Prawn glutathione reductase gene promoter-based antioxidant compound screening plasmid, screening method and application

Abstract

The invention provides an antioxidant compound screening plasmid based on a prawn glutathione reductase gene promoter. The plasmid comprises a nucleotide sequence as shown in SEQ ID NO: 4. The invention further provides an antioxidant compound screening method based on the prawn glutathione reductase gene promoter. The invention also provides an application of the compound MC2 and / or MC3 in regulating the activity of LvGST, regulating and controlling an NRF2-Keap1 pathway or preparing a medicine for preventing and treating diseases caused by oxidative stress. According to the method, a dual-luciferase reporter gene system is utilized, so that large-scale screening of candidate compounds can be realized in a semi-automatic, simple and high-throughput manner, experimental errors caused by experimental operation process, transfection efficiency and cell state difference are reduced, and the accuracy is higher.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a screening plasmid, a screening method and an application of antioxidant compounds based on a shrimp glutathione reductase gene promoter. Background Art

[0002] Substance and energy metabolism is constantly taking place in biological organisms, accompanied by various oxidation reactions, which produce numerous free radical molecules in cells. Among them, reactive oxygen species (ROS) are the most important and most thoroughly studied, so they are often regarded as characteristic molecules of oxidative stress.

[0003] ROS generally refers to superoxide anions (·O-2), hydroxyl radicals (OH) and hydrogen peroxide (H2O2). There are two sources of ROS: one is endogenous, such as leakage of reactive oxygen in the oxidative phosphorylation process of the mitochondrial respiratory chain and production by peroxisomes and activated inflammatory cells; the other is exogenous, such as exogenous compounds, pathogens, proinflammatory cytokines and heavy metal induction. When cells are stimulated by internal and external environments, the production of ROS and other substances increases, which may break the balance between the body's oxidation-antioxidation system and eventually lead to oxidative stress. The destructive effect of free radical molecules such as ROS on biological macromolecules under oxidative stress is the main reason for cell damage. Among them, proteins and DNA are the main targets of ROS attack. ROS attacks can cause protein structural mutations or loss of biological activity, DNA chain breaks, DNA site mutations, DNA double-strand distortions, and proto-oncogene and tumor suppressor gene mutations, ultimately leading to oxidative damage to the body. On the other hand, a certain amount of ROS will not only not cause damage to the body, but also have the effects of killing pathogens and detoxification. This is particularly important for invertebrates that lack acquired immunity. ROS plays a key role in some important immune responses, such as "respiratory burst" (RB) and encapsulation. The former is that cells take in a large amount of oxygen, activate the oxidase in the body, produce high concentrations of superoxide anions in the body and generate a variety of reactive oxygen intermediates, which are then used to kill bacteria; the latter is that blood cells bind to large invaders, such as parasites, protozoa and nematodes, and form multi-layer cysts around the invaders. Subsequently, the invaders in the cysts are poisoned or suffocated by ROS and reactive nitrogen species (RNS) in the cavity. Therefore, the balance between the body's oxidation-antioxidation system is crucial for the normal physiological activities and even survival of eukaryotic organisms.

[0004] Since the different positive and negative effects of ROS on cells are closely related to their concentration, the body's oxidation-antioxidation system needs to be precisely regulated to maintain balance. Oxidative stress breaks the balance of the redox state in cells, thereby activating or inhibiting many signaling pathways and some signal transduction molecules, such as the NRF2-Keap1 pathway, the NF-κB pathway, MAPKs, kinase proteins, mammalian target of rapamycin (mTOR) and protein kinase C (PKC), and ultimately regulating the expression of effector genes. Nrf2 is a transcription factor of the core pathway Nrf2-Keap1 in the oxidative stress response, and is present in all types of cells in the body. Its loss or activation disorder directly causes changes in the sensitivity of cells to stressors. Keap1, another important protein in this pathway, binds to the cysteine-rich region of Nrf2, making most of the latter unable to enter the cell nucleus, thereby basically inhibiting the transcription factor activity of Nrf2 and avoiding increasing the sensitivity of cells to stressors. When cells are under oxidative stress or the intracellular ROS concentration is too high, the cysteine ​​in Keap1 is acid-phosphorylated, and then the activity of Keap1 as an E3 ligase weakens, Nrf2 and Keap1 separate, resulting in reduced Nrf2 ubiquitination and degradation, an increase in free Nrf2 in the cytoplasm, and an increase in Nrf2 transferred into the nucleus. Nrf2 that enters the nucleus forms a heterodimer with Maf protein and binds to the antioxidant responsive element (ARE) in the promoter region of the target gene. Subsequently, the transcription initiation complex containing the Nrf2-Maf dimer activates and initiates the transcription of many antioxidant stress effector genes in the cell, such as glutathione reductase family gene genes, thioredoxin system genes, and peroxidase family genes, thereby maintaining the balance of the intracellular oxidation-antioxidation system.

[0005] In fact, under physiological conditions, the Nrf2-Keap1 pathway can maintain low-intensity activity to stabilize the ROS generated by the metabolic process at a certain level. The Nrf2-Keap1 pathway is not only directly involved in the regulation of antioxidant genes, but also can maintain the balance of the oxidation-antioxidation system in cells by coordinating and directing other antioxidant stress-related pathways, such as the PI3K-Akt pathway and the TLR pathway. In addition, RNS (including nitric oxide (NO), peroxynitrosyl anion (ONOO-), nitrosyl hydrogen (HNO), nitrite ion (NO2-) and nitrogen dioxide (NO2)) and endoplasmic reticulum stress (ER)-stress caused by exogenous substances can also activate the Nrf2-Keap1 pathway. It can be seen that the Nrf2-Keap1 pathway is the core signaling pathway for maintaining the balance of the oxidation-antioxidation system in cells. It can be seen that Nrf2-Keap1 pathway regulatory compounds play an important role in both theoretical research and practical application. Screening for Nrf2-Keap1 pathway regulatory compounds involves detecting the activity of the pathway. The most direct method for detecting the activity of the pathway is to detect the nuclear entry of Nrf2, which usually requires Western-blot technology or immunofluorescence technology.

[0006] However, if these two technologies are used, large-scale screening cannot be carried out. Another technical route is to detect the expression of downstream genes of the Nrf2-Keap1 pathway, and reporter gene technology can be used to achieve high-throughput screening.

[0007] At present, there is no report on the screening method of antioxidant compounds based on the shrimp glutathione reductase gene promoter. Summary of the invention

[0008] The purpose of the present invention is to provide a highly efficient and specific screening plasmid, screening method and application for the antioxidant stress compounds in the NRF2-Keap1 pathway of shrimp in response to the above technical problems.

[0009] In order to achieve the above object, the present invention provides a plasmid for screening antioxidant compounds based on the promoter of shrimp glutathione reductase gene (glutathione reductase, LvGST), wherein the plasmid comprises a nucleotide sequence as shown in SEQ ID NO:4.

[0010] Specifically, the nucleotide sequence of SEQ ID NO: 4 is TGCAAAGTCAC. This nucleotide sequence can be specifically recognized by Nrf2 protein. The protection scope of the present invention also relates to a nucleotide sequence complementary to the nucleotide sequence shown in SEQ ID NO: 4.

[0011] Preferably, the sequence is inserted into the multiple cloning site of a plasmid. More preferably, the plasmid is a plasmid vector pGL3-Basic, and the sequence is inserted between the Kpn I and Bgl II sites of the pGL3-Basic vector.

[0012] In another aspect, the present invention also provides a host cell comprising the plasmid.

[0013] On the other hand, the present invention also provides a method for screening antioxidant compounds based on the shrimp glutathione reductase gene promoter, the method comprising the following steps:

[0014] (1) The promoter sequence of the LvGST gene of Litopenaeus vannamei was obtained by chromosome walking, and the promoter sequence was analyzed and synthetic primers were designed to amplify the LvGST promoter, and the dual luciferase reporter gene vector pGL3-LvGST expressing the LvGST promoter was constructed;

[0015] (2) The dual luciferase reporter gene vector pGL3-LvGST expressing the LvGST promoter, the vector expressing the Nrf2 protein, and the internal reference plasmid pRL-TK were co-transfected into Drosophila S2 cells. After 40 hours of transfection, the candidate antioxidant compounds were added respectively. After 8 hours, the cells were lysed and the ratio of firefly luciferase activity to Renilla luciferase activity in the cell lysate was detected and compared with that of the control group without the addition of the candidate antioxidant compounds. The regulatory effect of the candidate antioxidant compounds on the LvGST promoter was analyzed, thereby screening antioxidant compounds that can regulate the activity of LvGST.

[0016] Preferably, the primers used to amplify the LvGST promoter in step (1) are as follows:

[0017] pGL3-LvGST-KpnⅠ-F:5'-TATggtaccATATATAAACGAATGGGAGTAAGTAAT-3'

[0018] pGL3-LvGST-BglⅡ-R: 5'-AATagatctCTTGACGCTGTGGAAGGAAA-3'.

[0019] Preferably, in step (1), the sample loading parameters of the 50 μL PCR reaction system for amplification are as follows: 1 μL of 10 pM forward and reverse primers, 1 μL of 10 Mm dNTP, 5 μL of 10×PCR buffer, 1 μL of LA Taq enzyme, 200 ng of the vannamei genomic template, and the volume is made up to 50 μL with ultrapure water. The PCR running program parameters are as follows: pre-denaturation at 94°C for 3 minutes; then denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; repeat the cycle 34 times.

[0020] Preferably, in the step (1), after the PCR product is gel-recovered and purified, 1 μg of the PCR product and 1 μg of the pGL3-Basic empty vector are cut with restriction endonucleases KpnⅠ and BglⅡ, respectively.

[0021] Preferably, the 50 μL enzyme digestion system in step (1) is as follows: 5 μL of 10× enzyme digestion buffer, 5 μL of each of two restriction endonucleases KpnⅠ and BglⅡ, 1 μg of DNA, pure water added to make up to at least 50 μL, enzyme digestion temperature of 37°C, and enzyme digestion time of 2 hours.

[0022] Preferably, in step (1), after the empty vector and PCR fragment are digested, cloning and sequencing are performed to confirm that the vector is successfully constructed; endotoxin-free plasmid is extracted, the concentration is measured, and it is stored under appropriate conditions for later use.

[0023] Preferably, in step (2), S2 cells are cultured in a 96-well plate in advance, and plasmid transfection can be performed when the cells grow to cover about 90% of the area (about 24 hours).

[0024] Preferably, in step (2), 50 μL of transfection system in each well of a 96-well plate contains 0.2 μg of pGL3-LvGST and 0.02 μg of pRL-TK. The transfection reagent used is lipofectamine 2000 (Invitrogen, CAT. NO. 11668-027), and the transfection method is in accordance with the reagent instructions.

[0025] Preferably, in step (2), cell lysis and two luciferase activity detection are performed using Dual-Luciferase Reporter A assay System (Promega, Lot#327451), and the usage is in accordance with the reagent instructions.

[0026] On the other hand, the present invention also provides the use of compound MC2 in regulating LvGST activity, regulating NRF2-Keap1 pathway or preparing drugs for preventing and treating diseases caused by oxidative stress, wherein the chemical structure of compound MC2 is:

[0027]

[0028] On the other hand, the present invention also provides the use of compound MC3 in regulating LvGST activity, regulating NRF2-Keap1 pathway or preparing drugs for preventing and treating diseases caused by oxidative stress, wherein the chemical structure of compound MC3 is:

[0029]

[0030] NRF2-Keap1 pathway regulatory compounds play an important role in the study of cell anti-oxidative stress function and have potential therapeutic effects on diseases caused by oxidative stress. The present invention has the following advantages: (1) The present invention utilizes a dual luciferase reporter gene system to achieve large-scale screening of candidate compounds in a semi-automatic, simple and high-throughput manner; (2) The rational design of the dual luciferase reporter gene system reduces experimental errors caused by differences in experimental operation process, transfection efficiency and cell state, making the accuracy higher; (3) The present invention is mainly used for the screening of NRF2-Keap1 pathway regulatory compounds, and is also used for the screening of auxiliary drugs for the treatment of oxidative stress-related diseases; (4) The NRF2-Keap1 pathway is conserved in eukaryotic cells, so the screened NRF2-Keap1 pathway regulatory compounds may also play a role in other eukaryotic cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The promoter sequence of the GST gene of Litopenaeus vannamei is shown. The NRF2 binding site is indicated by a shaded mark.

[0032] Figure 2 This is the pGL3-Basic empty vector plasmid map.

[0033] Figure 3 This is the plasmid map of the internal reference plasmid pRL-TK.

[0034] Figure 4 It was shown that LvGST is a downstream target gene of the NRF2-Keap1 pathway in Litopenaeus vannamei.

[0035] Figure 5 The luciferase reporter gene system is used to screen for compounds regulating the GST promoter in Litopenaeus vannamei. DETAILED DESCRIPTION

[0036] The following is a preferred embodiment of the present invention. It should be noted that, for those skilled in the art, several improvements and modifications can be made without departing from the principles of the present invention, and these improvements and modifications are also considered to be within the scope of protection of the present invention. Unless otherwise specified, the reagents and consumables used in the embodiments of the present invention are all commercially available products. Unless otherwise specified, the conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics and recombinant DNA used in the embodiments of the present invention are all within the skills of the field.

[0037] The present invention provides a screening plasmid, screening method and application of antioxidant compounds based on the promoter of shrimp glutathione reductase gene, including but not limited to one or more of the following steps:

[0038] 1. Chromosome walking to obtain the promoter sequence of LvGST

[0039] (1) The promoter sequence of Litopenaeus vannamei LvGST was obtained by chromosome walking, and the reporter gene vector pGL3-LvGST was constructed using pGL3-Basic (Cat. No.: E1751, Promega). According to the LvGST expressed sequence tag (EST) sequence on GenBank (GenBank sequence number: GETZ01007636), two specific primers for Genome-Walking PCR were designed (R1: 5'TTGACGCTGTGGAAGGAAACGAAGTGCA3' (SEQ ID NO: 1); R2: 5'CTGTGATCAAAGTGTCTTTCCCTTGAAA 3' (SEQ ID NO: 2), and the promoter sequence of LvGST (SEQ ID NO: 3) was obtained by PCR using the Genome-Walking Kit. The Genome-Walking Kit used a kit from Clontech, with a catalog number of 638904; (Specifically, the chromosome walking method includes: cutting the genome and then connecting a universal linker; when amplifying the promoter, the forward primer used is the universal primer in the kit, and the reverse primer is SEQ ID NO: 1 and SEQ ID NO: 2 designed by the present invention.

[0040] The specific nucleotide sequence of the LvGST promoter SEQ ID NO: 3 is:

[0041] ATATATAAACGAATGGGAGTAAGTAATAAAGCTACAACGAAGGAAGAGCAGTGGAAGACAGCGGTGCCTCTTGAGTGGAGAGTCAAGGTCAGAATTCCCTTCCCCTGATGCTGACGTCATGATCACAAGCGGGCCGTGTGAAAATGGCTCGCCTGT CAAAGTCGTATGGACAGAATGTAATGAGTGTCTGTCTGTTCTCTTGGGATAGTGATTTTGTTGTTTATGTTTCTTTCTACTTGCCTGTGTACACCGTGTCTGCAGACTACATTAGAGCGTGCGTGTACGCGGTTATCTGATGTTTGTGCTTCCGTG TGCAAAGTCACCCTGACATGGCTAGCTATTATCAGTAGACTTCAGTCAACGGTCGGACGTGCTCTGCCCCACACGCCCATCAGCGCCTCCTCCGAAATAGTGAGTGGAAGATTCATTTACTGGCTGTTCTGAGGCTTTCAAGGGAAAGACACTTTGATCACAGGCATACTCTGAACACAGCTTGCACTTCGTTTCCTTCCACAGCGTCAAG.

[0042] Among them, the underlined ARE nucleotide sequence is a potential NRF2 binding site, specifically TGCAAAGTCAC (SEQ ID NO: 4). Figure 1 The nucleotide sequence of the promoter of the GST gene of Litopenaeus vannamei is also shown. The NRF2 binding site sequence is indicated by a shaded mark.

[0043] 2. Construction of pGL3-LvGST vector

[0044] According to the promoter sequence (SEQ ID NO: 3) of the GST gene of Litopenaeus vannamei obtained in step (i), the promoter sequence is analyzed and primers are designed and synthesized to construct a dual luciferase reporter gene vector;

[0045] The nucleotide sequences of the primers designed to synthesize and amplify the LvGST promoter are as follows:

[0046] pGL3-LvGST-KpnⅠ-F: 5'-TATggtaccATATATAAACGAATGGGAGTAAGTAAT-3' (SEQ IDNO: 5);

[0047] pGL3-LvGST-BglII-R: 5'-AATagatctCTTGACGCTGTGGAAGGAAA-3' (SEQ ID NO: 6).

[0048] The sample loading parameters of the 50 μL PCR reaction system were as follows: 1 μL of each forward and reverse primer (10 pM), 1 μL of 10 Mm dNTP, 5 μL of 10× PCR buffer, 1 μL of LA Taq enzyme, 200 ng of Litopenaeus vannamei genome template, and the volume was made up to 50 μL with ultrapure water.

[0049] PCR program parameters: pre-denaturation at 94°C for 3 minutes; then denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; repeat the cycle 34 times.

[0050] After gel purification of the PCR product, the PCR product and the pGL3-Basic empty vector (Promega, E1751, plasmid map as shown in Figure 1) were cleaved with restriction endonucleases Kpn I and Bgl II, respectively. Figure 2 As shown) 1 μg each.

[0051] Enzyme digestion system (50 μL): 5 μL of 10× enzyme digestion buffer, 5 μL of each of two restriction endonucleases, 1 μg of DNA (volume depends on concentration), add pure water to make up to at least 50 μL. Enzyme digestion temperature 37°C, enzyme digestion time 2 hours.

[0052] After the empty vector and PCR fragment were digested, cloning and sequencing were performed to confirm that the vector was successfully constructed. The recombinant vector with completely correct sequencing was named pGL3-LvGST; the endotoxin-free plasmid was extracted, the concentration was measured, and it was stored under appropriate conditions for future use.

[0053] 3. Detection of NRF2 activation on LvGST promoter

[0054] 1. The pGL3-LvGST plasmid vector obtained in step (ii) was used together with pAc5.1-LvNRF2 (the negative control group used pAc5.1-LvActin; pAc5.1-LvNRF2 and pAc5.1-LvActin were obtained by inserting the coding nucleotide sequences of LvNRF2 and LvActin into the KpnⅠ and ApaⅠ restriction sites of the pAc5.1-Basic plasmid, wherein the manufacturer and product number of pAc5.1-Basic is (V4110-20) and the internal reference plasmid pRL-TK (Promega, E2241, the plasmid map is as follows) Figure 3 As shown) were co-transfected into Drosophila S2 cells.

[0055] The nucleotide sequence of LvNRF2 used in the embodiment of the present invention is shown in SEQ ID NO: 7 below.

[0056] S2 cells (Schneider's Medium + 5% FBS) were cultured in a 96-well plate one day in advance, and plasmid transfection was performed when the cells grew to cover about 90% of the area (about 24 hours).

[0057] The transfection system (50 μL) in each well of the 96-well plate contained 0.2 μg of pGL3-LvGST and 0.02 μg of pRL-TK; the transfection reagent used was lipofectamine 2000 (Invitrogen, catalog number: 11668-027), and the transfection method followed the reagent instructions.

[0058] 2. After 48 hours of transfection, the cells were lysed and the ratio of firefly luciferase activity to Renilla luciferase activity in the cell lysate was detected. Compared with the control group overexpressing LvActin, the activation effect of NRF2 on the LvGST promoter was detected. The results showed that LvGST was a downstream effector gene of the NRF2-Keap1 pathway. Figure 4 As shown, Figure 4 The verification result of whether LvGST provided in the embodiment of the present invention is the downstream target gene of the NRF2-Keap1 pathway of Penaeus vannamei. Figure 4 It can be seen that NRF2 of Litopenaeus vannamei significantly enhances the promoter activity of LvGST, and this promoting effect disappears when the NRF2 binding site in the LvGST promoter is mutated (pGL3-LvGSTm). One-way ANOVA was used, and ** indicates p < 0.01.

[0059] Compared with pGL3-LvGST, Figure 3 The difference between pGLbasic and pGL3-LvGSTm lies in the ARE site sequence. Specifically, the ARE site sequence information is as follows: pGL3-LvGST is TGCAAAGTCAC (SEQ ID NO: 8), and pGL3-LvGSTm is: gaagcctcaga (SEQ ID NO: 9).

[0060] 4. Screening of candidate compounds using the luciferase reporter gene system

[0061] The reporter gene plasmid pGL3-LvGST constructed in step (ii) and the internal reference plasmid were co-transfected into Drosophila S2 cells. The transfection conditions were the same as those in step (iii). After 40 hours of transfection, the candidate antioxidant compound was added for treatment. After 8 hours, the cells were lysed, and the ratio of firefly luciferase activity / sea renilla luciferase activity in the cell lysate was detected. Compared with the control group, the regulatory effect of the candidate antioxidant compound on the LvGST promoter was analyzed.

[0062] Specifically, 40 hours after transfection, appropriate amounts of NRF2-Keap1 pathway activator tert-butylhydroquinone (tBHQ), NRF2-Keap1 pathway inhibitor LY294002 (structural formula C19H17NO3 molecular weight: 307.343, CAS number: 154447-36-6), keap1-Nrf2 pathway inhibitor keap1 (comp124453) or candidate marine compounds were added to the culture medium of different experimental groups for treatment; 8 hours later, the cells were lysed and the ratio of firefly luciferase / sea renilla luciferase activity in the lysate was detected respectively. Cell lysis and luciferase activity detection were performed using Dual-Luciferase Reporter Aassay System (Promega, catalog number 327451), and the use method was in accordance with the reagent instructions. Compared with the control group overexpressing LvActin, the activation effect on the LvGST promoter was detected, proving that LvGST is a downstream effector gene of the NRF2-Keap1 pathway (e.g. Figure 4 As shown in Figure 2 ). Litopenaeus vannamei NRF2 significantly enhanced the LvGST promoter activity (pGL3-LvGST), but this promotion effect disappeared when the NRF2 binding site in the LvGST promoter was mutated (pGL3-LvGSTm). One-way ANOVA was used, and ** indicates p < 0.01.

[0063] Figure 5 Results of screening for compounds regulating the GST promoter in Litopenaeus vannamei using the luciferase reporter gene system. Through testing, it was found that the candidate marine compounds (MC) MC2 and MC3 can significantly regulate the activity of LvGST. This indicates that they are potential regulators of the NRF2-Keap1 pathway. * indicates p < 0.05, ** indicates p < 0.01.

[0064] Among them, the chemical structure of MC2 is:

[0065]

[0066] The chemical structure of MC3 is:

[0067]

[0068] It can be seen that compounds MC2 and / or MC3 can be used to regulate LvGST activity, regulate the NRF2-Keap1 pathway, or prepare drugs for preventing and treating diseases caused by oxidative stress.

[0069] 5. Immunovalidation of Regulatory Compounds

[0070] For those that can significantly activate LvGST, they are used to treat S2 cells, and then Drosophila NRF2 antibodies are used to detect whether they can induce NRF2 to enter the nucleus, that is, activate the NRF2-Keap1 pathway.

[0071] The present invention has the following advantages: (1) The present invention utilizes a dual luciferase reporter gene system to realize large-scale screening of candidate compounds in a semi-automatic, simple and high-throughput manner; (2) The rational design of the dual luciferase reporter gene system reduces experimental errors caused by differences in experimental operation process, transfection efficiency and cell state, thereby achieving higher accuracy; (3) NRF2-Keap1 pathway regulatory compounds play an important role in the study of cellular antioxidant stress function and have potential therapeutic effects on diseases caused by oxidative stress. The present invention is mainly used for the screening of NRF2-Keap1 pathway regulatory compounds and is also used for the screening of auxiliary drugs for the treatment of oxidative stress-related diseases; (4) The NRF2-Keap1 pathway is conserved in eukaryotic cells, so the screened NRF2-Keap1 pathway regulatory compounds may also play a role in other eukaryotic cells.

Claims

1. A plasmid for screening antioxidant compounds based on the promoter of shrimp glutathione reductase gene, the plasmid comprising the nucleotide sequence shown in SEQ ID NO:

4.

2. The plasmid according to claim 1, characterized in that The sequence was inserted into the multiple cloning site of the plasmid.

3. The plasmid according to claim 1, characterized in that The plasmid is a plasmid vector pGL3-Basic, and the sequence is inserted between the Kpn I and Bgl II sites of the pGL3-Basic vector.

4. A method for screening antioxidant compounds based on the promoter of shrimp glutathione reductase gene, the method comprising the following steps: (1) The promoter sequence of the LvGST gene of Litopenaeus vannamei was obtained by chromosome walking, and the promoter sequence was analyzed and synthetic primers were designed to amplify the LvGST promoter, and the dual luciferase reporter gene vector pGL3-LvGST expressing the LvGST promoter was constructed; (2) The dual luciferase reporter gene vector pGL3-LvGST expressing the LvGST promoter, the vector expressing the Nrf2 protein, and the internal reference plasmid pRL-TK were co-transfected into Drosophila S2 cells. After 40 hours of transfection, the candidate antioxidant compounds were added respectively. After 8 hours, the cells were lysed and the ratio of firefly luciferase activity to Renilla luciferase activity in the cell lysate was detected and compared with that of the control group without the addition of the candidate antioxidant compounds. The regulatory effect of the candidate antioxidant compounds on the LvGST promoter was analyzed, thereby screening antioxidant compounds that can regulate the activity of LvGST.

5. The method according to claim 4, characterized in that The primers used to amplify the LvGST promoter in step (1) are as follows: pGL3-LvGST-KpnⅠ-F:5'-TATggtaccATATATAAACGAATGGGAGTAAGTAAT-3' pGL3-LvGST-BglⅡ-R: 5'-AATagatctCTTGACGCTGTGGAAGGAAA-3'.

6. The method according to claim 4, characterized in that In the step (1), the sample loading parameters of the 50 μL PCR reaction system used for amplification are as follows: 1 μL each of 10 pM forward and reverse primers, 1 μL of 10 Mm dNTP, 5 μL of 10×PCR buffer, 1 μL of LA Taq enzyme, 200 ng of vannamei genomic template, and the volume is made up to 50 μL with ultrapure water; the PCR running program parameters are as follows: pre-denaturation at 94°C for 3 minutes; then denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds; and the cycle is repeated 34 times.

7. The method according to claim 4, characterized in that In the step (1), after the PCR product is gel-recovered and purified, the PCR product and the pGL3-Basic empty vector are cut respectively using restriction endonucleases KpnⅠ and BglⅡ.

8. The method according to claim 4, characterized in that In the step (2), the 50 μL transfection system in each well of the 96-well plate contains 0.2 μg of pGL3-LvGST and 0.02 μg of pRL-TK.

9. Use of compound MC2 in regulating LvGST activity, regulating NRF2-Keap1 pathway or preparing drugs for preventing and treating diseases caused by oxidative stress, wherein: The chemical structure of compound MC2 is:

10. Use of compound MC3 in regulating LvGST activity, regulating NRF2-Keap1 pathway or preparing drugs for preventing and treating diseases caused by oxidative stress, wherein: The chemical structure of compound MC3 is:

Images