGCTCAGAGCCTCAGCCCAGAACCAGTTCCCCAGGAGGAAGAGAAGCTGTCCCAACGGAATGCCAACCCAGGGATCAAGTGTTTCGCTGTGCGCTCCCTAGGCTGGGTAGAGATGACCGAGGAGGAGCTGGCCCCAGGACGCAGCAGTGTGGCAGTCAACAATTGTATCCGCCAGCTCTCCTACCACAAAAACAATCTACATGATCCGATGGCTGGGGGCTGGGGAGAGGGAAAGGATCTGCTGCTCCAGCTGGAGGACGAGACTCTAAAGTTGGTGGAGCCACAGAACCAGACGCTGCTGCATGCACAGCCCATCGTCAGCATTCGTGTGTGGGGCGTTGGGCGGGACAGTGGAAGGGACTTTGCCTACGTAGCTCGAGATAAGCTGACCCAGATGCTCAAGTGCCACGTGTTTCGCTGTGAGGCACCTGCCAAGAACATCGCCACCAGCCTGCATGAGATCTGCTCCAAGATCATGTCTGAACGGCGCAATGCTCGCTGCTTGGTCAATGGACTCTCCCTAGACCACTCTAAACTCGTGGATGTCCCTTTCCAAGTGGAATTCCCAGCACCAAAGAATGAGCTGGTGCAGAAGTTCCAAGTCTATTACCTGGGAAATGTGCCAGTTGCTAAACCTGTTG。

[0008] The second aspect of the present invention provides:

[0009] The use of the circular non-coding RNA circApbb1 molecule in the preparation of a drug for treating atherosclerosis.

[0010] The circApbb1 was significantly upregulated in the hearts of atherosclerotic mice, causing cardiac function damage and arterial plaque formation.

[0011] A third aspect of the present invention provides:

[0012] A siRNA targeting the expression level of circApbb1, characterized in that it comprises a sense strand and an antisense strand, and the sequence of the sense strand is shown in SEQ ID NO.4:

[0013] GCAGTGTGGCAGTCAACAATT.

[0014] The antisense strand sequence is shown in SEQ ID NO.5:

[0015] AATTGTTGACTGCCACACTGC.

[0016] A fourth aspect of the present invention provides:

[0017] An adeno-associated virus vector containing the siRNA is obtained by cloning the siRNA into a vector (pHBAAV-cTNT-MCS-Green) to obtain an adeno-associated virus vector of the siRNA (HBAAV2 / 9-cTNT-mir30-circApbb1-Green).

[0018] A fifth aspect of the present invention provides:

[0019] The adeno-associated virus vector is used in preparing a medicine for treating atherosclerosis.

[0020] Preferably, the adeno-associated virus vector can reduce the expression of circApbb1 in the heart of atherosclerotic mice, reduce the area of ​​atherosclerotic plaques, inhibit the progression of atherosclerosis and improve heart function.

[0021] Preferably, the adeno-associated virus vector can improve cardiac function indicators including: end-systolic ventricular septum thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, short-axis shortening rate and aortic blood pressure.

[0022] A sixth aspect of the present invention provides:

[0023] A preparation method for constructing the siRNA adeno-associated virus vector comprises the following steps:

[0024] a) vector digestion;

[0025] b) obtaining the target fragment;

[0026] c) PCR amplification of the target fragment;

[0027] d) connecting the target fragment to the vector;

[0028] e) transforming into competent cells;

[0029] f) PCR identification of bacterial liquid;

[0030] g) Sequencing verification;

[0031] h) Plasmid extraction.

[0032] A seventh aspect of the present invention provides:

[0033] A method for packaging an adeno-associated virus comprises transfecting AAV-293 cells with a three-plasmid system (a shuttle plasmid (carrying siRNA), a pAAV-RC vector plasmid, and a pHelper vector plasmid), crushing the cells to collect a lysis supernatant containing AAV particles, and performing purification and quality testing to obtain the adeno-associated virus.

[0034] An eighth aspect of the present invention provides:

[0035] A pharmaceutical composition for treating atherosclerosis comprises an effective dose of the siRNA or the expression vector, and a pharmaceutically acceptable carrier or excipient.

[0036] The present invention has the following beneficial effects:

[0037] The present invention proves that circApbb1 is highly expressed in atherosclerotic myocardial tissue, designs a siRNA that can target circApbb1, and constructs an siRNA adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1-Green. According to tests, the siRNA adeno-associated virus vector prepared by the present invention can knock down the expression of circApbb1, reduce the area of ​​aortic root and aortic plaque in mice, reduce body weight, inhibit the progression of atherosclerosis, and improve cardiac function, which provides an important supplement to the biological function of circApbb1 and a new technical means for the treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a comparison chart of the expression results of circApbb1 in atherosclerotic myocardial tissue and control myocardial tissue detected by qRT-PCR.

[0039] Figure 2This is a comparison of the relative expression levels of RNA after digestion of circApbb1 and mApbb1 with RNase R.

[0040] Figure 3 This is the Oil Red staining and plaque area changes of the aortic root and aorta of mice after circApbb1 knockdown.

[0041] Figure 4 This is a diagram showing changes in cardiac function in mice after circApbb1 knockdown. DETAILED DESCRIPTION

[0042] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only part of the embodiments of the present invention, not all embodiments. Specific conditions are not indicated in the following embodiments, and are usually implemented according to conventional conditions or according to the conditions recommended by the manufacturer.

[0043] The location of circApbb1 (mmu_circRNA_42044) on the genome is: chr7:105564972-105567753, and the length of the cyclized sequence is 945bp. circApbb1 is expressed in both human and mouse hearts. So far, there has been no research or report on the use of circApbb1 in the treatment of atherosclerosis.

[0044] Therefore, the present invention mainly provides circApbb1 molecules, siRNA targeting circApbb1 expression, adeno-associated virus vectors, preparation methods and applications. By designing circApbb1 siRNA and constructing the siRNA adeno-associated virus vector HBAAV2 / 9-cTNT-mir30-circApbb1 Green, the formation of atherosclerosis is intervened, thereby realizing the treatment of atherosclerosis with circApbb1.

[0045] The main materials and reagents used in the present invention are shown in Table 1:

[0046] Table 1 Main materials and reagents

[0047]

[0048] Table 2 Experimental instruments

[0049]

[0050]

[0051] Example 1: Analysis of circApbb1 expression levels in atherosclerotic myocardial tissue

[0052] In this example, circApbb1 expressed in four species, namely human, mouse, rat and monkey, was screened based on sequencing data, and then qRT-PCR technology was used to detect the expression of circApbb1 in atherosclerotic mice ( Figure 1 AS group) and control mice ( Figure 1 Con group) expression in heart tissue, the primer sequences of circApbb1 are shown in SEQ ID NO: 2 and SEQ ID NO: 3. The specific experimental scheme is as follows:

[0053] (1) Sample collection: Heart tissues of atherosclerotic mice were collected, placed in cryopreservation tubes and stored in a -80°C refrigerator for future use.

[0054] (2) RNA extraction: Heart tissue was obtained, ground into fine powder with liquid nitrogen, and then 1 ml of TriZol reagent was added. After sufficient lysis by blowing, 200 μl of chloroform was added, and the mixture was mixed by vortexing. The mixture was allowed to stand at room temperature for 3 min. The mixture was centrifuged at 4°C, 12,000 rpm, and then the mixture was incubated for 15 min. The upper clear solution was transferred to a new EP tube, and an equal volume of isopropanol was added. The mixture was mixed and allowed to stand at room temperature for 10 min. The mixture was centrifuged at 4°C, 12,000 rpm, and then the supernatant was discarded to obtain a white precipitate. The precipitate was washed twice with 75% ethanol, and then centrifuged at 4°C, 7,500 rpm, for 10 min. The supernatant was discarded. After the ethanol evaporated, the RNA was dissolved in 20-30 μl of DEPC water, and the RNA concentration was measured.

[0055] (3) gDNA genome removal

[0056] Take a 200μl centrifuge tube and add the following reagents to prepare the reaction system

[0057]

[0058] Reaction conditions: 42°C, 2 min, 4°C, 0 min.

[0059] (4) Reverse transcription reaction

[0060]

[0061] Reaction conditions: 25°C, 5 min; 42°C, 30 min; 85°C, 5 min.

[0062] (5) qRT-PCR was used to detect the expression level of circApbb1 in normal and atherosclerotic heart tissues. The reaction system was as follows:

[0063]

[0064] Reaction conditions: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s, 40 cycles; 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0065] (6) Result analysis: The Ct values ​​of the target gene and the reference gene were recorded, and the 2^(-ΔΔCt) value was calculated to express the expression level of circApbb1.

[0066] Results Figure 1 , circApbb1 was significantly upregulated in the heart tissue of atherosclerotic mice compared with control mice.

[0067] Example 2: RNase R digestion

[0068] In this example, the inventors designed specific primers that can amplify circApbb1, and the primer sequences are as follows: F: 5'-(GTGCCAGTTGCTAAACCTGT)-3' (SEQ ID NO: 2), R: 5'-(TGCCAGTAGTAGGTCCCTGA)-3' (SEQ ID NO: 3), and circApbb1 was amplified using the primers. RNase R enzyme can digest linear RNA and has almost no effect on circRNA. Therefore, RNase R was used to treat mouse heart total RNA to verify the molecular stability of circApbb1. The reaction system is as follows:

[0069]

[0070]

[0071] Reaction conditions: 37°C, 30 min; 4°C, 0 min. The treated RNA was reverse transcribed into cDNA and the abundance changes were detected by PCR.

[0072] Results Figure 2 The comparison results of RNase R digestion of circApbb1 and mApbb1 showed that the expression of linear RNAApbb1 was significantly reduced after RNase R digestion, while the expression level of circApbb1 remained basically unchanged, indicating that circApbb1 is resistant to RNase R digestion.

[0073] Example 3: Construction of circApbb1 siRNA adeno-associated virus vector and viral packaging

[0074] 1. Construction of adeno-associated virus vectors for siRNA

[0075] (1) Vector information: The present invention uses pHBAAV-cTNT-MCS-Green vector to make mir30 structure:

[0076] siRNA sense strand sequence: GCAGTGTGGCAGTCAACAATT (SEQ ID NO: 4);

[0077] siRNA antisense strand sequence: AATTGTTGACTGCCACACTGC (SEQ ID NO: 5).

[0078] (2) Vector digestion, the system is as follows:

[0079]

[0080] Reaction conditions: 37°C, 1-2h.

[0081] (3) Obtain the target fragment, and the PCR amplification system is as follows:

[0082]

[0083] Reaction conditions: 95°C, 5 min; 95°C, 30 s; 55-72°C, 30 s; 72°C, 30-60 s / kb (27-35 cycles); 72°C, 10 min; 12°C, 0 min.

[0084] (4) The target fragment is connected to the vector. The system is as follows:

[0085]

[0086] Reaction conditions: 50°C, 30 min, 4°C, 5 min.

[0087] (5) Transformation: Take out the DH5α competent cells from the -80℃ refrigerator and immediately put them on ice to thaw; after the competent cells are thawed, add 5μL of the ligation product and place on ice for 20-30 min; heat shock at 42℃ for 90s, and incubate on ice for 2-3min after the heat shock; add 500μL LB culture medium and turn it upside down 3-5 times; shake and culture at 37℃ and 230rpm for 45-60min; spread the bacterial solution on a solid plate with corresponding resistance and culture it in a 37℃ constant temperature incubator for 12-16h.

[0088] (6) Bacterial liquid PCR identification, the identification system is as follows:

[0089]

[0090] Reaction conditions: 94°C, 5 min; 94°C, 30 s; 56°C, 30 s; 72°C, 30-60 s / Kb, 25 cycles; 72°C, 10 min; 12°C, 0 min.

[0091] (7) Sequencing. If the sequencing result is consistent with the target sequence, the target plasmid is successfully constructed.

[0092] (8) Plasmid extraction: After successful sequencing, arrange for bacterial culture amplification and perform plasmid extraction and purification.

[0093] 2. Adeno-associated virus packaging and quality testing

[0094] (1) AAV-293 cells were subcultured and cultured at 37°C, 5% CO2, and 95% relative humidity.

[0095] (2) Transfection: Transfection was performed when the cell density reached 80-90%. The components of the transfection complex were as follows:

[0096]

[0097] (3) Medium change: 6 hours after transfection, replace the medium with complete medium containing 10% fetal bovine serum.

[0098] (4) Cell collection: 72 h after transfection, cells containing AAV particles were scraped off and centrifuged at 150 × g for 3 min to collect the cells. The culture supernatant was removed and the cells were resuspended in 300 μL PBS.

[0099] (5) Cell disruption: The cells were repeatedly frozen and thawed three times in liquid nitrogen and 37°C water bath, centrifuged at 2000×g for 5 min, the cell debris were removed, and the lysis supernatant containing AVV particles was collected.

[0100] (6) Adeno-associated virus purification: Add 0.1 μL Benonase enzyme to every 1 ml of crude virus extract, incubate in 37°C water bath for 1 h to remove the cell genome and residual plasmid DNA in the virus solution, centrifuge at 600×g, 4°C for 10 min, and take the supernatant. Purify using Biomiga Adeno-associated Virus Purification Kit V1469-01, add the purified virus sample liquid to an ultrafiltration tube, centrifuge at 1400×g for 30 min, and obtain the purified virus.

[0101] (7) Take the purified virus for sterility test, mycoplasma test and virus titer test.

[0102] The results showed that the siRNA adeno-associated virus vector of circApbb1 was successfully constructed and the virus packaging was completed.

[0103] Example 4. Effect of HBAAV2 / 9-cTNT-mir30-circApbb1-Green on the progression of atherosclerosis in mice

[0104] 1. Construction of Atherosclerosis Model

[0105] The present invention uses C57 BL / 6J mice as control (Con), 8-week-old Apoe - / -The mice were fed a high cholesterol diet to establish an atherosclerosis model. The experimental groups were divided into a control group (Con group, given a conventional diet) and a model group (Apoe - / - group (NC group, injected with HBAAV2 / 9-cTNT-Green and fed with a high-cholesterol diet); empty vector group (NC group, injected with HBAAV2 / 9-cTNT-Green and fed with a high-cholesterol diet); low knockdown group (sicircApbb1 group, injected with HBAAV2 / 9-cTNT-mir30-circApbb1-Green and fed with a high-cholesterol diet). Empty vector and circApbb1 knockdown adeno-associated virus were injected into mice through the tail vein and fed with a high-fat diet for 8 weeks. The body weight of mice was measured every week, and cardiac ultrasound was performed at the end of the experiment.

[0106] Results Figure 3 C, compared with the Con group mice, Apoe - / - The weight of mice increased with the extension of high-fat diet, and knockdown of circApbb1 significantly reduced the weight of mice (*Apoe - / - vs Con, #Apoe - / - vs sicircApbb1, +NC vsCon).

[0107] 2. Oil red staining

[0108] After the experiment, the mice were killed by spinal dislocation, and the aorta was carefully dissected from the aortic arch at the heart to the iliac bifurcation of the abdominal aorta. The fat tissue around the blood vessels was peeled off with forceps, and the aorta was cut longitudinally with ophthalmic scissors under a dissecting microscope, and the aorta was moved along the inner curve of the aortic arch. The aorta was then spread flat on filter paper in a Y shape, fixed with 4% paraformaldehyde for 20 minutes, and stained with Oil Red O working solution in the dark for 1 hour. Finally, the aorta was photographed and the vascular surface area and red plaque area were counted using Image J software.

[0109] Mouse hearts were fixed with 4% paraformaldehyde for 1 hour, dehydrated with different concentrations of sucrose, embedded with OCT, and sliced ​​to collect complete aortic valve tissue. The tissue was hydrated in PBS solution for 5 minutes, pre-washed with 60% isopropanol for 5 minutes, and then transferred to 60% Oil Red O working solution, stained for 30 minutes in the dark, and the stained sections were rinsed with 60% isopropanol solution 2-3 times to remove background staining. The treated sections were washed with water and counterstained with hematoxylin for 10 seconds, and then anti-blued with running water for 30 minutes. After the anti-blued was completed, the sections were sealed and photographed, and finally the red plaque area and the aortic root area were counted using Image J software.

[0110] Results Figure 3 Compared with the Con group mice, Apoe - / -Obvious atherosclerotic plaques appeared in the abdominal aorta and aortic root of mice, suggesting that Apoe - / - The mouse atherosclerosis model was successfully established. The results of Oil Red O staining of the aorta of mice in the sicircApbb1 group were observed. It was found that knocking down circApbb1 could significantly reduce the area of ​​atherosclerotic plaques in the intima and aortic root of the abdominal aorta of mice, indicating that reducing the level of circApbb1 can inhibit the progression of atherosclerotic lesions.

[0111] 3. Mouse Heart Ultrasound

[0112] Mice were fixed in a supine position on a 37°C heating plate under 2% isoflurane inhalation anesthesia. After depilation of the mouse chest, ultrasound detection was performed using a Vevo2100 small animal ultrasound machine and an MS-550D probe. The long axis section of the sternum was taken, and the probe was rotated 90 degrees clockwise on the basis of the long axis section of the left ventricle, i.e., the short axis section of the left ventricle. The M-mode was used to record the movement of the left ventricle, and the end-systolic ventricular septum thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, short axis shortening rate, and aortic blood pressure were measured.

[0113] Results Figure 4 Compared with the Con group mice, Apoe - / - The thickness of the left ventricular posterior wall at the end of systole of mice was significantly reduced, and the left ventricular internal diameter at the end of systole was significantly increased, indicating abnormal cardiac structure. The ejection fraction and short-axis shortening rate were significantly reduced, indicating that the heart function of mice was weakened. The pulsed Doppler results showed that Apoe - / - The aortic pressure of mice was significantly higher than that of the Con group. Knockdown of circApbb1 increased the thickness of the left ventricular posterior wall at the end of systole, significantly reduced the left ventricular internal diameter at the end of systole, significantly increased the ejection fraction and short-axis shortening rate, and restored the aortic pressure to the level of the Con group, indicating that inhibiting the level of circApbb1 can increase the Apoe - / - Mouse cardiac function and inhibited ventricular remodeling.

[0114] In summary, the siRNA adeno-associated virus vector designed in the present invention can target circApbb1, and downregulating its level can significantly reduce the plaque area of ​​the abdominal aorta and aortic root, inhibit the progression of atherosclerosis, improve cardiac function, and inhibit ventricular remodeling, indicating that circApbb1 can become a molecular target for the treatment of atherosclerosis.

[0115] The above description is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the technical scope disclosed by the present invention, and they should be covered by the protection scope of the present invention.

Claims

1. A circular non-coding RNA circApbb1 molecule, characterized in that The nucleotide sequence of circApbb1 is shown in SEQ ID NO.

1.

2. Use of the circular noncoding RNA circApbb1 molecule according to claim 1 in the preparation of a drug for treating atherosclerosis.

3. A siRNA targeting circApbb1 expression, characterized in that: It includes a sense strand and an antisense strand, the sequence of the sense strand is shown in SEQ ID NO.4, and the sequence of the antisense strand is shown in SEQ ID NO.

5.

4. An adeno-associated virus vector comprising the siRNA according to claim 3, characterized in that: The adeno-associated virus vector of siRNA (HBAAV2 / 9-cTNT-mir30-circApbb1-Green) was obtained by cloning siRNA into the vector (pHBAAV-cTNT-MCS-Green).

5. Use of the adeno-associated virus vector according to claim 4 in the preparation of a drug for treating atherosclerosis.

6. A preparation method for constructing the siRNA adeno-associated virus vector according to claim 4, characterized in that: The following steps are involved: a) vector digestion; b) obtaining the target fragment; c) PCR amplification of the target fragment; d) connecting the target fragment to the vector; e) transforming into competent cells; f) PCR identification of bacterial liquid; g) Sequencing verification; h) Plasmid extraction.

7. A method for packaging an adeno-associated virus, characterized in that: AAV-293 cells were transfected using a three-plasmid system, and the cells were broken to collect the lysis supernatant containing AAV particles, which was then purified and quality tested to obtain adeno-associated virus. The three-plasmid system included a shuttle plasmid, a pAAV-RC vector plasmid, and a pHelper vector plasmid.

8. The use according to claim 5, characterized in that: The adeno-associated virus vector can reduce the expression of circApbb1 in the heart of atherosclerotic mice, reduce the area of ​​atherosclerotic plaques, inhibit the progression of atherosclerosis and improve heart function.

9. The use according to claim 8, characterized in that: The adeno-associated virus vector can improve the following cardiac function indicators: end-systolic ventricular septum thickness, end-systolic left ventricular posterior wall thickness, end-systolic left ventricular internal diameter, ejection fraction, short-axis shortening rate and aortic blood pressure.

10. A pharmaceutical composition for treating atherosclerosis, characterized in that: The invention comprises an effective dose of the siRNA according to claim 3 or the expression vector according to claim 4, and a pharmaceutically acceptable carrier or excipient.

Images