Detection kit for detecting ractopamine based on IPCR and detection method thereof

Abstract

The invention discloses a detection kit for detecting ractopamine based on IPCR and a detection method thereof, an anti-RAC polyclonal antibody is obtained through animal immunization, and an RAC direct competition ELISA method is established on the basis of the anti-RAC polyclonal antibody; according to the invention, a biotin-labeled polyclonal antibody is prepared by using an N-hydroxysuccinimide active esterification method, and an indirect competitive real-time fluorescence immune PCR method is established by combining a biotin-avidin system; therefore, signal amplification is realized, false positive is effectively controlled, and detection specificity and sensitivity are greatly improved. The method has good recovery rate and good precision when being used for detecting an actual sample.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a detection kit for detecting ractopamine based on IPCR and a detection method thereof. Background Art

[0002] Ractopamine (RAC) is an animal feed additive that can increase the lean meat conversion rate of edible animals. After long-term or large-scale feeding, the residues in the animal's body will accumulate in the human body through the food chain, threatening human health.

[0003] At present, the detection technology of RAC residues is mainly based on chromatography. Turberg et al. first used liquid chromatography to detect ractopamine residues in animal feed, with a detection limit of 1.25 μg / mL. Dong et al. established an ultra-high performance liquid chromatography tandem mass spectrometry (UHPLC-ESI-MS / MS) method for the determination of ractopamine residues in pig tissues. After the sample was hydrolyzed overnight, it was extracted with ethyl acetate and purified by solid phase extraction. The average recovery rate was 93.3%-106.5%, and the minimum detection limit and quantification limit were 0.2 μg / kg and 0.5 μg / kg. This highly sensitive method was applied to the study of RAC loss.

[0004] In order to improve the sensitivity of basic immunology, Sano et al. established an immune PCR system based on enzyme-linked adsorption in 1992. The principle of immune PCR is basically similar to that of traditional ELISA technology, except that a specific reporter DNA is used to replace the enzyme label on the antigen or antibody, and then the signal is amplified by molecular means. In theory, any antigen that can be specifically recognized by an antibody can be detected and analyzed using immune PCR technology. ImmunoPCR converts the detection of protein into the detection of nucleic acid. The entire reaction system mainly consists of two parts: the first part is the binding reaction between antigen and antibody; the second part is conventional PCR amplification and result detection, usually using agarose gel electrophoresis. Because immune PCR combines the advantages of antigen-antibody binding specificity of ELISA and rapid and high sensitivity of PCR amplification, compared with traditional ELISA, it can not only ensure the specificity of the reaction, but also increase the minimum detection limit by 10-1,000 times, and has a wide linear detection range of about 6 orders of magnitude. At the same time, the PCR result should be proportional to the antigen-antibody binding. If quantitative nucleic acid analysis technology is used, a suitable quantitative relationship can be established for quantitative testing of antigens. Due to its high sensitivity and excellent qualitative ability, IPCR is widely used in clinical medicine, biology, environmental chemistry and other fields. Since its proposal in 1992, immune PCR has undergone continuous improvements by many scholars and has transformed from a new research method to an increasingly mature laboratory technology, achieving a leap from protein analysis to nucleic acid analysis, especially in immunological research and clinical testing. Janet et al. used real-time IPCR to detect HIV core protein p24. The sensitivity of this method in detecting HIV virus reached 2 viral copies / mL, which is 25 times that of RT-PCR. Chao et al. used IPCR to detect botulinum toxin A (BoNT / A) and compared it with ELISA. The results showed that the minimum detection limit of ELISA was 5ng, while that of IPCR was 50fg. Its sensitivity was 10 times that of traditional ELISA. 4 -10 5 times.

[0005] The technologies currently used to detect ractopamine mainly include high performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), liquid chromatography-mass spectrometry (LC-MS) and ELISA. However, the use of large-scale precision instruments for detection requires huge one-time investment, is time-consuming, and requires training of operators. The most widely used ELISA rapid detection technology currently has a sensitivity of only ng / mL for the detection of residues such as β-stimulants. As an immune capture technology, immune PCR technology combines the high specificity of antibodies to antigens with the high sensitivity of PCR, and has a good correlation with the ELISA method. In theory, it has been proven that the detection limit of IPCR can generally reach the level of fg / mL, which is 10 times that of the traditional ELISA method. 2 times, and has broad application prospects. As a new technology that has developed rapidly in the past decade, immune PCR has shown its great advantages in simplicity, speed and sensitivity compared to traditional large-scale instruments or ELISA methods. In particular, after using fluorescent quantitative PCR technology as a detection method, the entire detection process can be monitored in real time, and the relationship between the standard and the Ct value can be quantitatively analyzed. Despite this, there are still problems that need to be solved in its technology. First of all, the reaction steps of the Bio-SA system are cumbersome, and shortening the reaction time as much as possible should be a focus of the next study. Secondly, the application of LAMP technology in immune PCR is a good qualitative analysis method, which can not only get rid of the dependence on instruments, but also has high sensitivity. As a new method with high sensitivity and strong specificity, immune PCR technology will continue to be optimized and developed with the development of molecular biology. This technology will be more widely used in various fields.

[0006] The market needs a detection method with high specificity and high sensitivity, which overcomes the disadvantages of high detection cost and dependence on large instruments. The present invention solves such problems. The present invention obtains anti-RAC polyclonal antibodies through animal immunization, and establishes a RAC direct competitive ELISA method on this basis. At the same time, the biotin-labeled polyclonal antibody is prepared by the N-hydroxysuccinimide active esterification method, and an indirect competitive real-time fluorescent immuno-PCR method is established in combination with the biotin-avidin system. Summary of the invention

[0007] In order to solve the shortcomings of the prior art, the purpose of the present invention is to provide a detection kit and a detection method for detecting ractopamine based on IPCR. On the basis of the enzyme-linked immunosorbent assay, the present invention uses fluorescent quantitative PCR as a signal detection means to establish a real-time quantitative immune PCR method for detecting RAC, which has high specificity, high sensitivity, low detection cost, convenient detection, and does not rely on large instruments.

[0008] In order to achieve the above object, the present invention adopts the following technical solution:

[0009] The invention discloses a detection kit for detecting ractopamine based on IPCR, comprising: a reaction system as follows: coating a PCR tube with a RAC-BSA polyclonal antibody, adding Bio-pAbs for reaction, using streptavidin SA as a bridge to respectively connect a biotin-labeled antibody and a DNA, adding Bio-DNA, and finally washing with PBST and ddH2O respectively; the RAC-BSA polyclonal antibody is used to prepare a ractopamine hapten by a polyanhydride method, and then the hapten BSA is coupled with a carrier protein OVA by a mixed anhydride method, and the serum is separated and purified by immunizing New Zealand white rabbits to obtain the RAC-BSA polyclonal antibody.

[0010] The aforementioned IPCR-based detection kit for ractopamine comprises: the reaction system is as follows: PCR tubes are coated with 2ug / mL RAC-BSA polyclonal antibodies, 0.326ug / mL Bio-pAbs is added for reaction, 2.57μg / mL streptavidin SA is used as a bridge to connect the biotin-labeled antibody and DNA respectively, Bio-DNA with a working concentration of 1:6400 and a mass of 0.35ng is added, and finally washed with PBST and ddH2O for 5 times respectively; the RAC-BSA polyclonal antibody is prepared by the polyanhydride method for ractopamine hapten, and then the hapten BSA is coupled with the carrier protein OVA by the mixed anhydride method, and the serum is separated and purified by immunizing New Zealand white rabbits to obtain the RAC-BSA polyclonal antibody.

[0011] The detection method of ractopamine based on IPCR includes the following steps:

[0012] Step 1, first synthesizing the ractopamine hapten, then preparing the immunogen RAC-BSA by a mixed anhydride method, and finally synthesizing the ractopamine coated antigen; the ractopamine hapten is RAC-glutaric anhydride semialdehyde;

[0013] Step 2, by immunizing New Zealand white rabbits, separating and purifying the serum to obtain RAC-BSA polyclonal antibodies;

[0014] Step 3, establish the RAC direct competition ELISA method;

[0015] Step 4, establishing an indirect competitive rt-IPCR method based on anti-RAC polyclonal antibodies;

[0016] A 209 bp fragment in the pGEM-3Z Vector: GenBank accession number: X65304.3 plasmid was selected, and PCR primers were designed using Primer premier 5.0 and Beacon Designer 7.9, respectively, to prepare biotin-labeled reporter DNA (Bio-DNA) and qPCR primer probes;

[0017] Using pGEM-3Z Vector plasmid DNA as a template, biotin-reporter DNA (Bio-DNA) was prepared by PCR amplification with biotin-labeled upstream primers;

[0018] Biotin-RAC polyclonal antibody (Bio-anti RAC pAb) was prepared by coupling biotin and polyclonal antibody using N-hydroxysuccinimide active esterification method (NHS);

[0019] Step 5, optimizing rt-IPCR conditions, wherein the rt-IPCR conditions include: optimizing SA concentration, optimizing tube washing times, optimizing Bio-DNA addition amount, and selecting the optimal working concentrations of RAC-BSA and Bio-anti RAC pAb;

[0020] Step six, establish the rt-IPCR system and standard curve.

[0021] The aforementioned IPCR-based detection method for ractopamine, step 1 is as follows:

[0022] First synthesize ractopamine hapten:

[0023] Weigh ractopamine hydrochloride, add it into a glutaric anhydride solution dissolved in pyridine three times, and stir at room temperature; then blow dry with high-purity nitrogen at room temperature to remove pyridine, and obtain ractopamine hapten RAC-glutaric anhydride semialdehyde;

[0024] The immunogen RAC-BSA was prepared by the mixed anhydride method: a solvent was added to the synthesized ractopamine hapten, i.e., RAC-glutaric anhydride semialdehyde, wherein the solvent was: DMF and 1,4-dioxane were pre-mixed in a volume ratio of 1:1, dissolved into a solution, pre-cooled on ice, and tributylamine pre-cooled on ice was added, and stirred in an ice bath for reaction; isobutyl chloroformate was added to the reaction solution, and the reaction was stirred at room temperature, and the activated ractopamine was added dropwise to the sodium borate solution containing BSA, and the reaction was stirred overnight; the solution was dialyzed and then used for later use;

[0025] Finally, the ractopamine-coated antigen is synthesized: a solvent is added to the synthesized ractopamine hapten, i.e., RAC-glutaric anhydride semialdehyde, wherein the solvent is DMF and 1,4-dioxane pre-mixed in a volume ratio of 1:1, dissolved into a solution, pre-cooled on ice, and tributylamine pre-cooled on ice is added, and the reaction is stirred; after adding isobutyl chloroformate to the reaction solution, the reaction is transferred to room temperature and stirred, and the activated ractopamine is added dropwise to the sodium borate solution containing OVA and stirred; the solution is dialyzed and set aside.

[0026] The aforementioned IPCR-based ractopamine detection method, step 3, specific steps for establishing the RAC direct competitive ELISA method:

[0027] 1. Synthesize horseradish peroxidase (HRP) labeled RAC-HRP by mixed anhydride method: add HRP to deionized water, adjust pH with NaOH, and detoxify with nitrogen; add an aqueous solution of 1,4-butylene glycol, and incubate the mixture at room temperature under nitrogen; remove excess 1,4-butylene glycol by Sephadex G25, and purify activated HRP; add ractopamine to the activated HRP, and then add N,N-dimethylformamide to dissolve it completely; adjust pH, detoxify the solution with nitrogen, incubate the mixture at room temperature under nitrogen, and dialyze for later use;

[0028] 2. Establish a standard curve:

[0029] Dilute the ractopamine standard with PBS and calculate the binding rate according to formula (1-1), where B and B0 are the OD values ​​measured when the standard is added and the RAC concentration is 0, respectively. 450nm The RAC concentration corresponding to the 50% inhibition rate in the standard curve is the half inhibition concentration (IC 50 ), the standard concentration with an inhibition rate of 10% was defined as IC 10 value;

[0030] Binding rate (%) = B / B0 × 100%

[0031] Inhibition rate (%) = (1-B / B0) × 100% (1-1)

[0032] 3. Sample addition recovery experiment:

[0033] Dilute the RAC solution with a blank pig urine sample and take the supernatant for ELISA detection; calculate the spike recovery rate according to formula (1-2):

[0034] Recovery rate (%) = measured sample concentration / added sample concentration × 100% (1-2)

[0035] The aforementioned detection method for detecting ractopamine based on IPCR, step 4, the specific steps of establishing an indirect competitive rt-IPCR method based on anti-RAC polyclonal antibodies include:

[0036] 1. Design PCR primers, prepare biotin-labeled reporter DNA (Bio-DNA) and qPCR primer probes:

[0037] PCR primer 3Z SET-15F3: Biotin-GTAACGCCAGGGTTTTCC SEQ ID No: 01;

[0038] PCR primer 3Z SET-15B3: GCGGATAACAATTTCACACAG SEQ ID No: 02;

[0039] Fluorescence quantitative PCR primer 3Z FP: GCTTGAGTATTCTATAGTGTC SEQ ID No: 03;

[0040] Fluorescence quantitative PCR primer 3Z RP: AGCGGATAACAATTTCAC SEQ ID No: 04;

[0041] Fluorescence quantitative PCR primer Probe-FAM: CAGCTATGACCATGATTACGCCAAG SEQ ID No: 05;

[0042] 2. Preparation of Biotin-Reporter DNA (Bio-DNA):

[0043] Using pGEM-3Z Vector plasmid DNA as a template, PCR amplification was performed with biotin-labeled upstream primers to prepare Bio-DNA. After the amplification results were detected by electrophoresis, the target band was cut out under ultraviolet light and recovered according to the instructions of the gel recovery kit; the absorbance of DNA at OD260nm and OD280nm was measured, and the Bio-DNA concentration was calculated using formula (1-3):

[0044] Bio-DNA concentration (ng / uL) = OD260 × dilution factor × 40 (1-3);

[0045] 3. Preparation of biotin-RAC polyclonal antibody (Bio-anti RAC pAb):

[0046] Antibody preparation: RAC polyclonal antibody (anti-RAC pAb) was dialyzed with 0.1 M CB buffer at 4°C for 24 h, with the buffer changed every 8 h on average; the antibody concentration and CB buffer volume were recorded;

[0047] Activation of NHS-D-Biotin: Dissolve NHS-D-Biotin in DMSO to a final concentration of 22 mg / mL. Make sure to use it immediately and store it away from light.

[0048] Depending on the antibody concentration, the activated NHS-D-Biotin was diluted to a molar ratio of antibody to NHS-D-Biotin of 48:1, 24:1, or 12:1;

[0049] Antibody-biotin connection: Take 10% volume of activated NHS-D-Biotin from antibody solution (solution A) and slowly add it dropwise into solution CB while stirring gently;

[0050] After the addition, continue to stir gently at 25°C in the dark for 13 h;

[0051] Dialysis: The marker was dialyzed with 0.01M PBS buffer at 4°C for 72 h, with the buffer changed every 8 h on average;

[0052] Recover the dialysate, determine the antibody concentration according to formula (1-4), and store at -20°C for later use;

[0053] C (mg / mL) = [1.55×(A280-A320)-0.76×(A260-A320)]×n, where n is the dilution multiple (1-4).

[0054] In the aforementioned IPCR-based ractopamine detection method, step 5, the specific contents of rt-IPCR condition optimization include:

[0055] SA concentration optimization:

[0056] Select each dilution multiple to optimize the concentrations of Bio-anti RAC pAb and Bio-DNA; select the one with the smallest Ct value at the standard concentration of 0 ng / mL and the largest Ct value difference (ΔCt) between the standard concentrations of 1 ng / mL and 0 ng / mL;

[0057] Optimization of pipe washing times:

[0058] The discarded liquid containing Bio-DNA, the liquid washed 5 times with PBST solution and the liquid washed 5 times with ddH2O were recovered and subjected to PCR and rt-qPCR experiments;

[0059] Optimization of Bio-DNA addition amount:

[0060] Based on the known concentration of Bio-DNA, the optimized scheme of serial dilution was adopted, and the dilution ratios were 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, and 1:51200, respectively. The actual amount of Bio-DNA added was 1.41ng, 0.70ng, 0.35ng, ​​0.175ng, 0.0875ng, and 0.044ng.

[0061] Selection of optimal working concentrations of RAC-BSA and Bio-anti RAC pAb:

[0062] A checkerboard assay was performed in a 0.6% glutaraldehyde-treated PCR tube using 0.5, 1, and 2 ug / mL RAC-BSA and Bio-anti RAC pAb at dilutions of 1:500, 1:1000, 1:2000, and 1:4000, respectively, to determine the optimal working concentrations of the coating antigen and Bio-anti RAC pAb; the optimal antigen-antibody working concentration was selected with a smaller Ct value at a standard concentration of 0 ng / mL and a larger Ct value at a standard concentration of 1 ng / mL.

[0063] The specific contents of step 6 of the aforementioned IPCR-based ractopamine detection method, establishing the rt-IPCR system and the standard curve, include:

[0064] An indirect competitive rt-IPCR assay for ractopamine was established. The specific steps are as follows:

[0065] Coating: dilute RAC-BSA to the optimal working concentration with CB coating solution, add to the PCR tube pretreated with glutaraldehyde at the optimal concentration, overnight;

[0066] Blocking: Pour off the blocking solution in the tube, wash with PBST; add 1% skim milk sodium carbonate solution to block;

[0067] Indirect competition reaction: Pour off the blocking solution, wash with PBST, add the standard and Bio-anti RAC pAb diluted to the optimal working concentration, and incubate;

[0068] Bio-anti RAC pAb reacts with SA: Pour off the liquid in the tube, wash with PBST, and add SA diluted to the optimal working concentration for incubation;

[0069] SA and Bio-DNA reaction: Pour off the liquid and wash with PBST; add Bio-DNA diluted to the optimal working concentration of 1:6400 and incubate;

[0070] Detection: After discarding the liquid, wash with PBST and sterile ultrapure water respectively, add 20μL of fluorescent quantitative PCR reaction system: 2×SensiFAST Mix Probe Lo-ROX 10μL, 10μM FP 0.8μL, 10μM RP 0.8μL, 10μM Probe0.2μL, ddH2O 8.2μL, and amplify; the reaction program is: 95℃120s, 95℃10s, 60℃26s, Go to Step2and Repeat 39×;

[0071] The method for establishing the standard curve is:

[0072] Add 10-fold gradient dilution of RAC standard: 0, 0.001, 0.01, 0.1, 1, 10, 100 ng / mL, add 20 μL of fluorescent quantitative PCR reaction system: 2×SensiFAST Mix Probe Lo-ROX 10 μL, 10 μM FP 0.8 μL, 10 μM RP0.8 μL, 10 μM Probe 0.2 μL, ddH2O 8.2 μL, use Taq man probe method for amplification, collect fluorescence curve; establish standard curve with logarithm of ractopamine standard concentration as horizontal axis and Ct value as vertical axis; determine the linear range of rt-IPCR through standard curve; and calculate 50% inhibition rate IC according to standard curve. 50 Value; IC 50 The value is defined as the RAC concentration corresponding to the average of the Ct value of the 0 ng / mL standard and the Ct value of the 100 ng / mL standard; at the same time, the Ct values ​​of 8 wells with a concentration of 0 ng / mL were continuously measured, and the standard curve was used to calculate the average value and standard deviation. Combined with the obtained linear equation, the minimum detection limit (LOD) was determined according to formula (1-5);

[0073] The lowest limit of detection (LOD) = the mean value of negative sample detection + 3 times the standard deviation (SD) (1-5).

[0074] The present invention is beneficial in that:

[0075] The pGEM-3Z of the present invention is an artificially synthesized cloning vector, so homologous gene fragments do not appear in the enzyme labeling reaction system, effectively controlling the occurrence of false positives;

[0076] The present invention uses pGEM-3Z plasmid as a template, utilizes biotin to label the 5' upstream primer, amplifies a biotinylated DNA containing 209 bp, and successfully prepares high-purity Bio-DNA; uses N-hydroxysuccinimide active esterification method (NHS) to label ractopamine polyclonal antibody; combines the biotinylated reporter DNA with the antibody based on the biotin-avidin coupling system, thereby establishing an rt-IPCR method for detecting ractopamine; it has been verified that the titer of Bio-pAbs is significantly reduced after coupling;

[0077] The present invention optimizes the main factors of rt-IPCR, mainly including the optimization of SA concentration, the number of plate washes, the amount of Bio-DNA added and the optimal working concentration of antigen and antibody; these optimizations achieve synergy in improving the detection specificity, and the LOD is two orders of magnitude higher than the competitive ELISA method; the specificity detection results show that the RAC-polyclonal antibody has a high specificity for RAC and has no cross-reaction with other 16 β-receptor agonist substances (CR < 0.018%). The addition recovery results show that after adding 0.25-1.0ng / mL RAC standard, the recovery rate is in the range of 80-120%, indicating that the method has a good recovery rate when used to detect actual samples. The repeatability experimental results show that the intra-plate and inter-batch coefficients of variation are both less than 10%, and the precision is good.

[0078] The sensitivity of the indirect competitive rt-IPCR method constructed based on the optimized conditions is increased by 10 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] Figure 1 Schematic diagram of the synthesis route of the present invention: (a) Ractopamine hapten synthesis route; (b) RAC-glutaric anhydride semialdehyde reacts with isobutyl chloroformate to synthesize mixed anhydride; (c) Mixed anhydride is coupled with BSA;

[0080] Figure 2 Schematic diagram of the standard curve of the present invention: (a) 0-50 ng / mL inhibition curve; (b) 0-5 ng / mL standard curve;

[0081] Figure 3The schematic diagram of the experimental results of the present invention is (a) the results of real-time fluorescent immuno-PCR with different concentrations of avidin; (b) optimization of the number of plate washes (ordinary PCR); Washing waste: waste liquid containing Bio-DNA; PBST1-PBST5: PBST washing solution washed 5 times; ddH2O 1-dd H2O 5: liquid washed 5 times with ddH2O; DNA209: Bio-DNA after immuno-PCR; (c) optimization of the number of plate washes (rt-PCR); (d) amplification curves of Bio-DNA with different concentrations; (e) analysis diagram of Bio-DNA concentration and coefficient of variation; (f) ractopamine rt-IPCR concentration curve; (g) rt-IPCR standard curve. DETAILED DESCRIPTION

[0082] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0083] The detection effect of the present invention is verified by the following experiments:

[0084] 1. Materials and Methods

[0085] 1.1 Synthesis of ractopamine hapten, immunogen and coating antigen

[0086] Weigh 68 mg of ractopamine hydrochloride and add it to 24 mg of glutaric anhydride solution dissolved in 4 mL of pyridine in three portions, and stir the reaction at room temperature (22-25°C) for 18-24 hours. Then use high-purity nitrogen to blow dry at room temperature to remove pyridine to obtain ractopamine hapten (RAC-glutaric anhydride semialdehyde). Its synthesis route is shown in Figure 1 (a).

[0087] The immunogen RAC-BSA was prepared by the mixed anhydride method. 8 mL of solvent (DMF and 1,4-dioxane were pre-mixed in a volume ratio of 1:1) was added to the above-synthesized ractopamine hapten (RAC-glutaric anhydride semialdehyde) to dissolve into a 0.1 mmol solution, which was pre-cooled on ice for 0.5 hours, and then 52.4 μL of tributylamine pre-cooled on ice was added, and the reaction was stirred in an ice bath for 10 minutes; 28.8 μL of isobutyl chloroformate was added to the reaction solution, and the reaction was stirred at room temperature for 4 hours. The activated ractopamine was added dropwise to 10 mL of 200 mg BSA in a 20 mg / mL sodium borate solution at pH 8.5, and the addition was completed within 1 hour, with stirring, and the reaction was carried out in an ice bath; then the reaction was stirred at room temperature overnight, and the pH value of the reaction system was monitored from time to time during the entire reaction process. If necessary, 0.1 M NaOH was used to adjust the pH to 8.5. After the reaction is completed, the product is placed in a dialysis bag and dialyzed with distilled water at 4°C for 1 day, and then with 0.01M pH 7.4 PBS at 4°C for 3 days. The solution is changed twice a day, and finally the product is aliquoted and stored in a refrigerator at -20°C for future use. The synthetic route is shown in Figure 1 (b) and (c).

[0088] The synthesis method of ractopamine coated antigen is the same as that of synthesizing immunogen RAC-BSA. Replace the 20mg / mL BSA sodium borate solution with the same concentration of OVA sodium borate solution. After the reaction is completed, dialyze with distilled water and 0.01M PBS at 4℃, respectively, and finally store in a -20℃ refrigerator for later use.

[0089] 1.2 Preparation of RAC rabbit polyclonal antibody

[0090] Six healthy male New Zealand white rabbits (weight 2.0-2.5kg) were selected, raised and observed for 1 week, and blood was collected from the posterior ear vein as a negative control. Three rabbits (BSA-RAC1 number: R1, R2, R3; BSA-RAC2 number: R4, R5, R6) were immunized with the above-mentioned immunogens (ractopamine hapten and BSA conjugates: BSA-RAC1 and BSA-RAC2). According to the weight of the rabbit, the basic immunization was carried out at a dose of 1.0 mg / kg, RAC-BSA was diluted with normal saline, and an equal volume of Freund's complete adjuvant was added for emulsification, and the rabbit was injected subcutaneously at 5 points on the back. After 2 weeks, the complete adjuvant was replaced with an incomplete adjuvant for booster immunization. Immunization was then performed every 4 weeks. After 6 immunizations, immunization was performed every 2 weeks.

[0091] 1.3 Establishment of RAC direct competitive ELISA method

[0092] 1.3.1 Preparation of RAC enzyme marker

[0093] RAC-HRP labeled with horseradish peroxidase (HRP) was synthesized by the mixed anhydride method, and the specific steps were as follows: 20 mg of HRP was accurately weighed in 0.5 mL of deionized water, the pH was adjusted to 10.8 with 0.5 M NaOH, and detoxified with nitrogen; 50 μL of a 5 μmol 1,4-butylene glycol aqueous solution was added, and the mixture was incubated at room temperature under nitrogen for 20 h; excess 1,4-butylene glycol was removed by Sephadex G25 to purify and activate HRP; 5 mg of ractopamine was added to the activated HRP, and 200 μL of N,N-dimethylformamide was added to dissolve it completely; the pH was adjusted to 10.8, the solution was detoxified with nitrogen, and the mixture was incubated at room temperature under nitrogen for 40 h;

[0094] The cells were dialyzed in PBS solution for 4 days, with the solution changed twice a day. An equal volume of glycerol was added to the dialyzed solution, the solution was mixed by pipetting, and stored at -20°C for later use.

[0095] 1.3.2 Establishment of standard curve

[0096] Add different concentrations of RAC standard to compete with RAC-HRP for binding to the antibody coated on the bottom of the microwell. Dilute the ractopamine standard (100 mg / mL) with PBS to the following concentrations: 50 ng / mL, 20 ng / mL, 10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1.25 ng / mL, 0.6 ng / mL, 0.3 ng / mL, 0.15 ng / mL, 0 ng / mL. Calculate the binding rate according to formula (1-1), where B and B0 are the OD values ​​measured when the standard is added and the RAC concentration is 0, respectively. 450nm The RAC concentration corresponding to the 50% inhibition rate in the standard curve is the half inhibition concentration (IC 50 ), the standard concentration with an inhibition rate of 10% was defined as IC 10 value.

[0097] Binding rate (%) = B / B0 × 100%

[0098] Inhibition rate (%) = (1-B / B0) × 100% (1-1)

[0099] 1.3.3 Sample addition recovery experiment

[0100] The pretreatment method of the swine urine sample was combined with the actual situation and referred to the Announcement No. 1486 of the Ministry of Agriculture and Rural Affairs. The blank swine urine sample was diluted with a 10 μg / mL RAC solution and centrifuged at 5000 r / min for 10 min to obtain a spiked sample with a final RAC concentration of 0.25-1 μg / mL. The supernatant was used for ELISA detection. Each concentration was repeated 3 times, and the average concentration of ractopamine in the 3 replicates was used to calculate the spiked recovery rate according to formula (1-2).

[0101] Recovery rate (%) = sample measured concentration / sample added concentration × 100% (1-2)

[0102] 1.4 Establishment of indirect competitive rt-IPCR method based on anti-RAC polyclonal antibody

[0103] 1.4.1 Primer and probe design

[0104] This study selected a 209 bp fragment in the pGEM-3Z Vector (GenBank accession number: X65304.3). Primer premier 5.0 and Beacon Designer 7.9 were used to design PCR primers (to prepare biotin-labeled reporter DNA) and qPCR primer probes (established by rt-IPCR method), respectively, as shown in Table 1.

[0105] Table 1 Primer probe sequences

[0106]

[0107] 1.4.2 Preparation of biotin-reporter DNA (Bio-DNA)

[0108] Using pGEM-3Z Vector plasmid DNA as a template, PCR amplification was performed with biotin-labeled upstream primers to prepare Bio-DNA. After the amplification results were detected by electrophoresis, the target band was cut out under ultraviolet light and recovered according to the instructions of the gel recovery kit. The absorbance values ​​of DNA at OD260nm and OD280nm were measured, and the Bio-DNA concentration was calculated using formula (1-3).

[0109] Bio-DNA concentration (ng / uL) = OD260 × dilution factor × 40 (1-3)

[0110] 1.4.3 Preparation of Biotin-RAC polyclonal antibody (Bio-anti RAC pAb)

[0111] Biotin and polyclonal antibodies were coupled using N-hydroxysuccinimide active esterification method (NHS). The specific steps are as follows:

[0112] (1) Antibody preparation: RAC polyclonal antibody (anti-RAC pAb) was dialyzed against 0.1 M CB buffer at 4°C for 24 h, with the buffer changed every 8 h on average; the antibody concentration and CB buffer volume were recorded;

[0113] (2) Activation of NHS-D-Biotin: Dissolve NHS-D-Biotin in DMSO to a final concentration of 22 mg / mL. Make sure to use it immediately and store it away from light.

[0114] (3) Diluting activated NHS-D-Biotin to a molar ratio of antibody to NHS-D-Biotin of 48:1, 24:1, or 12:1 according to the antibody concentration;

[0115] (4) Antibody-biotin connection: Take 10% volume of activated NHS-D-Biotin in the antibody solution (solution A) and slowly add it dropwise into the CB solution while gently stirring;

[0116] (5) After the addition, continue stirring gently at 25°C in the dark for 13 h;

[0117] (6) Dialysis: The marker was dialyzed with 0.01 M PBS buffer at 4°C for 72 h, with the buffer changed every 8 h on average;

[0118] (7) Recover the dialysate, determine the antibody concentration according to formula (1-4), and store it at -20°C for future use.

[0119] C (mg / mL) = [1.55 × (A280-A320)-0.76 × (A260-A320)] × n, n is the dilution factor (1-4)

[0120] 1.5 Optimization of rt-IPCR conditions

[0121] 1.5.1 SA concentration optimization

[0122] SA is used as a bridge to connect Bio-anti RAC pAb and Bio-DNA. Too high a concentration can easily cause nonspecific adsorption, resulting in a large experimental background value, while too low a concentration can prevent Bio-anti RAC pAb from completely combining with Bio-DNA, thereby reducing the sensitivity of the reaction. Select different dilution multiples (1:1000, 1:2000, 1:4000, 1:8000, 0.37-3ug / mL) to optimize the concentrations of Bio-anti RAC pAb and Bio-DNA. The standard concentration of 0ng / mL has the smallest Ct value and the largest Ct value difference (ΔCt) between the standard concentrations of 1ng / mL and 0ng / mL is the best.

[0123] 1.5.2 Optimization of pipe washing times

[0124] Because the fluorescent quantitative PCR technology has a very high detection ability for DNA, any residual DNA will affect the experimental results. At the same time, although too many washes can ensure the complete removal of unbound DNA, it increases the possibility of human error and waste of resources. Therefore, the number of washes when cleaning Bio-DNA is optimized. The discarded liquid that may contain Bio-DNA, the liquid washed 5 times with PBST washing solution, and the liquid washed 5 times with ddH2O were recovered and subjected to PCR and rt-qPCR experiments.

[0125] 1.5.3 Optimization of Bio-DNA addition amount

[0126] In view of the results of 2.5.2, when Bio-DNA is diluted 1:1600 and added to the reaction system, a large amount of Bio-DNA will remain in the discarded liquid. Excessive Bio-DNA not only causes waste, but also may cause serious background signals during the washing process due to operational errors or non-specific binding of Bio-DNA itself to the bottom of the plate. Therefore, based on the known concentration of Bio-DNA, an optimized dilution scheme was adopted, using 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, and 1:51200 respectively (the actual amount of Bio-DNA added is: 1.41ng, 0.70ng, 0.35ng, ​​0.175ng, 0.0875ng, and 0.044ng).

[0127] 1.5.4Optimal working concentration selection of RAC-BSA and Bio-anti RAC pAb

[0128] The optimal working concentrations of the coated antigen and Bio-anti RAC pAb were determined by using a chessboard assay in a PCR tube treated with 0.6% glutaraldehyde at 0.5, 1, and 2ug / mL RAC-BSA and Bio-anti RAC pAb at dilutions of 1:500, 1:1000, 1:2000, and 1:4000. The Ct value of the standard concentration of 0ng / mL was as small as possible, and the Ct value of the standard concentration of 1ng / mL was as large as possible, which was determined as the optimal working concentration of the antigen and antibody.

[0129] 1.6 rt-IPCR system and standard curve establishment

[0130] 1.6.1 Establishment of rt-IPCR system

[0131] An indirect competitive rt-IPCR assay for ractopamine was established. The specific steps are as follows:

[0132] (1) Coating: Dilute RAC-BSA to the optimal working concentration with CB coating solution, add to PCR tubes pretreated with glutaraldehyde at the optimal concentration, 50 μL / tube, and incubate at 4°C overnight;

[0133] (2) Blocking: Pour off the blocking solution in the tube, wash once with PBST, add 1% skim milk sodium carbonate solution for blocking, 200 μL / tube, and block at 37°C for 1 h;

[0134] (3) Indirect competition reaction: Pour off the blocking solution, wash three times with PBST, add a certain concentration of standard and Bio-anti RAC pAb diluted to the optimal working concentration, 50 μL / tube, and incubate at 37°C for 1 h;

[0135] (4) Reaction of Bio-anti RAC pAb with SA: Pour off the liquid in the tube, wash three times with PBST, add SA diluted to the optimal working concentration, 50 μL / tube, and incubate at 37°C for 1 h;

[0136] (5) SA and Bio-DNA reaction: After discarding the liquid, wash with PBST three times; add Bio-DNA diluted to the optimal working concentration of 1:6400, 50 μL / tube, and incubate at 37°C for 1 h;

[0137] (6) Detection: After discarding the liquid, wash with PBST and sterile ultrapure water for 5 times, add the fluorescent quantitative PCR reaction system as shown in Table 2, and perform amplification. The reaction procedure is shown in Table 3.

[0138] Table 2 Fluorescence quantitative PCR reaction system (20 μL)

[0139]

[0140] Table 3 Fluorescence quantitative PCR reaction procedure

[0141]

[0142]

[0143] 1.6.2rt-IPCR standard curve and detection sensitivity

[0144] Add 10-fold gradient dilution of RAC standard (0, 0.001, 0.01, 0.1, 1, 10, 100 ng / mL), add to the fluorescence quantitative PCR reaction system (Table 2), use Taq man probe method for amplification, and collect fluorescence curves. Use the logarithm of ractopamine standard concentration as the horizontal axis and the Ct value as the vertical axis to establish a standard curve. Determine the linear range of rt-IPCR through the standard curve; and calculate the 50% inhibition rate IC according to the standard curve. 50 In this study, IC 50 The value is defined as the RAC concentration corresponding to the average of the Ct value of the 0 ng / mL standard and the Ct value of the 100 ng / mL standard. At the same time, the Ct values ​​of 8 wells with a concentration of 0 ng / mL were continuously measured, and the standard curve was used to calculate the average value and standard deviation. Combined with the obtained linear equation, the minimum detection limit (LOD) was determined according to formula (1-5).

[0145] Limit of detection (LOD) = mean value of negative sample detection + 3 times standard deviation (SD) (1-5)

[0146] 1.7 Specificity experiments

[0147] In order to identify the specificity of the rt-IPCR detection method, the IC values ​​of ractopamine (RAC), clenbuterol (CLE), salbutamol (SAL), bambuterol (BAM), cimaterol (CIM), cibuterol (CIB), clorprenaline (CLO), fenoterol (FEN), formoterol (FOR), mabuterol (MAB), mapenterol (MAP), penbutolol (PEN), terbutalin (TER), tulobuterol (TUL), zilpaterol (ZIL) and 15 other β-adrenergic receptor agonists including phenylethanolamine A were measured. 50 The cross-reaction rate of ractopamine is set to 100%, and the cross-reaction rate (CR) of other β-adrenergic receptor agonists is calculated according to formula (1-6):

[0148] CR(%)=IC 50 (RAC) / IC 50 (Other competing binders)×100% (1-6)

[0149] 1.8.2 rt-IPCR actual sample detection

[0150] The six swine urine samples confirmed as negative by LC-MS / MS were pre-treated according to 2.3.3 and measured by the rt-IPCR established above. The spike recovery rate was calculated based on the measured value and the actual added sample concentration. Each sample and each concentration were repeated three times, and the average value was used as the spike recovery value.

[0151] 1.8.3 Repeatability Experiment

[0152] The precision of the experimental method is determined by the coefficient of variation between plates (CV%). Add 0 ng / mL standard, randomly select a plate each time and repeat 10 times, for a total of 3 times. Calculate the Sd of the 0 value well and calculate the coefficient of variation between and within batches using formula (1-7). Where CV is the coefficient of variation, Sd is the standard deviation, is the average value of Ct value.

[0153]

[0154] 2. Experimental results

[0155] 2.1 RAC direct competition ELISA method

[0156] 2.1.1 Linear range

[0157] The results are as follows Figure 2 As shown in (a), when the concentration of the standard is 0-50 ng / mL, the linear regression equation of the curve is y=-0.3217x+0.735, R 2 =0.8536. The RAC concentration corresponding to the maximum absorption peak inhibition rate of 20-80% was determined as the linear range, and the results showed that its linear range was 0.15-5.0 ng / mL.

[0158] 2.1.2 Establishment of standard curve and determination of minimum detection limit

[0159] In the linear range determined above, direct competitive ELISA was performed with a standard concentration gradient of 5, 2.5, 1.25, 0.6, 0.3, 0.15, and 0 ng / mL, and a standard curve was drawn with the standard concentration as the horizontal axis and the binding rate as the vertical axis. The standard curve fitted according to the test results was y = -0.4752x + 1.0285, R 2 =0.9891, the results are shown in Figure 2 (b) Calculate the half inhibition rate IC according to the linear equation 50 =1.1±0.11ng / mL, IC 10 The value was 0.19±0.03ng / mL. The results showed that the concentration of RAC standard was in the range of 0.15-5ng / mL, and the standard curve had good linear correlation, which met the detection requirements.

[0160] 2.2rt-IPCR method

[0161] 2.2.1 Linear range and detection sensitivity

[0162] The 100 ng / mL RAC standard was diluted 10 times to 0.001 ng / mL, and a total of 6 concentration gradients were set. After indirect competition and fluorescence quantitative PCR reaction, a curve was drawn with Ct as the ordinate and the logarithm of the RAC standard concentration as the abscissa, as shown in the figure. Figure 3 (f) Calculate the 50% inhibition rate IC based on the concentration curve 50 The value was 0.18±0.03ng / mL, which was comparable to the competitive ELISA method (IC 50 =1.1 ng / mL, compared with 3.1.2), it is increased by about 1 order of magnitude.

[0163] Through the first-order equation fitting, the linear regression equation of the standard curve is y=0.3569x+15.02, R 2 =0.9724, such as Figure 3(g) The linear range of rt-IPCR was determined to be 0.001-100 ng / mL. Due to the limitation of the instrument and methodology in the enzyme labeling experiment, the linear range of the competitive ELISA method was about 10-0.01 ng / mL. Figure 2 (b) The detection linear range of rt-IPCR is 100-0.001 ng / mL, which is broadened by 1 order of magnitude compared with the competitive ELISA method.

[0164] 2.2.2 Minimum detection limit

[0165] A standard curve for immuno-PCR was established with a gradient of 0.001-100 ng / mL, such as Figure 2 As shown in (f), the detection sensitivity can reach 0.001 ng / mL. The standard deviation Sd=0.09 was calculated based on the Ct values ​​of 8 wells with a concentration of 0 ng / mL. After calculation, the minimum detection limit (LOD) was 0.0039 ng / mL. Compared with the indirect competitive ELISA (LOD=0.19 ng / mL, 3.1.2), the minimum detection limit was increased by about 2 orders of magnitude.

[0166] The results of this experiment showed that the ractopamine rt-IPCR standard curve established in this study had a good linear correlation in the range of 0.001-100 ng / mL. Compared with the competitive ELISA method, the detection sensitivity, linear range and minimum detection limit were improved by about 2 orders of magnitude, which could meet the detection requirements.

[0167] 3.3 Specificity

[0168] This study examined the IC values ​​of RAC and 15 other β-receptor agonists. 50 value. The specificity of the rt-IPCR method was evaluated by the cross-reaction rate of these competing substances. In the reaction, the concentration gradient of the RAC standard was 0, 0.001, 0.01, 0.1, 1, 10, 100 ng / mL; the concentration gradient of the other 16 competing substances was 0, 0.1, 1, 10, 100, 1000, 10000 ng / mL. As shown in Table 6, the cross-reaction rate of ractopamine is 100%, and the cross-reaction rates with other competing substances are less than 0.018%. The RAC rt-IPCR detection method established in this study has good specificity and can meet the detection requirements.

[0169] Table 6 Cross-reaction rate between RAC and other β-receptor agonists

[0170]

[0171]

[0172] 3.4 Accuracy Experiment

[0173] 0.25, 0.5, and 1.0 ng / mL RAC standard were added to 6 different batches of pig urine samples. The supernatant was taken after treatment according to Announcement No. 1486 of the Ministry of Agriculture and Rural Affairs, and rt-IPCR detection was performed. The results are shown in Table 7. The results showed that the average recovery rate was 86-115%, and the relative standard deviation was 1.56-3.7%, which were all within the acceptable range (80-120%, relative standard deviation less than 5%), proving that the IPCR method established in this study has good accuracy.

[0174] Table 7 Recovery of ractopamine in pig urine

[0175]

[0176]

[0177] Note: a: average value of 3 measurements.

[0178] 3.5 Precision experiment

[0179] The intra-plate and inter-batch coefficients of variation are shown in Table 8. The results showed that the intra-plate coefficient of variation (CV%) was within 3.5-4.5%, the average coefficient of variation was 3.89%, the inter-batch coefficient of variation (CV%) was 9.03%, and the CVs were all less than 10%, demonstrating good repeatability.

[0180] Table 8 rt-IPCR intra-plate and inter-batch coefficient of variation

[0181]

[0182] The present invention prepares ractopamine hapten (RAC-glutaric anhydride semialdehyde) by introducing carboxyl groups with the help of polyanhydride method, and then couples the hapten with carrier proteins (BSA and OVA) by mixed anhydride method to synthesize immunogen RAC-BSA and coating source RAC-OVA, respectively. New Zealand white rabbits were immunized by conventional methods to obtain polyclonal antibodies anti-RACpAb with good titer. RAC and HRP were connected by mixed anhydride method. The present invention established a direct competitive ELISA method for detecting RAC using RAC polyclonal antibodies and enzyme-labeled antigen (RAC-HRP). The IC of this method 50 The value was 1.1 ng / mL, and the minimum detection limit (IC 10 ) is 0.19ng / mL.

[0183] A direct competitive ELISA method was established using the enzyme-labeled antigen and polyclonal antibody to detect ractopamine residues. The results showed that this method IC 50The value was 1.1ng / mL, and the lowest detection limit (LOD) was 0.19ng / mL.Based on the enzyme-linked immunosorbent assay, this study used fluorescence quantitative PCR as a signal detection method to establish a real-time quantitative immuno-PCR method for detecting RAC.

[0184] Biotin-labeled DNA and biotinylated polyclonal antibodies were prepared by using the 5'-end biotin labeling method of PCR primers and the N-hydroxysuccinimide active esterification method, respectively. Using the pGEM-3Z plasmid as a template, a biotinylated DNA containing 209 bp was amplified using the biotin-labeled 5' upstream primer. Using the prepared polyclonal antibody as the object, the biotinylated antibody was prepared using the N-hydroxysuccinimide active esterification method. At the same time, the titer of the biotinylated antibody was determined and the IC 50 The value was 0.604ng / mL, and the minimum detection limit (IC 10 ) is 0.024ng / mL. Based on the biotin-avidin coupling system, the biotinylated reporter DNA was combined with the antibody to establish the rt-IPCR method for detecting ractopamine. The streptavidin and biotin system was used as the experimental basis to complete the signal amplification of the antigen-antibody binding.

[0185] The main parameters of the reaction, including the reaction carrier, the concentration of the labeled antibody and antigen, the concentration of avidin, the number of plate washes, the concentration of Bio-DNA and other factors, were optimized, and finally the rt-IPCR reaction system was established: 2ug / mL detection antigen was used for coating, 0.326ug / mL biotinylated antibody was added for reaction, and 2.57ug / mL avidin was selected to combine the biotin antibody with 0.35ng Bio-DNA, and finally PBST and ddH2O were used for washing 5 times respectively to remove the excess Bio-DNA. After testing, the minimum detection limit (LOD) of this method was 0.0039ng / mL, and the IC 50 =0.18ng / mL. Compared with the competitive ELISA method, it is improved by two orders of magnitude. In this method, the RAC-polyclonal antibody has a high specificity for RAC and has no cross-reaction with other 16 β-receptor agonist substances (CR < 0.018%). The results of the added recovery experiment showed that when the RAC concentration was 0.25-1.0ng / mL, the intra-plate recovery rate was 80-120%, and the intra-plate and inter-plate coefficient of variation (CV%) was less than 10%, indicating that this method has a good recovery rate when used to detect actual samples. The results of the repeatability experiment showed that the intra-plate and inter-batch coefficients of variation were both less than 10%, and the precision was good.

[0186] There are four biotin binding sites on an avidin molecule, so the Bio-SA system itself should have a multi-stage amplification function. When the biotin to antibody feed ratio is too large, the antibody binding antigen site may be occupied by excessive biotin. When biotin is insufficient, the biotinylated antibody concentration will be insufficient, and the avidin binding sites will decrease, resulting in a reduction in the amount of DNA that can be detected. Therefore, the sensitivity of the indirect competitive rt-IPCR method constructed based on the optimized conditions in this experiment has increased by 10 times.

[0187] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solution obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present invention.

Claims

1. A detection kit for detecting ractopamine based on IPCR, characterized in that: include: The reaction system is as follows: a PCR tube is coated with a RAC-BSA polyclonal antibody, Bio-pAbs is added for reaction, streptavidin SA is used as a bridge to connect the biotin-labeled antibody and DNA respectively, Bio-DNA is added, and finally washed with PBST and ddH2O respectively; the RAC-BSA polyclonal antibody is prepared by a polyanhydride method for ractopamine hapten, and then the hapten BSA is coupled with a carrier protein OVA by a mixed anhydride method, and the serum is separated and purified by immunizing New Zealand white rabbits to obtain the RAC-BSA polyclonal antibody.

2. The detection kit for detecting ractopamine based on IPCR according to claim 1, characterized in that: include: The reaction system is as follows: 2ug / mL detection antigen is used for coating, 0.326ug / mL Bio-pAbs is added for reaction, 2.57μg / mL (1:2000) streptavidin SA is used as a bridge to connect the biotin-labeled antibody and DNA, Bio-DNA with a working concentration of 1:6400 and a mass of 0.35ng is added, and finally washed with PBST and ddH2O for 5 times respectively; the RAC-BSA polyclonal antibody is prepared by the polyanhydride method for ractopamine hapten, and then the hapten BSA is coupled with the carrier protein OVA by the mixed anhydride method, and the serum is separated and purified by immunizing New Zealand white rabbits to obtain the RAC-BSA polyclonal antibody.

3. A method for detecting ractopamine based on IPCR, characterized in that: The steps include: Step 1, first synthesizing the ractopamine hapten, then preparing the immunogen RAC-BSA by a mixed anhydride method, and finally synthesizing the ractopamine coated antigen; the ractopamine hapten is RAC-glutaric anhydride semialdehyde; Step 2, by immunizing New Zealand white rabbits, separating and purifying the serum to obtain RAC-BSA polyclonal antibodies; Step 3, establish the RAC direct competition ELISA method; Step 4, establishing an indirect competitive rt-IPCR method based on anti-RAC polyclonal antibodies; A 209 bp fragment in the pGEM-3Z Vector: GenBank accession number: X65304.3 plasmid was selected, and PCR primers were designed using Primer premier 5.0 and Beacon Designer 7.9, respectively, to prepare biotin-labeled reporter DNA (Bio-DNA) and qPCR primer probes; Using pGEM-3Z Vector plasmid DNA as a template, biotin-reporter DNA (Bio-DNA) was prepared by PCR amplification with biotin-labeled upstream primers; Biotin-RAC polyclonal antibody (Bio-anti RAC pAb) was prepared by coupling biotin and polyclonal antibody using N-hydroxysuccinimide active esterification method (NHS); Step 5, optimizing rt-IPCR conditions, wherein the rt-IPCR conditions include: optimizing SA concentration, optimizing tube washing times, optimizing Bio-DNA addition amount, and selecting the optimal working concentrations of RAC-BSA and Bio-anti RAC pAb; Step six, establish the rt-IPCR system and standard curve.

4. The method for detecting ractopamine based on IPCR according to claim 3, characterized in that: The steps are as follows: First synthesize ractopamine hapten: Weigh ractopamine hydrochloride, add it into a glutaric anhydride solution dissolved in pyridine three times, and stir at room temperature; then blow dry with high-purity nitrogen at room temperature to remove pyridine, and obtain ractopamine hapten RAC-glutaric anhydride semialdehyde; The immunogen RAC-BSA was prepared by the mixed anhydride method: a solvent was added to the synthesized ractopamine hapten, i.e., RAC-glutaric anhydride semialdehyde, wherein the solvent was: DMF and 1,4-dioxane were pre-mixed in a volume ratio of 1:1, dissolved into a solution, pre-cooled on ice, and tributylamine pre-cooled on ice was added, and stirred in an ice bath for reaction; isobutyl chloroformate was added to the reaction solution, and the reaction was stirred at room temperature, and the activated ractopamine was added dropwise to the sodium borate solution containing BSA, and the reaction was stirred overnight; the solution was dialyzed and then used for later use; Finally, the ractopamine-coated antigen is synthesized: a solvent is added to the synthesized ractopamine hapten, i.e., RAC-glutaric anhydride semialdehyde. The solvent is a mixture of DMF and 1,4-dioxane in a volume ratio of 1:1, dissolved into a solution, pre-cooled on ice, and tributylamine pre-cooled on ice is added. The reaction is stirred in an ice bath; after adding isobutyl chloroformate to the reaction solution, the reaction is stirred at room temperature, and the activated ractopamine is added dropwise to the sodium borate solution containing OVA and stirred; the solution is dialyzed and set aside.

5. The method for detecting ractopamine based on IPCR according to claim 3, characterized in that: The step 3 is to establish the specific steps of the RAC direct competition ELISA method:

1. RAC-HRP labeled with horseradish peroxidase (HRP) was synthesized by mixed anhydride method: HRP was added to deionized water, the pH was adjusted with NaOH, and the solution was detoxified with nitrogen; an aqueous solution of 1,4-butylene glycol was added, and the mixture was incubated at room temperature under nitrogen; excess 1,4-butylene glycol was removed by Sephadex G25 to purify and activate HRP; ractopamine was added to the activated HRP, and N,N-dimethylformamide was added to dissolve it completely; the pH was adjusted, the solution was detoxified with nitrogen, the mixture was incubated at room temperature under nitrogen, and it was dialyzed for later use; 2. Establish a standard curve: Dilute the ractopamine standard with PBS and calculate the binding rate according to formula (1-1), where B and B0 are the OD values ​​measured when the standard is added and the RAC concentration is 0, respectively. 450nm The RAC concentration corresponding to the 50% inhibition rate in the standard curve is the half inhibition concentration (IC 50 ), the standard concentration with an inhibition rate of 10% was defined as IC 10 value; Binding rate (%) = B / B0 × 100% Inhibition rate (%) = (1-B / B0) × 100% (1-1) 3. Sample addition recovery experiment: Dilute the RAC solution with a blank pig urine sample and take the supernatant for ELISA detection; calculate the spike recovery rate according to formula (1-2): Recovery rate (%) = measured sample concentration / sample added concentration × 100% (1-2).

6. The method for detecting ractopamine based on IPCR according to claim 3, characterized in that: The specific steps of step 4, establishing an indirect competitive rt-IPCR method based on anti-RAC polyclonal antibodies, include:

1. Design PCR primers, prepare biotin-labeled reporter DNA (Bio-DNA) and qPCR primer probes: PCR primer 3Z SET-15F3: Biotin-GTAACGCCAGGGTTTTCC SEQ ID No: 01; PCR primer 3Z SET-15B3: GCGGATAACAATTTCACACAG SEQ ID No: 02; Fluorescence quantitative PCR primer 3Z FP: GCTTGAGTATTCTATAGTGTC SEQ ID No: 03; Fluorescence quantitative PCR primer 3Z RP: AGCGGATAACAATTTCAC SEQ ID No: 04; Fluorescence quantitative PCR primer Probe-FAM: CAGCTATGACCATGATTACGCCAAG SEQ ID No: 05; 2. Preparation of Biotin-Reporter DNA (Bio-DNA): Using pGEM-3Z Vector plasmid DNA as a template, PCR amplification was performed with biotin-labeled upstream primers to prepare Bio-DNA. After the amplification results were detected by electrophoresis, the target band was cut out under ultraviolet light and recovered according to the instructions of the gel recovery kit; the absorbance of DNA at OD260nm and OD280nm was measured, and the Bio-DNA concentration was calculated using formula (1-3): Bio-DNA concentration (ng / uL) = OD260 × dilution factor × 40 (1-3); 3. Preparation of biotin-RAC polyclonal antibody (Bio-anti RAC pAb): Antibody preparation: RAC polyclonal antibody (anti-RAC pAb) was dialyzed with 0.1 M CB buffer at 4°C for 24 h, with the buffer changed every 8 h on average; the antibody concentration and CB buffer volume were recorded; Activation of NHS-D-Biotin: Dissolve NHS-D-Biotin in DMSO to a final concentration of 22 mg / mL. Make sure to use it immediately and store it away from light. Depending on the antibody concentration, the activated NHS-D-Biotin was diluted to a molar ratio of antibody to NHS-D-Biotin of 48:1, 24:1, or 12:1; Antibody-biotin connection: Take 10% volume of activated NHS-D-Biotin from antibody solution (solution A) and slowly add it dropwise into solution CB while stirring gently; After the addition, continue to stir gently at 25°C in the dark for 13 h; Dialysis: The marker was dialyzed with 0.01M PBS buffer at 4°C for 72 h, with the buffer changed every 8 h on average; The dialysate was recovered, and the antibody concentration was determined according to formula (1-4), and stored at -20°C for later use; C (mg / mL) = [1.55×(A280-A320)-0.76×(A260-A320)]×n, where n is the dilution multiple (1-4).

7. The method for detecting ractopamine based on IPCR according to claim 3, characterized in that: The specific contents of step 5, rt-IPCR condition optimization include: SA concentration optimization: Select SA at each dilution multiple to optimize the concentrations of Bio-anti RAC pAb and Bio-DNA; the best one is the one with the smallest Ct value at the standard concentration of 0 ng / mL and the largest Ct value difference (ΔCt) between the standard concentrations of 1 ng / mL and 0 ng / mL; Optimization of pipe washing times: The discarded liquid containing Bio-DNA, the liquid washed 5 times with PBST solution and the liquid washed 5 times with ddH2O were recovered and subjected to PCR and rt-qPCR experiments; Optimization of Bio-DNA addition amount: Based on the known concentration of Bio-DNA, the optimized scheme of serial dilution was adopted, and the dilution ratios were 1:1600, 1:3200, 1:6400, 1:12800, 1:25600, and 1:51200, respectively. The actual amount of Bio-DNA added was 1.41ng, 0.70ng, 0.35ng, ​​0.175ng, 0.0875ng, and 0.044ng. Selection of optimal working concentrations of RAC-BSA and Bio-anti RAC pAb: A checkerboard assay was performed in a 0.6% glutaraldehyde-treated PCR tube with 0.5, 1, and 2 ug / mL RAC-BSA and Bio-anti RAC pAb at dilutions of 1:500, 1:1000, 1:2000, and 1:4000, respectively, to determine the optimal working concentrations of the coating antigen and Bio-antiRAC pAb; the optimal antigen-antibody working concentration was selected with the smallest Ct value at a standard concentration of 0 ng / mL and the largest Ct value at a standard concentration of 1 ng / mL.

8. The method for detecting ractopamine based on IPCR according to claim 3, characterized in that: The specific contents of step 6, establishing the rt-IPCR system and the standard curve include: An indirect competitive rt-IPCR assay for ractopamine was established. The specific steps are as follows: Coating: dilute RAC-BSA to the optimal working concentration with CB coating solution, add to the PCR tube pretreated with glutaraldehyde at the optimal concentration, overnight; Blocking: Pour off the blocking solution in the tube, wash with PBST; add 1% skim milk sodium carbonate solution to block; Indirect competition reaction: Pour off the blocking solution, wash with PBST, add the standard and Bio-anti RAC pAb diluted to the optimal working concentration, and incubate; Bio-anti RAC pAb reacts with SA: Pour off the liquid in the tube, wash with PBST, and add SA diluted to the optimal working concentration for incubation; SA and Bio-DNA reaction: Pour off the liquid and wash with PBST; add Bio-DNA diluted to the optimal working concentration of 1:6400 and incubate; Detection: After discarding the liquid, wash with PBST and sterile ultrapure water for 5 times, add 20μL of fluorescent quantitative PCR reaction system: 2×SensiFAST Mix Probe Lo-ROX 10μL, 10μM FP 0.8μL, 10μM RP 0.8μL, 10μM Probe 0.2μL, ddH2O 8.2μL, and amplify; the reaction program is: 95℃120s, 95℃10s, 60℃26s, Go to Step2and Repeat 39×; The method for establishing the standard curve is: Add 10-fold gradient dilution of RAC standard: 0, 0.001, 0.01, 0.1, 1, 10, 100 ng / mL, add 20 μL of fluorescent quantitative PCR reaction system: 2×SensiFAST Mix Probe Lo-ROX 10 μL, 10 μM FP 0.8 μL, 10 μM RP0.8 μL, 10 μM Probe 0.2 μL, ddH2O 8.2 μL, use Taq man probe method for amplification, collect fluorescence curve; establish standard curve with logarithm of ractopamine standard concentration as horizontal axis and Ct value as vertical axis; determine the linear range of rt-IPCR through standard curve; and calculate 50% inhibition rate IC according to standard curve. 50 Value; IC 50 The value is defined as the RAC concentration corresponding to the average of the Ct value of the 0 ng / mL standard and the Ct value of the 100 ng / mL standard; at the same time, the Ct values ​​of 8 wells with a concentration of 0 ng / mL were continuously measured, and the standard curve was used to calculate the average value and standard deviation. Combined with the obtained linear equation, the minimum detection limit (LOD) was determined according to formula (1-5); The lowest limit of detection (LOD) = the mean value of negative sample detection + 3 times the standard deviation (SD) (1-5).

Images