Rice pre-harvest sprouting resistant OsRDR4 gene as well as InDel marker and application thereof

Abstract

The invention discloses a rice pre-harvest sprouting resistant OsRDR4 gene and an InDel marker and application thereof, the rice pre-harvest sprouting resistant OsRDR4 gene is obtained through a gene editing method, and the rice pre-harvest sprouting rate is increased due to deletion of the gene. OsRDR4 gene close linkage primers ZIRDR4 are designed to be used for rice pre-harvest sprouting resistant molecular marker-assisted selection, the pre-harvest sprouting resistant genes OsRDR4 are successfully introduced into pre-harvest sprouting susceptible varieties Goid46B and II-32B and a pre-harvest sprouting susceptible variety Williang B, and the pre-harvest sprouting rate of the varieties is extremely remarkably reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic breeding, and in particular to a method for preventing rice ear germination. OsRDR4 Gene and InDel marking and application. Background Art

[0002] Rice panicle germination refers to the phenomenon that the seeds germinate prematurely on the panicle due to environmental conditions (such as high temperature and high humidity) before the rice is harvested. This problem seriously affects the yield and quality of rice (including hybrid rice seed production), causing huge losses to agricultural production. For example, in September 2024, there were several consecutive rainy days in Fujian, which caused a sharp increase in the panicle germination rate of sterile lines in hybrid rice seed production and halved the yield. Its essence is that the dormancy of seeds of modern varieties is reduced. Rice panicle germination is a complex quantitative trait controlled by multiple genes. Its occurrence is jointly affected by intrinsic factors of the variety (such as hormone content (ABA / GA), seed maturity and morphology) and external environment (such as light, temperature and humidity). New panicle germination germplasm or resistance genes can be mined through natural populations or mutagenesis. For example, Chu Chengcai et al. obtained 12 easy-to-sprout mutants by mutagenesis, and gene cloning found that mutations in the main enzymes OsPDS, OsZDS, OsCRTISO and β-OsLCY involved in the carotenoid biosynthesis pathway reduced ABA biosynthesis, resulting in an easy-to-sprout phenotype. However, the discovered ear sprout resistance loci cannot completely solve the ear sprout resistance problem in production, and new genes need to be further discovered.

[0003] Molecular marker technology plays an important role in rice ear sprout resistance breeding. InDel (insertion / deletion) marker is a molecular marker technology based on DNA sequence differences. It has the advantages of simple operation, low cost and good stability. It is suitable for large-scale genetic analysis and molecular marker-assisted breeding.

[0004] Therefore, studying new rice panicle sprout resistance genes and their InDel markers will not only help to deeply understand the molecular mechanism of rice panicle sprouting, but also provide strong technical support for the breeding of rice varieties resistant to panicle sprouting. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the present invention aims to provide a rice anti-ear sprouting OsRDR4 Gene and InDel marking and application.

[0006] In order to achieve the above object, the present invention adopts the following technical solution: The present invention provides OsRDR4 Application of genes in regulating the germination of fresh seeds of plants, the OsRDR4 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0007] Furthermore, the plant is wheat, rice or Arabidopsis thaliana.

[0008] Furthermore, the lack OsRDR4 The gene improves the germination level of fresh rice seeds and reduces germination resistance.

[0009] The present invention also provides a primer pair of InDel markers for identifying rice panicle sprouting resistance / susceptibility, the nucleotide sequence of the primer pair is: ZIRDR4-F: 5'-CGTGATCAGATCCAGTGCAG-3'; ZIRDR4-R: 5'-TGCAAGCAATCTGAGCCATCC -3'.

[0010] The present invention also provides a kit for identifying rice panicle sprouting resistance / susceptibility, and the kit comprises the above primer pair.

[0011] The present invention also provides the use of the above-mentioned InDel-labeled primer pair or the above-mentioned kit in auxiliary breeding of rice anti-ear sprouting traits.

[0012] Furthermore, the above application includes the following steps: (1) extracting genomic DNA of rice to be tested; (2) Using genomic DNA as a template, PCR amplification was performed on the genomic DNA using the ZIRDR4-F / R primer pair, and rice panicle germination resistance / susceptibility analysis was performed based on the agar gel electrophoresis results; the nucleotide sequence of the primer pair was: ZIRDR4-F: 5'-CGTGATCAGATCCAGTGCAG-3'; ZIRDR4-R: 5'-TGCAAGCAATCTGAGCCATCC -3'.

[0013] Furthermore, when the agar gel electrophoresis result is 406 bp, it indicates that the tested rice carries OsRDR4 Gene Nipponbare allele type; when the agar gel electrophoresis result is 492bp, it means that the tested rice does not carry OsRDR4 Gene Nipponbare allele type.

[0014] The beneficial effects of the present invention are: (1) The present invention provides rice OsRDR4 The application of genes can enhance the resistance of rice panicle germination.

[0015] (2) The present invention provides a rice ear sprout resistance gene OsRDR4 Indel molecular marker ZIRDR4, which is closely linked to the gene.

[0016] (3) Anti-ear sprouting gene OsRDR4 Molecular marker-assisted screening can obtain rice varieties or lines with significantly improved resistance to ear germination. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : OsRDR4 Sequencing verification of gene-edited lines.

[0018] Figure A shows Nipponbare (NIP) and gene knockout lines KO-8, KO-12, and KO-15. RDR4 -bar3 sequencing results; Figure B shows the sequencing results of Nipponbare (NIP) and gene knockout lines KO-8, KO-12, and KO-15. RDR4 -Sequencing results of bar4.

[0019] Figure 2 : OsRDR4 Ear sprouting phenotype of gene-edited lines.

[0020] Figure A shows the ear germination phenotype of Nipponbare (NIP) and gene knockout lines KO-8, KO-12, and KO-15; Figure B shows the ear germination rate of Nipponbare and gene knockout lines KO-8, KO-12, and KO-15 in July 2023; Figure C shows the ear germination rate of Nipponbare and gene knockout lines KO-8, KO-12, and KO-15 in November 2023.

[0021] Figure 3 : Amplification results of molecular marker ZIRDR4 in resistant / susceptible ear germination parents, where Takara DL1000 was used as the marker.

[0022] Figure 4 : Ear sprouting performance of the ear sprouting resistant near-isogenic lines of Gang46B (Gang46B-RDR4-1, Gang46B-RDR4-2 and Gang46B-RDR4-3).

[0023] Figure 5 : Ear sprout performance of II-32B ear sprout resistant near-isogenic lines (II-32B, II-32B-RDR4-1, II-32B-RDR4-2 and II-32B-RDR4-3). DETAILED DESCRIPTION

[0024] The technical solution of the present invention is further described in detail below through specific embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments.

[0025] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0026] Example 1: Rice ear sprout resistance gene OsRDR4 Identification (1) Rice ear sprout resistance gene OsRDR4 Knockout validation by OsRDR4 (sequence as shown in SEQ ID NO.1) was the target gene, and CRISPR-GE software was used to target the japonica rice variety Nipponbare OsRDR4 Gene search for PAM sequence. Through BLAST analysis, OsRDR4 Two sequences of the gene were selected as highly conservative preferred sequences OsRDR4 -bar3 (specific target sequence is TCTGCAGACTGCGATTGAAG) and OsRDR4 -bar4(GTGCTACGGCAGCTACTAAC). Wuhan Boyuan Biotechnology Co., Ltd. was commissioned to use CRISP / Cas9 technology to construct the vector pBWA(V)HU-yl- RDR4 After transforming Nipponbare, a total of 23 transgenic plants were obtained. DNA was extracted from these transgenic plants and tested with hygromycin (primer: Hyg), and 3 strains were identified as negative strains and 20 strains as positive strains. Then, the gene editing target site primers R4-b3 and R4-b4 were used to amplify the positive plants, and these amplified products were sent to Shanghai Biotech for sequencing and identification to determine the type of gene editing.

[0027] Sequence of sequencing primer R4-b3: SEQ ID NO.2: R4-b3-F: 5'-CAACTTATTGAGGTGTTCAATAC-3'; SEQ ID NO. 3: R4-b3-R: 5'-GATTGAAGTTAACCTTGTTCCCC-3'.

[0028] Sequence of sequencing primer R4-b4: SEQ ID NO.4: R4-b4-F: 5'-GTGCTGTCACATGTCTAATCCTC-3'; SEQ ID NO. 5: R4-b4-R: 5'-CTAGATTGCAAGTACGACTCTTC-3'.

[0029] The results are as follows Figure 1As shown, the sequencing results were aligned with the corresponding sequences of the wild type, and three different variant types of the R4-b3 and R4-b4 target sites were selected for subsequent research, namely: KO-8 (R4-b3 deletion of 1bp and R4-b4 deletion of 32bp), KO-12 (R4-b3 deletion of 3bp and R4-b4 deletion of 32bp), and KO-15 (R4-b3 deletion of 3bp and R4-b4 deletion of 1bp).

[0030] (2) OsRDR4 Ear germination phenotype of gene-edited lines Planting Nihonbare OsRDR4 The knockout lines are KO-8, KO-12 and KO-15. When mature, the whole ear germination method was used to evaluate the germination resistance of rice ears. The specific steps are as follows: First, record the date and mark it for each line at the initial heading stage. When the grains are mature (30-35 days after heading), select more than 10 rice ears with the same maturity date from each line, put them into a seed soaking bag and tie them up. After sampling, soak the seeds in an incubator at 28°C for 10 hours. After that, carry out germination treatment for 7 days (28°C), wash twice a day and dry them. After germination, investigate the germination rate of each ear.

[0031] Figure 2 The results showed OsRDR4 The ear germination rates of the gene knockout strains KO-8, KO-12 and KO-15 were significantly higher than those of the wild-type Nipponbare. OsRDR4 The functional loss of the gene leads to a decrease in the germination resistance of Japanese rapeseed.

[0032] Example 2: Rice ear sprout resistance gene OsRDR4 Development of tightly linked markers for the gene ZIRDR4 Comparison of Japan's sunny and good radiation OsRDR4 The 3kb region upstream and downstream of the gene was found to be higher than that of Nipponbare. OsRDR4 The allele has an additional 86 bp near 1.1 kb downstream of the 3'UTR; the added sequence is shown below underlined: tattcgcgagacgaatctgttgagcctaattagtctatgattagtctatgtgatgctacagtaa ACATGTGCTAATTATATATTATTTAGGATTAAAAAATTTATCTCATGAATTAGCTCTCATTTATATAATTAGTTTTATTATTAGTCTACATTTAATAATTTGAATTAATGTTCAA acattcgatatgacagggacta; Primers ZIRDR4 were designed on both sides of the increase.

[0033] Sequence of primer ZIRDR4: SEQ ID NO.6: ZIRDR4-F: 5'-CGTGATCAGATCCAGTGCAG-3'; SEQ ID NO.7: ZIRDR4-R: 5'-TGCAAGCAATCTGAGCCATCC-3'; The product of the anti-ear sprouting allele amplified by this sequence is 406 bp, and the nucleotide sequence is shown in SEQ ID NO.8.

[0034] The product of the susceptible ear germination allele amplified by this sequence is 492 bp, and the nucleotide sequence is shown in SEQ ID NO.9.

[0035] The primers were applied to the ear sprout-resistant varieties Nipponbare and the ear sprout-susceptible varieties Jiafuzhan, Gang 46B, II-32B, Guang 8B, Jing 4155S, Yexiang B and Taifeng B.

[0036] The specific steps are as follows: (1) Using Tiangen Plant Genome Extraction Kit to extract genomic DNA of the above varieties; (2) Use the extracted genomic DNA as a template for PCR amplification. The PCR reaction system is 20 μL, containing 2.0 μL 10× buffer, 0.3 μL 10 mM dNTP, 2.0 μL 25 mM Mg 2+ , 2.0 μL 4 μM forward and reverse primers (SEQ ID NO.6 and SEQ ID NO.7), 0.25 μL 4U / μL Taq enzyme, 2.0 μL 20 ng / μL template DNA, 11.45 μL ultrapure water. The PCR reaction program was: 94℃ pre-denaturation for 5 minutes, then 33 cycles of 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, and finally 72℃ extension for 10 minutes.

[0037] (3) Take 5 μL of the amplified product and load it onto a 1% agarose gel. Perform electrophoresis for 20 minutes and take a photo to preserve the electrophoresis results.

[0038] The results are as follows Figure 3 As shown, the amplification product of the ear sprout-resistant variety Nipponbare is 406bp; while the amplification product of the ear sprout-susceptible varieties Jiafuzhan, Gang 46B, II-32B, Guang 8B, Jing 4155S, Yexiang B and Taifeng B is 492bp, indicating that the molecular marker ZIRDR4 can be used to distinguish between resistant and susceptible varieties, and can be used as a marker for prospect selection to introduce the Nipponbare ear sprout-resistant allele into the susceptible ear sprout varieties.

[0039] Example 3: Using molecular marker-assisted selection technology to select rice anti-ear sprouting gene OsRDR4 Introduced into the sensitive heading germination variety Gang 46B The donor parent Nipponbare and Oka 46B were crossed once, backcrossed four times, and selfed once. The molecular marker ZIRDR4 was used for auxiliary selection in backcrossing and selfing, and finally a strain with anti-ear sprouting was obtained. OsRDR4 The specific steps are as follows: (1) Hybridize Nipponbare and Oka 46B to obtain F 1 seed; (2) Planting F 1 After heading, it was backcrossed with the recurrent parent Gang 46B to obtain BC 1 F 1 seed; (3) Planting BC 1 F 1 In the seedling stage, molecular marker ZIRDR4 was used to screen OsRDR4 After heading, select the recurrent parent Gang 46B and backcross it with Gang 46B to obtain BC 2 F 1 seed; (4) In BC 2 F 1 To BC 4 F 1 , the method in step (3) was used to screen OsRDR4 The individual plants were backcrossed with Gang 46B until BC was harvested. 4 F 2 ; (5) Planting BC 4 F 2 , using molecular marker ZIRDR4 to screen for OsRDR4 When mature, fresh rice ears are taken for identification of ear germination resistance (the specific steps are the same as step (3) of Example 1).

[0040] The results are as follows Figure 4 As shown, the ear germination rate of the ear germination-resistant near-isogenic line Gang 46B was significantly lower than that of the susceptible ear germination variety (Gang 46B) observed in Zhangzhou in 2024.

[0041] Example 4: Using molecular marker-assisted selection technology to select rice anti-ear sprouting gene OsRDR4 Introduced into the sensitive ear sprout variety II-32B The donor parent, Nipponbare, and II-32B, the recurrent parent, were hybridized once, backcrossed five times, and selfed once. The molecular marker ZIRDR4 was used for auxiliary selection in backcrossing and selfing, and finally a strain with anti-ear sprouting was obtained. OsRDR4 The specific steps are as follows: (1) Hybridizing Nipponbare and II-32B to obtain F 1 seed; (2) Planting F 1 , after heading, it was backcrossed with the recurrent parent II-32B to obtain BC 1 F 1 seed; (3) Planting BC 1 F 1 In the seedling stage, molecular marker ZIRDR4 was used to screen OsRDR4 After heading, select the recurrent parent II-32B and backcross with II-32B to obtain BC 2 F 1 seed; (4) In BC 2 F 1 To BC 5 F 1 , the method in step (3) was used to screen OsRDR4 The individual plants were backcrossed with II-32B until BC was harvested. 5 F 2 ; (5) Planting BC 4 F 2 , using molecular marker ZIRDR4 to screen for OsRDR4 When mature, fresh rice ears are taken for identification of ear germination resistance (the specific steps are the same as step (3) of Example 1).

[0042] The results are as follows Figure 5 As shown, the ear germination rate of the II-32B ear germination-resistant near-isogenic line was significantly lower than that of the susceptible ear germination variety (II-32B) observed in Zhangzhou in 2024.

[0043] The above is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent change made to the above embodiment according to the technical essence of the invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. OsRDR4 The application of genes in regulating the germination of fresh seeds of plants is characterized by: Said OsRDR4 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The plant is wheat, rice or Arabidopsis thaliana.

3. The use according to claim 1, characterized in that: Missing OsRDR4 The gene improves the germination level of fresh rice seeds and reduces germination resistance.

4. A primer pair for identifying InDel markers for rice panicle sprouting resistance / susceptibility, characterized in that: The nucleotide sequence of the primer pair is: ZIRDR4-F: 5'-CGTGATCAGATCCAGTGCAG-3'; ZIRDR4-R: 5'-TGCAAGCAATCTGAGCCATCC -3'.

5. A kit for identifying rice panicle sprouting resistance / susceptibility, characterized in that: The kit comprises the primer pair according to claim 4.

6. Use of the InDel-labeled primer pair according to claim 4 or the kit according to claim 5 in auxiliary breeding for rice anti-ear sprouting trait.

7. The use according to claim 6, characterized in that: The steps include: (1) extracting genomic DNA of rice to be tested; (2) Using genomic DNA as a template, PCR amplification was performed on the genomic DNA using the ZIRDR4-F / R primer pair, and rice panicle germination resistance / susceptibility analysis was performed based on the agar gel electrophoresis results; the nucleotide sequence of the primer pair was: ZIRDR4-F: 5'-CGTGATCAGATCCAGTGCAG-3'; ZIRDR4-R: 5'-TGCAAGCAATCTGAGCCATCC -3.

8. The use according to claim 7, characterized in that: When the agar gel electrophoresis result is 406 bp, it indicates that the tested rice carries OsRDR4 Gene Nipponbare allele type; when the agar gel electrophoresis result is 492bp, it means that the tested rice does not carry OsRDR4 Gene Nipponbare allele type.

Images