Bst DNA polymerase mutant as well as preparation method and application thereof

Abstract

The invention relates to a Bst DNA polymerase mutant as well as a preparation method and application thereof, and the nucleotide sequence of the Bst DNA polymerase mutant is as shown in SEQ ID NO. 1. Compared with a wild type Bst DNA polymerase and a commercially available Bst 2.0 DNA polymerase, the Bst DNA polymerase mutant disclosed by the invention has higher enzyme activity and enzyme catalysis efficiency, meanwhile, the Bst DNA polymerase mutant is relatively good in salt resistance, pH resistance and heat resistance, and the Bst DNA polymerase mutant is applied to loop-mediated isothermal amplification detection, so that the amplification efficiency can be obviously improved.

Description

Technical Field

[0001] The present invention relates to the technical field of protein modification and virus detection, and in particular to a Bst DNA polymerase mutant and a preparation method and application thereof. Background Art

[0002] Loop-mediated isothermal amplification (LAMP) technology is another innovative invention technology in the field of in vitro nucleic acid amplification after the polymerase chain reaction (PCR) technology. It has the advantages of rapidity, high efficiency, and strong specificity, and has been widely used in various fields such as biomedicine and food safety.

[0003] Strand displacement DNA polymerase (such as Bst DNA polymerase) is the most critical component in the LAMP reaction, and its performance is crucial to the rate, specificity and reliability of LAMP detection. At present, although Bst DNA polymerase has been commercialized, the quality of BstDNA polymerase products in the domestic market is uneven and expensive, which in turn restricts its application in actual detection.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] In order to solve the above technical problems, the present invention provides a Bst DNA polymerase mutant and a preparation method and application thereof.

[0006] The technical solution adopted by the present invention is:

[0007] In one aspect, the present invention provides a Bst DNA polymerase mutant, wherein the nucleotide sequence of the Bst DNA polymerase mutant is shown in SEQ ID NO.1.

[0008] A Bst DNA polymerase mutant proposed in the present invention has higher enzyme activity and enzyme catalytic efficiency than wild-type Bst DNA polymerase and commercially available Bst 2.0 DNA polymerase. At the same time, it has good salt resistance, pH resistance and heat resistance, and can be used in loop-mediated isothermal amplification detection to significantly improve the efficiency of amplification.

[0009] Another aspect of the present invention provides a method for preparing the Bst DNA polymerase mutant as described in the above technical solution, comprising the following steps:

[0010] S1. constructing an expression vector according to the nucleotide sequence of the Bst DNA polymerase mutant to obtain a mutant plasmid;

[0011] S2. The mutant plasmid is transformed into competent cells by heat shock method for culture and expression. The obtained expression product is crushed by high pressure, purified and dialyzed to obtain the Bst DNA polymerase mutant.

[0012] Preferably, in step S1, the specific method for constructing the expression vector is:

[0013] Using a wild-type Bst DNA polymerase plasmid as a template, designing primers according to the nucleotide sequence of the Bst DNA polymerase mutant, performing PCR amplification, using DpnⅠ restriction nuclease to digest the non-mutated parent chain in the amplified product, and purifying to obtain a mutant plasmid;

[0014] The nucleotide sequence of the wild-type Bst DNA polymerase is shown in SEQ ID NO.2.

[0015] More preferably, the primers include a forward primer and a backward primer, and the nucleotide sequences thereof are shown as SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0016] More preferably, in step S2, the specific method of purification is: taking the catalytic efficiency of the purified enzyme as an indicator, optimizing the salt concentration of the elution buffer used in the nickel column affinity chromatography and molecular exclusion chromatography purification process of the wild-type Bst DNA polymerase, and determining the elution buffer composition used in the purification process of the Bst DNA polymerase mutant based on the optimal elution buffer salt concentration of the wild-type Bst DNA polymerase purification process.

[0017] More preferably, the elution buffer of the nickel column affinity chromatography of the wild-type Bst DNA polymerase is: 25mM Tris-HCl, 150-1000mM NaCl, 300mM imidazole, and the elution buffer of the molecular exclusion chromatography is: 25mM Tris-HCl, 150-1000mM NaCl, 2mM DTT.

[0018] The preparation method of the Bst DNA polymerase mutant provided by the present invention is designed based on the nucleotide sequence of the wild-type Bst DNA polymerase, and the Bst DNA polymerase mutant is quickly and effectively expressed by mutating the 1099th T and the 1100th C in the nucleotide sequence to G, and the purification process is explored. The purification efficiency is high, the target product is large in amount and has good activity, and the purification cost is reduced, which is suitable for industrial production.

[0019] In another aspect, the present invention provides a use of the Bst DNA polymerase mutant as described in the above technical solution or the Bst DNA polymerase mutant prepared by the preparation method described in any one of the above technical solutions in loop-mediated isothermal amplification.

[0020] Preferably, the reaction system includes: inner primers FIP and BIP, outer primers F3 and B3, loop primers Loop-F and Loop-B, betaine, dNTPs, Bst DNA polymerase buffer, MgSO4, Bst DNA polymerase mutant, fluorescent dye, DNA template, and DEPC water.

[0021] Preferably, the amplification procedure is: 65-73°C for 40 min, and 95°C for 10 min.

[0022] The Bst DNA polymerase mutant of the present invention is applied to loop-mediated isothermal amplification, and has a faster amplification speed than the commercially available Bst 2.0 DNA polymerase, shortens the time required for detection, and maintains high specificity and sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The enzymatic activity result diagram of the Bst DNA polymerase mutant of Example 1;

[0024] Figure 2 The figure is a result diagram of the purification of the Bst DNA polymerase mutant protein in Example 1, wherein A is the result of the salt concentration optimization of the elution buffer of the nickel column affinity chromatography, and B is the result of the salt concentration optimization of the elution buffer of the molecular exclusion chromatography;

[0025] Figure 3 The figure is a comparison result of the enzyme catalytic efficiency of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase of Example 1;

[0026] Figure 4 The figure is a comparison result of the enzyme activities of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase in Example 1;

[0027] Figure 5 The figure is a comparison result of the salt tolerance of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase in Example 1, wherein A, B, and C are the effects of the change of (NH4)2SO4 concentration on the amplification rates of the mutant, the wild-type and the Bst2.0 DNA polymerase, respectively;

[0028] Figure 6 The figure is a comparison result of the salt tolerance of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase in Example 1, wherein A, B and C are the effects of the change of KCl concentration on the amplification rates of the mutant, the wild-type and the Bst 2.0 DNA polymerase, respectively;

[0029] Figure 7 The figure is a comparison result of the salt tolerance of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase in Example 1, wherein A, B and C are the effects of the change of MgSO4 concentration on the amplification rates of the mutant, the wild-type and the Bst 2.0 DNA polymerase, respectively;

[0030] Figure 8 The figure is a comparison result of pH resistance of the Bst DNA polymerase mutant, wild-type Bst DNA polymerase and Bst 2.0 DNA polymerase in Example 1, wherein A, B and C are the effects of pH changes on the amplification rates of the mutant, wild-type and Bst 2.0 DNA polymerases, respectively;

[0031] Fig. 9 The figure is a comparison result of the heat resistance of the Bst DNA polymerase mutant, the wild-type Bst DNA polymerase and the Bst 2.0 DNA polymerase in Example 1, wherein A, B and C are the effects of temperature changes on the amplification rates of the mutant, the wild-type and the Bst 2.0 DNA polymerase, respectively;

[0032] Fig.10 This is a graph showing the application results of loop-mediated isothermal amplification of the Bst DNA polymerase mutant based on Example 1, wherein A, B, and C represent the effects of betaine concentration, magnesium ion concentration, and enzyme concentration on LAMP, respectively. DETAILED DESCRIPTION

[0033] In order to better understand the above technical solution, exemplary embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although exemplary embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a clearer and more thorough understanding of the present invention and to fully convey the scope of the present invention to those skilled in the art.

[0034] Example 1

[0035] A method for preparing a Bst DNA polymerase mutant comprises the following steps:

[0036] S1. Construct an expression vector according to the nucleotide sequence of the Bst DNA polymerase mutant to obtain a mutant plasmid. The specific method is as follows:

[0037] Using wild-type Bst DNA polymerase plasmid (plasmid vector is pET-28a) as a template, primers are designed according to the nucleotide sequence of the Bst DNA polymerase mutant (as shown in SEQ ID NO.1), PCR amplification is performed, and the non-mutated parent chain in the amplification product is digested with DpnⅠ restriction nuclease, and the mutant plasmid is obtained after purification;

[0038] The nucleotide sequence of wild-type Bst DNA polymerase is shown in SEQ ID NO.2.

[0039] The primers include a forward primer and a backward primer, and their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively:

[0040] Forward primer: CAGACTACGGTCAGATCGAACTCCGTGTAC (SEQ ID NO. 3);

[0041] Backward primer: CGATCTGACCGTAGTCTGCTGCGAAGATC (SEQ ID NO. 4).

[0042] S2. The mutant plasmid was transformed into Rosetta competent cells by heat shock method for culture and expression (the cells were plated and cultured for 12 hours and then transferred to 1.5L culture medium, placed in a 37°C shaker for 8 hours, and then induced at 18°C ​​for 14 hours using IPTG. The cultured bacteria were centrifuged at 2000 rpm to remove the supernatant and collected), and the expression product was crushed by high pressure, purified, and dialyzed for 24 hours to obtain the Bst DNA polymerase mutant.

[0043] The specific method of purification is: taking the catalytic efficiency of the purified enzyme as an indicator, optimizing the salt concentration of the elution buffer used in the nickel column affinity chromatography and molecular exclusion chromatography purification of the wild-type Bst DNA polymerase (the elution buffer of the nickel column affinity chromatography is: 25mM Tris-HCl, 150-1000mM NaCl, 300mM imidazole; the elution buffer of the molecular exclusion chromatography is: 25mM Tris-HCl, 150-1000mM NaCl, 2mM DTT), and determining the composition of the elution buffer used in the purification process of the Bst DNA polymerase mutant based on the optimal elution buffer salt concentration of the wild-type Bst DNA polymerase purification process. Figure 2The elution buffer of nickel column affinity chromatography of Bst DNA polymerase mutant was determined to be: 25mM Tris-HCl, 500mM NaCl, 300mM imidazole; the elution buffer of molecular exclusion chromatography was: 25mM Tris-HCl, 500mM NaCl, 2mM DTT.

[0044] The Bst DNA polymerase mutant prepared in Example 1 was tested, and the results are shown in Figure 1-Figure 10 and Table 1.

[0045] (I) Enzyme activity test of Bst DNA polymerase mutants:

[0046] The enzyme activity test tool used is visual LAMP, and the experimental results are determined by color changes during the reaction. The reaction system includes LAMP primer set (inner primers FIP and BIP, outer primers F3 and B3, loop primers Loop-F and Loop-B), betaine, dNTPs, Bst DNA polymerase buffer, MgSO4, Bst DNA polymerase (the experimental group uses Bst DNA polymerase mutant, wild-type Bst DNA polymerase and commercially available Bst 2.0 DNA polymerase, respectively, and the control group does not add enzyme), fluorescent dye (neutral red), DNA template (African swine fever ASFV), DEPC water. The specific amount of each component of the reaction system is shown in Table 1, the sequence of the primer set SEQ ID NO.5-SEQ ID NO.10 is shown in Table 2, and the amplification program is 65℃ for 40min and 95℃ for 10min.

[0047] Table 1 LAMP reaction system

[0048] F3 and B3 The final concentration is 0.2 μM, and the dosage is 0.5 μL FIP and BIP The final concentration is 0.8 μM and the dosage is 0.4 μL Loop-F and Loop-B The final concentration is 0.4 μM and the dosage is 1 μL Betaine The final concentration is 0.7M and the dosage is 3.5μL dNTPs The final concentration is 1.4 μM, and the dosage is 3.5 μL 10×Bst DNA polymerase buffer The dosage is 2.5 μL <![CDATA[MgSO4]]> The final concentration is 6 μM, and the dosage is 1.5 μL Bst DNA polymerase At the same concentration of 1 mg / mL, add 1 μL Template: pET28a-ASFV plasmid <![CDATA[Copy number is 10 6 copies / μL]]> Fluorescent dye solution (neutral red) The final concentration is 0.8 μM, and the dosage is 2 μL DEPC water Add to the total system to 25 μL

[0049] Table 2 LAMP primer set sequences

[0050]

[0051] Depend on Figure 1 It can be seen that both the mutant and the wild type have Bst DNA polymerase activity, and the color is significantly different compared to the no enzyme control group.

[0052] (II) Screening of buffer salt concentrations during purification of Bst DNA polymerase mutants

[0053] The present invention explores the purification process of wild-type Bst DNA polymerase and finds that by changing the salt concentration of the buffer in each process during the protein purification process, the A260 / A280 ratio of the final product enzyme can be effectively reduced, thereby improving the catalytic efficiency of the enzyme. Specifically, the qLAMP method is used to compare the catalytic efficiency of the enzyme purified under different buffer salt concentration conditions. The LAMP system used is to replace the neutral red in the above enzyme activity test method with Eva Green, and the salt concentration of the buffer in different processes during the purification of the wild-type Bst DNA polymerase is optimized (the elution buffer of the nickel column affinity chromatography is: 25mM Tris-HCl, 150 / 500 / 1000mM NaCl, 300mM imidazole; the elution buffer of the molecular exclusion chromatography is: 25mMTris-HCl, 150 / 500 / 1000mM NaCl, 2mM DTT) to determine the various buffer components of the purified Bst DNA polymerase mutant.

[0054] like Figure 2 As shown, after the purification process of wild-type Bst DNA polymerase was optimized, the optimal salt concentration of nickel column affinity chromatography elution buffer and molecular exclusion chromatography buffer was 500mM.

[0055] (III) Comparison of enzyme catalytic efficiency of Bst DNA polymerase mutants

[0056] The qLAMP method was used to compare the enzyme catalytic efficiency of Bst DNA polymerase mutants, wild-type Bst DNA polymerase and Bst2.0 DNA polymerase. The LAMP system was as above.

[0057] from Figure 3 It can be seen that the enzyme catalytic efficiency of the Bst DNA polymerase mutant is greater than that of the wild-type Bst DNA polymerase and Bst 2.0 DNA polymerase.

[0058] (IV) Comparison of enzyme activities of Bst DNA polymerase mutants

[0059] The qLAMP method was used to compare the enzyme activities of Bst DNA polymerase mutants, wild-type Bst DNA polymerase and Bst2.0 DNA polymerase. The LAMP system included an oligonucleotide hairpin, a complementary primer on the hairpin, dNTPs, Bst DNA polymerase buffer, Bst DNA polymerase and Eva Green, wherein the sequences of the hairpin and primer are shown below.

[0060] Card issuance: CCTCTCCGTGTCTTGTACTTCCCGTCAGAGAGG

[0061] Primer: gacgggaag

[0062] Figure 4 The results showed that based on the size comparison of the final fluorescence plateau phase, the mutant enzyme activity was greater than that of the wild-type and Bst2.0 enzymes.

[0063] (V) Salt tolerance test of Bst DNA polymerase mutants

[0064] Although the catalytic activity of the enzyme is essential, resistance to complex reaction systems is also crucial to the overall reaction efficiency. In general, pH and salt concentration have a greater or lesser effect on the amplification rate. High salt concentrations hinder the electrostatic interaction between the enzyme and DNA. Therefore, the qLAMP method was used to study the effects of different concentrations of (NH4)2SO4, KCl and MgSO4 in the amplification buffer on the amplification of Bst DNA polymerase mutants, wild-type Bst DNA polymerase and Bst 2.0 DNA polymerase. The buffer components used in the LAMP amplification process are: 20mM Tris-HCl, 5 / 10 / 20 / 50 / 100mM (NH4)2SO4, 10 / 20 / 50 / 100 / 200mM KCl, 0 / 2 / 4 / 8 / 12mM MgSO4, 0.1% Tween 20, pH = 8.8.

[0065] Figure 5-Figure 7 The results showed that the mutant did not show significant changes in the salt tolerance tests of (NH4)2SO4 and KCl, but in the MgSO4 salt tolerance test, it was more salt tolerant than the wild type and could still complete amplification at a concentration of 12mM.

[0066] (VI) pH resistance test of Bst DNA polymerase mutants

[0067] The pH value plays a key role in the amplification speed of Bst DNA polymerase. The conventional LAMP process occurs in a weakly alkaline environment, usually between 8.0-9.0. Here, we used the qLAMP method to test the amplification rate of mutants, wild-type and Bst2.0 enzymes between pH 8.0-9.5. The buffer components used in the LAMP amplification process are: 20mM Tris-HCl, 10mM (NH4)2SO4, 50mM KCl, 2mM MgSO4, 0.1% Tween 20, pH = 8.0 / 8.5 / 9 / 9.5.

[0068] from Figure 8It can be seen that all three DNA polymerases can achieve stable amplification between pH 8.0-9.5. Although the mutants did not have a significant improvement in pH tolerance, they increased the overall reaction rate in a high pH environment.

[0069] (VII) Heat resistance test of Bst DNA polymerase mutants

[0070] The use of polymerase amplification at high temperatures increases the possibility of hairpin loop formation and strand separation, resulting in more efficient and faster reactions. Here, we used the qLAMP method to test the amplification rates of mutants, wild-type and Bst2.0 enzymes at temperatures between 65 and 75 ° C. The amplification program was: 65 / 67 / 69 / 71 / 73 / 75 ° C for 40 min and 95 ° C for 10 min.

[0071] The results are as follows Fig. 9 As shown, the three DNA polymerases can perform real-time LAMP amplification at 65-73°C, and the mutants do not have a significant improvement in heat resistance.

[0072] (VIII) Optimization of the application of Bst DNA polymerase mutants in loop-mediated isothermal amplification

[0073] Purified Bst DNA polymerase has the problem of non-specific amplification. To address this problem, a suitable LAMP amplification system needs to be established, including three solutions: reducing the concentration of magnesium ions in the system, increasing the concentration of betaine in the system, and reducing the amount of enzyme used.

[0074] from Fig.10 It can be seen that the optimal betaine dosage of the Bst DNA polymerase mutant in LAMP amplification is 2M, the optimal magnesium ion concentration is 3.6mM, and the optimal enzyme dosage is 0.1mg / mL. Considering the problem of detection cost, it is recommended to use a lower enzyme concentration for LAMP detection.

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Bst DNA polymerase mutant, characterized in that The nucleotide sequence of the Bst DNA polymerase mutant is shown in SEQ ID NO.

1.

2. A method for preparing a Bst DNA polymerase mutant according to claim 1, characterized in that: The following steps are involved: S1. constructing an expression vector according to the nucleotide sequence of the Bst DNA polymerase mutant to obtain a mutant plasmid; S2. The mutant plasmid is transformed into competent cells by heat shock method for culture and expression. The obtained expression product is crushed by high pressure, purified and dialyzed to obtain the Bst DNA polymerase mutant.

3. The method for preparing a Bst DNA polymerase mutant according to claim 2, characterized in that: In step S1, the specific method of constructing the expression vector is: Using a wild-type Bst DNA polymerase plasmid as a template, designing primers according to the nucleotide sequence of the Bst DNA polymerase mutant, performing PCR amplification, using DpnⅠ restriction nuclease to digest the non-mutated parent chain in the amplified product, and purifying to obtain a mutant plasmid; The nucleotide sequence of the wild-type Bst DNA polymerase is shown in SEQ ID NO.

2.

4. The method for preparing a Bst DNA polymerase mutant according to claim 3, characterized in that: The primers include a forward primer and a backward primer, and the nucleotide sequences thereof are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

5. The method for preparing a Bst DNA polymerase mutant according to claim 3, characterized in that: In step S2, the specific method of purification is: taking the catalytic efficiency of the purified enzyme as an indicator, optimizing the salt concentration of the elution buffer used in the nickel column affinity chromatography and molecular exclusion chromatography purification process of the wild-type Bst DNA polymerase, and determining the elution buffer composition used in the purification process of the Bst DNA polymerase mutant based on the optimal elution buffer salt concentration of the wild-type Bst DNA polymerase purification process.

6. The method for preparing a Bst DNA polymerase mutant according to claim 5, characterized in that: The elution buffer of the nickel column affinity chromatography of the wild-type BstDNA polymerase is: 25mM Tris-HCl, 150-1000mM NaCl, 300mM imidazole, and the elution buffer of the molecular exclusion chromatography is: 25mM Tris-HCl, 150-1000mM NaCl, 2mM DTT.

7. Use of the Bst DNA polymerase mutant according to claim 1 or the Bst DNA polymerase mutant prepared by the preparation method according to any one of claims 2 to 7 in loop-mediated isothermal amplification.

8. The use according to claim 7, characterized in that The reaction system includes: inner primers FIP and BIP, outer primers F3 and B3, loop primers Loop-F and Loop-B, betaine, dNTPs, Bst DNA polymerase buffer, MgSO4, Bst DNA polymerase mutant, fluorescent dye, DNA template, and DEPC water.

9. The use according to claim 7, characterized in that The amplification procedure was: 65-73°C for 40 min and 95°C for 10 min.

Images