Application of corn ZmRLR2 gene in corn lodging resistance

Abstract

The invention discloses application of a corn ZmRLR2 gene in corn lodging resistance, and belongs to the technical field of corn lodging-resistant molecular inheritance and breeding. According to the application of the corn ZmRLR2 gene in corn lodging resistance disclosed by the invention, the nucleotide sequence of the corn ZmRLR2 gene is shown as SEQ ID NO. 5. It is found for the first time that after overexpression of the ZmRLR2 gene, the root system of corn is significantly increased, the lignin content is significantly increased, and the lodging resistance is significantly enhanced. The invention has important application value for cultivating lodging-resistant corn new germplasm and new species.

Description

Technical Field

[0001] The invention relates to the technical field of molecular genetics and breeding of corn lodging resistance, and more specifically to the application of corn ZmRLR2 gene in corn lodging resistance. Background Art

[0002] As one of the three major food crops, corn plays an important role in ensuring food security and promoting national economic development. With the frequent occurrence of extreme climates such as typhoons and rainstorms and the increase in planting density, lodging has become a common problem in corn production. Lodging leads to reduced corn yields, easy mildew of grains, and poor quality, which is an important factor limiting the mechanized harvesting of corn. That is, the lodging problem of corn seriously restricts its yield, quality and mechanized harvesting. With the transfer of labor and the development of mechanization, higher requirements are placed on the lodging resistance of corn. However, the lodging resistance genes discovered in corn are relatively few, which is far from meeting the needs of corn lodging resistance breeding. The cloning and mechanism analysis of corn lodging resistance genes have important theoretical significance and application value.

[0003] Therefore, providing application of maize ZmRLR2 gene in maize lodging resistance is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0004] In view of this, the present invention aims at the problem that the current lack of corn lodging resistance genes and germplasm resources has seriously hindered the progress of corn lodging resistance breeding; provides the application of corn ZmRLR2 gene in corn lodging resistance. Overexpression of ZmRLR2 gene can improve lodging resistance and can be directly applied to corn lodging resistance breeding.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] Using 385 maize inbred lines, a genome-wide association analysis of field lodging (root lodging) traits at the V11 stage revealed a gene, ZmRLR2, that controls lignin synthesis. Candidate gene association analysis found that this gene was significantly associated with lodging. Plants overexpressing this gene had significantly larger root systems and significantly enhanced resistance to root lodging.

[0007] Application of maize ZmRLR2 gene in maize lodging resistance, the nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.

[0008] Further, the use of a biomaterial overexpressing the maize ZmRLR2 gene in maize lodging resistance, wherein the biomaterial is any one of the following:

[0009] A: an expression cassette capable of overexpressing the maize ZmRLR2 gene having a nucleotide sequence as shown in SEQ ID NO.5;

[0010] B: a recombinant vector containing the expression cassette described in A;

[0011] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

[0012] Furthermore, the maize ZmRLR2 gene is used in breeding lodging-resistant maize germplasm, and the nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.

[0013] Furthermore, the application of maize ZmRLR2 gene in maize breeding, the nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.

[0014] The present invention provides a new corn lodging resistance breeding gene resource. In the future, by exploring the excellent alleles of the gene, designing molecular markers, and introducing excellent haploid materials into commercial inbred lines, corn plants with enhanced lodging resistance can be obtained and promoted in production.

[0015] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses the application of the corn ZmRLR2 gene in corn lodging resistance, and for the first time found that after overexpressing the ZmRLR2 gene, the root system of corn was significantly enlarged, the root lignin content was significantly increased, and the root tensile strength was significantly enhanced. The present invention has important application value for cultivating new varieties and new germplasms of lodging-resistant corn. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0017] Figure 1 The accompanying figure shows the expression pattern analysis of ZmRLR2 in the present invention; different letters represent significant differences at the P<0.05 level;

[0018] Figure 2 The accompanying figure shows the RT-qPCR identification of the ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without overexpression vector); OE represents the ZmRLR2 overexpression strain; *** represents a significant difference from KN5585 at the P<0.001 level, and ns represents no significant difference from KN5585;

[0019] Figure 3The accompanying drawings show the root phenotype analysis of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without overexpression vector); OE represents the ZmRLR2 overexpression strain;

[0020] Figure 4 The attached figure shows the root lignin staining of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without overexpression vector); OE represents the ZmRLR2 overexpression strain;

[0021] Figure 5 The accompanying drawings show the root tensile strength analysis of the maize ZmRLR2 gene overexpression strain of the present invention; NT represents the negative control of transgenic material (material without the overexpression vector); OE represents the ZmRLR2 overexpression strain; *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] Example 1 Analysis of ZmRLR2 expression pattern

[0024] In order to understand the expression pattern of ZmRLR2, samples of roots, leaves, tassels, first, second, third and fourth stems of maize inbred line B73 were collected during the silking period. After RNA extraction and reverse transcription into cDNA, quantitative analysis of ZmRLR2 was performed using primers ZmRLR2-qPCR-F / R. It was found that ZmRLR2 was most highly expressed in the root system ( Figure 1 GAPC1 was used as the internal reference gene, and the primers for detecting the internal reference gene were GAPC1-qPCR-F / R.

[0025] The specific primer sequences are as follows:

[0026] ZmRLR2-qPCR-F:ATTCGCTCGTCGTCTCT; SEQ ID NO.1;

[0027] ZmRLR2-qPCR-R: CGCATGATGTTGCATTGC; SEQ ID NO.2;

[0028] GAPC1-qPCR-F:CCCTTCATCACCACGGACTAC; SEQ ID NO.3;

[0029] GAPC1-qPCR-R: AACCTTCTTGGCACCACCCT; SEQ ID NO.4.

[0030] Example 2 Overexpression of ZmRLR2 significantly enhances the lodging resistance of maize

[0031] The CDS sequence of ZmRLR2 is shown in SEQ ID NO.5.

[0032] ATGGCTGCCGGCGGCGACGACA CCACCATCGCGCAGGTCCACAGCGGCATCGACAGCAGCAACAAGACGCTGCTCAAGAGCGAGGCCCTCTACAAGTACGTGCTGGACACGTCGGTGCTGCCGCACGAGCCGGAGAGCATGCGTGAGCTGCGGCTGGTGACCGACAAGCACGAGTGGGGGTTCATGCAGTCGTCCCCGGACGAGGCGTCGCTGCTGCGGATGCTGATCAAGCTGAGCGGCGCGCGGCGGACGCTGGAGGTGGGCGTGTTCACGGGCTACTCGCTGCTGGCGACGGCTCTGGCGCTGCCCGCCGACGGCAAGGTCATCGCATTCGACGTGAGCCGCGAGTACTACGACATCGGCCGCCCCTTCATCGAGCGCGCCGGGGTGGCGGGCAAGGTGGACTTCCGGGAGGGCCCGGCGCTGGAGCAGCTGGACGAGCTCCTCGCCGACCCGGCCAACCACGGCGCCTTCGACTTCGCCTTCGTCGACGCCGACAAGCCTAACTACGTCCGGTACCACGAGCAGCTGCTCCGCCTGGTGCGCGTCGGGGGTACCGTCGTGTACGACAACACGCTGTGGGCCGGTACTGTGGCGCTTCCCCCCGACGCGCCGCTCAGCGACCTCGACCGCAGGTTCTCCGCCGCCATCAGGGAACTCAACGTCCGGCTTTCTCAGGATCCCCGCGTCGAGGTCTGCCAGCTCGCCATCGCCGACGGCGTCAC CATCTGCCGCCGCGTCGTCTGA ; SEQ ID NO.5.

[0033] In order to study the function of the ZmRLR2 gene, the CDS sequence of ZmRLR2 (as shown in SEQ ID NO.5) was constructed into the plant binary expression vector pCAMBIA3301 and driven by the Ubi promoter.

[0034] 1) Construction of expression vector pCAMBIA3301-UBI

[0035] (1) Vector digestion

[0036] The expression vector pCAMBIA3301 was digested with restriction endonucleases HindIII and BamHI (NEWENGLAND BioLabs). The digestion system was: 11 μg of pCAMBIA3301, 5 μL of CutSmart buffer, 1 μL each of HindIII and BamHI, and 50 μL of ddH2O. Digestion was performed at 37°C for 1 hour, and gel recovery was performed after electrophoresis detection.

[0037] (2) Gene synthesis of the full-length UBI promoter

[0038] The linker sequence after restriction digestion of pCAMBIA3301 and the full length of the UBI promoter were synthesized using gene synthesis technology, and the sequence is shown in SEQ ID NO.6.

[0039] Restriction linker sequence and full-length synthetic sequence of UBI promoter:

[0040]

[0041]

[0042] In SEQ ID NO.6, the underlined portion is the restriction endonuclease linker sequence, and the ununderlined portion is the UBI promoter sequence; the restriction endonuclease site is marked in italics.

[0043] (3) Homologous recombination

[0044] Connect the gene synthesis product with the vector: connect the gene synthesis product with the vector pCAMBIA3301 after enzyme digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 1μL of 5X In-Fusion Snap AssemblyMasterMix (Takara) recombinase; ddH2O is added to make up to 5μL. 50℃, connect for 15min.

[0045] (4) Recombinant plasmid transformation:

[0046] Take 2 μl of the ligation product and heat-shock transform it into E. coli competent DH5ɑ, apply it to LB solid culture plates containing 50 mg / L kanamycin, and culture it overnight at 37°C. Use primers pCAMBIA3301-F / R to detect the colony positively. After sequencing is correct, extract the recombinant plasmid pCAMBIA3301-UBI for subsequent experiments.

[0047] The specific primer sequences are as follows:

[0048] pCAMBIA3301-F: CTCGTATGTTGTGTGGAATTGTGAG; SEQ ID NO.7;

[0049] pCAMBIA3301-R: TGAACTTCAGGGTCAGCTTGCCGTAG; SEQ ID NO.8.

[0050] 2) Construction of overexpression vector pCAMBIA3301-UBI-ZmRLR2

[0051] (1) PCR amplification of ZmRLR2 CDS sequence:

[0052] Using maize inbred line B73 as material, total root RNA was extracted and reverse transcribed into cDNA. Using cDNA as template, pCAMBIA3301-UBI-ZmRLR2-F and pCAMBIA3301-UBI-ZmRLR2-R as primers, and high-fidelity enzyme KOD One TM PCR Master Mix (TOYOBO) was used for PCR amplification. The amplification system was: KOD One TM PCR MasterMix 25μL, template 2μl, upstream and downstream primers 1.5μL each, ddH2O 20μL. PCR reaction program: 98℃10s, 58℃5s, 68℃1s, 34 cycles.

[0053] The specific primer sequences are as follows:

[0054] pCAMBIA3301-UBI-ZmRLR2-F:

[0055] CAGGTCGACTCTAGAGGATCC ATGGCTGCCGGCGGCGACGACA ;

[0056] SEQ ID NO.9;

[0057] pCAMBIA3301-UBI-ZmRLR2-R:

[0058] TTCGAGCTGGTCACCGAGCTC TCAGACGACGCGGCGGCAGATG; SEQ ID NO.10.

[0059] (2) Vector digestion:

[0060] The expression vector pCAMBIA3301-UBI was digested with restriction endonucleases SacI and BamHI (NEWENGLAND BioLabs). The digestion system was: pCAMBIA3301-UBI 1 μg, CutSmart buffer 5 μL, SacI and BamHI 1 μL each, ddH2O to 50 μL. Digestion was performed at 37°C for 1 hour, and gel recovery was performed after electrophoresis detection.

[0061] PCR product and vector connection: The PCR amplification product was connected to the vector pCAMBIA3301-UBI after restriction digestion by homologous recombination. The connection system is: the molar ratio of vector to insert fragment is about 1:2; 5X In-Fusion SnapAssemblyMasterMix (Takara) recombinase 1μL; ddH2O is added to 5μL. 50℃, connection for 15min.

[0062] (3) Recombinant plasmid transformation:

[0063] Take 2 μl of the ligation product and heat-shock transform it into Escherichia coli competent DH5ɑ, apply it to LB solid culture plates containing 50 mg / L kanamycin, and culture it overnight at 37°C. Use primers BamH1-F and SacI-R to detect the colony positively. After sequencing is correct, extract the recombinant plasmid pCAMBIA3301-UBI-ZmRLR2 and transform it into Agrobacterium competent cells EHA105. After PCR verification, it is used for corn genetic transformation.

[0064] The specific primer sequences are as follows:

[0065] BamHI-F: TTAGCCCTGCCTCATACG; SEQ ID NO.11;

[0066] SacI-R: GATAATCATCGCAAGACCGGCAAC; SEQ ID NO. 12.

[0067] The steps for Agrobacterium transformation are as follows:

[0068] Take 1μl of recombinant plasmid and add it to 50μL of Agrobacterium EHA105 competent cells. Gently stir the bottom of the tube to mix it. Place it on ice for 10min, in liquid nitrogen for 5min, in a 37℃ water bath for 5min, and in an ice bath for 5min. Add 400μl of LB medium without antibiotics to each tube for recovery. Transfer it to a shaker at 200rpm and 28℃ for 2-3 hours. Centrifuge briefly at 4000rpm to collect the cells, add 50μl of LB liquid medium to resuspend the cells, pipette and beat evenly, spread it on LB solid medium containing antibiotics (50mg / L kanamycin), and invert and culture at 28℃ for 2-3 days.

[0069] 3) Obtaining overexpression strains

[0070] Suspension medium: 1 / 2MS + sucrose 68.5 g / L + glucose 36 g / L + L-proline 0.115 g / L.

[0071] Infection medium: 1 / 2MS + sucrose 68.5 g / L + glucose 36 g / L + L-proline 0.115 g / L + acetosyringone 200 mM + cysteine ​​200 mg / L.

[0072] Co-culture medium: 1 / 2MS + sucrose 20 g / L + glucose 10 g / L + proline 0.115 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + L-cysteine ​​200 mg / L + 2,4-D 0.5 mg / L + cypermethrin 2.2 mg / L + acetosyringone 200 mM.

[0073] Resting medium: MS + sucrose 30 g / L + proline 1.38 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + hydrolyzed casein 0.5 g / L + 2,4-D 0.5 mg / L + chloramphenicol 2.2 mg / L + timentin 200 mg / L.

[0074] Selection culture medium: MS + sucrose 30 g / L + proline 1.38 g / L + thiamine hydrochloride 0.5 mg / L + AgNO3 20 mM + hydrolyzed casein 0.5 g / L + 2,4-D 0.5 mg / L + chloramphenicol 2.2 mg / L + timentin 200 mg / L + phosphinothricin 40 mg / L.

[0075] Differentiation medium: MS + sucrose 20 g / L + 6-BA 0.1 mg / L + KT 1 mg / L + Timentin 200 mg / L.

[0076] Rooting medium: MS + sucrose 20g / L + MES 0.5g / L + IBA 0.2mg / L.

[0077] The ZmRLR2 gene-containing EHA105 was transformed into the maize inbred line KN5585 to obtain transgenic seeds of seven independent transgenic events. The specific process is as follows:

[0078] Place the freshly peeled corn embryos of about 1 mm in size into a 2 ml plastic centrifuge tube containing 1.8 mL of suspension culture medium, suspend and soak for 20 minutes, remove the liquid after the young embryos are collected, heat shock for 5 minutes, and then add the Agrobacterium infection solution (the infection culture medium containing the EHA105 Agrobacterium that transformed the recombinant plasmid) to infect for 5 minutes, during which air is blown into the Agrobacterium infection solution. Pour the infected corn embryos onto the co-culture medium, use a pipette to remove the excess Agrobacterium liquid on the surface, and co-culture at 23°C in the dark for 3 days. After co-culture, transfer the young embryos to the rest culture medium, culture them in the dark at 28°C for 6 days, and then place them on the selection culture medium, start screening culture for two weeks, replace the new selection culture medium, and then screen culture for another 2 weeks. The resistant callus tissue is transferred to a differentiation medium and cultured at 25°C and 5000lx light for 3 weeks; the differentiated seedlings are transferred to a rooting medium and cultured at 25°C and 5000lx light until they take root; the seedlings are transferred to small pots for growth, transplanted to a greenhouse after a certain growth stage, and the offspring seeds are harvested after 3-4 months.

[0079] The 10 T1 seeds obtained were planted in the field, and normal water and fertilizer management was maintained. At the small trumpet stage, glufosinate was applied to the leaves of the corn to identify whether the overexpression vector was transferred. The corn phenotype was observed 3-4 days later. The corn strains with wilted leaves did not contain the Bar gene, i.e., the overexpression vector was not transferred, and the corn strains with normal leaves were the corn strains containing the Bar gene, i.e., the overexpression vector was successfully transferred. Seven successful transgenic events were obtained through identification.

[0080] RT-qPCR was used to identify the expression of ZmRLR2 in seven overexpression (ZmRLR2-OE / KN5585) strains using primers ZmRLR2-qPCR-F / R. GAPC1 was used as the internal reference gene, and the primers for detecting the internal reference gene were GAPC1-qPCR-F / R.

[0081] The expression level of ZmRLR2 in OE-1, OE-2, OE-3, OE-4, and OE-5 strains was more than 5 times that of the transgenic negative control material (Nontransgenic, abbreviated as NT) ( Figure 2 ). Therefore, the two strains with the highest expression levels, OE-1 and OE-2, were selected for subsequent research.

[0082] Root size and lignin content directly affect the occurrence of lodging. Since ZmRLR2 was discovered through root lodging, the focus was on root phenotypes. The roots of the overexpression strains were dug out from the field and after rinsing, it was found that the roots of the two overexpression strains (OE-1 and OE-2) were significantly larger than those of the negative control (Nontransgenic, abbreviated as NT) ( Figure 3 ). The roots in the same layer and the same part were stained with phloroglucinol (WIESNER) and potassium permanganate. Phloroglucinol staining was used to stain total lignin, and potassium permanganate staining was used to stain S-lignin. It was found that the total lignin and S-lignin contents of the overexpression strains were significantly higher than those of the negative control ( Figure 4 ).

[0083] In order to simulate the natural lodging environment, the corn field was fully irrigated, and the root tensile strength was measured by using a tensile meter to pull the corn 40 degrees from 10 cm above the ground. Through analysis, the average root tensile strength of the NT material was 98.61N, the average root tensile strength of the OE-1 material was 146.74N, and the average root tensile strength of the OE-2 material was 223.74N. Statistical analysis found that the root tensile strength of the two overexpression lines was significantly higher than that of the negative control ( Figure 5 ). This indicates that ZmRLR2 positively regulates the root lodging resistance of maize roots and has important potential for improving maize lodging resistance.

[0084] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of maize ZmRLR2 gene in maize lodging resistance, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.

5.

2. Application of biomaterials overexpressing maize ZmRLR2 gene in maize lodging resistance, characterized in that: The biological material is any one of the following: A: an expression cassette capable of overexpressing the maize ZmRLR2 gene having a nucleotide sequence as shown in SEQ ID NO.5; B: a recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.

3. Application of maize ZmRLR2 gene in breeding lodging-resistant maize germplasm, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.

5.

4. Application of maize ZmRLR2 gene in maize breeding, characterized in that: The nucleotide sequence of the maize ZmRLR2 gene is shown in SEQ ID NO.5.

Images